ID: 1084679187

View in Genome Browser
Species Human (GRCh38)
Location 11:70656139-70656161
Sequence GCCCCATGTTGTGGGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084679182_1084679187 23 Left 1084679182 11:70656093-70656115 CCTTAGCACATGTCGTGAACTTC 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1084679187 11:70656139-70656161 GCCCCATGTTGTGGGAGTGAAGG 0: 1
1: 0
2: 1
3: 14
4: 178
1084679183_1084679187 -8 Left 1084679183 11:70656124-70656146 CCTGTGATCTCTCCAGCCCCATG 0: 1
1: 0
2: 2
3: 26
4: 340
Right 1084679187 11:70656139-70656161 GCCCCATGTTGTGGGAGTGAAGG 0: 1
1: 0
2: 1
3: 14
4: 178
1084679181_1084679187 26 Left 1084679181 11:70656090-70656112 CCTCCTTAGCACATGTCGTGAAC 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1084679187 11:70656139-70656161 GCCCCATGTTGTGGGAGTGAAGG 0: 1
1: 0
2: 1
3: 14
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084679187 Original CRISPR GCCCCATGTTGTGGGAGTGA AGG Intronic
900138280 1:1127989-1128011 GGCCCGTGCTGTGGGAGTGGGGG + Intergenic
900188266 1:1342930-1342952 GCCCCATGCTGGGGGGGTGGGGG - Intronic
901853343 1:12029604-12029626 GCCCCAGGTTCTGGGAGGAAAGG + Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
902930551 1:19728330-19728352 GCCCCATGGGGTGGTTGTGAGGG + Intronic
904734856 1:32623898-32623920 TCCACGTGTTGTGGGAGGGAGGG + Intronic
905263644 1:36736341-36736363 GCCCCAAGGAGAGGGAGTGATGG - Intergenic
907314456 1:53559570-53559592 GCCGCATGGTGAGTGAGTGATGG - Intronic
910035695 1:82784829-82784851 GCTGCATTTTGTGGGAGTTAGGG + Intergenic
910546571 1:88425404-88425426 GCCTGGAGTTGTGGGAGTGATGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
913531568 1:119737564-119737586 TCCACATGCCGTGGGAGTGAAGG + Intronic
915440966 1:155945259-155945281 GCCCCATGTTCTGGGGCTGAAGG + Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916706176 1:167352825-167352847 TCAACATTTTGTGGGAGTGAGGG - Intronic
919725305 1:200878557-200878579 GCCCCATCATTTGGGGGTGATGG - Intergenic
923689071 1:236175672-236175694 GCCCCATGTTCTCTCAGTGATGG - Intronic
1065650502 10:27884435-27884457 GCCCCATGCTGTGCCAGAGAAGG - Intronic
1068749664 10:60577418-60577440 CCCACCTGTTGTGGGAGGGATGG + Intronic
1069881664 10:71597261-71597283 GCCCCATGTTGGGAGAAAGACGG - Intronic
1070749064 10:78953263-78953285 GGCCCATGTTGGGGGACGGATGG - Intergenic
1071600612 10:86957097-86957119 GCCCCATGCTGGGTGATTGATGG + Intronic
1072019557 10:91384401-91384423 TCTCCATGCTGTGGGAGTGTGGG + Intergenic
1073803894 10:107074199-107074221 GCCCGGTGTTGGGGGAGTGCAGG - Intronic
1076273321 10:129175151-129175173 GCCCCAGGATGTGGGACTGCCGG - Intergenic
1076716139 10:132364829-132364851 GCCCCAGGGTGTGGGCGTGGAGG - Intronic
1076724761 10:132408140-132408162 GCCCCCTGCTCTGGGAGTGGGGG + Intronic
1077066105 11:641505-641527 GGCCCAGGTTGTGGGAGAAATGG + Intergenic
1077580409 11:3413731-3413753 CCCGCATGGTGTGGGAGTGTGGG + Intergenic
1077630613 11:3808735-3808757 GCCCCACGCTGTGGGAGTCCTGG + Intronic
1078098389 11:8314049-8314071 GCCTCATGGTGGGTGAGTGAAGG - Intergenic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1081978915 11:47254151-47254173 GCCCCATCTTGTGGGAGTGGGGG - Intronic
1082765533 11:57164601-57164623 GCCACATGTTGTGGGATGAAGGG + Intergenic
1083330730 11:61897259-61897281 GCCCCAGGGTGCAGGAGTGAGGG + Intergenic
1083680880 11:64351389-64351411 GCCCCATGCAGTGTGAGTGTGGG + Intronic
1084237335 11:67796560-67796582 CCCACATGGTGTGGGAGTGTGGG + Intergenic
1084679187 11:70656139-70656161 GCCCCATGTTGTGGGAGTGAAGG + Intronic
1084835067 11:71796268-71796290 CCCGCATGGTGTGGGAGTGTGGG - Intronic
1088174620 11:107037728-107037750 GCCCCATCTTGTGGTAGTCCAGG + Intergenic
1089057795 11:115600784-115600806 GCCCTATGTCTTGAGAGTGAGGG - Intergenic
1091615899 12:2051567-2051589 GCCCCAGGTGGTGGCAGTGCAGG + Intronic
1092020745 12:5200464-5200486 GGCCCAGTATGTGGGAGTGAGGG + Intergenic
1095352547 12:41231472-41231494 CTCCCATGTTGTTAGAGTGATGG + Intronic
1095751244 12:45713638-45713660 AGCCCATTTTGTGGGAGTGAGGG - Intergenic
1095777479 12:46025418-46025440 TCCCCATCTTGTGGGGGAGAGGG + Intergenic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096796488 12:54081280-54081302 CCTCCAGGTTGTGGGAGAGAAGG - Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1099467495 12:83005535-83005557 TCCCCATGCTCTGAGAGTGACGG + Intronic
1103340051 12:120216359-120216381 GCCCCATGATGAGGGGGTGCAGG - Intronic
1104324739 12:127785492-127785514 GCCCCATGTTTGGGGAGACAAGG + Intergenic
1104899078 12:132178521-132178543 GCCCCATGTAAGGGGAGTGGGGG - Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1111330851 13:86761075-86761097 GCCCCCTGCTGTAGTAGTGAAGG + Intergenic
1112568384 13:100570513-100570535 CCCACATGTTGTGGGAGGGCAGG - Intronic
1119410563 14:74427422-74427444 CCCACATCCTGTGGGAGTGAAGG - Intergenic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1121338251 14:93090126-93090148 GGCCCAAGTGGTGGGGGTGAGGG - Intronic
1122695107 14:103548621-103548643 CACCCATGTTGGGGGAGTCAGGG - Intergenic
1124252609 15:28116918-28116940 GCCACATGGTGTGGGAGCGTTGG - Intronic
1124354382 15:28984222-28984244 GGGCCATGCTGGGGGAGTGAGGG + Intronic
1128565032 15:68695388-68695410 GCCCCACGATGTGGGGGGGATGG + Intronic
1128602702 15:69011267-69011289 GCTCCAGCTTGTGGGTGTGAAGG + Intronic
1129616284 15:77100984-77101006 GCCCCTTGCTGAGGGAGGGAGGG + Exonic
1129883939 15:79025747-79025769 GGCCCATGTGGTGAGAATGAAGG + Intronic
1131072936 15:89477304-89477326 TCCCCATGTTGTGGGTGGGAAGG - Intronic
1132294689 15:100726477-100726499 GCCCCATGGTGAGTCAGTGAGGG - Intergenic
1132726122 16:1339067-1339089 GCCCCAGGAGGTGGGAGCGAGGG - Intronic
1133348951 16:5088983-5089005 CCCCCATGGTGTGGGAGTGTGGG + Intronic
1137584495 16:49656108-49656130 GCCCCACGTTGGGGCAGTGTAGG + Intronic
1139266082 16:65639779-65639801 GGACCATGTTGTAGCAGTGAGGG - Intergenic
1139657275 16:68396552-68396574 GCCCCAGGGTGTGAGACTGAGGG - Intronic
1142820525 17:2462957-2462979 GCCACATGTTGTTGAAATGATGG - Intronic
1144281889 17:13734549-13734571 CCCACATGTTGTGGGAGGGACGG + Intergenic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1147911473 17:43858580-43858602 GCCCCTTGTTGAGGGAAAGATGG + Intronic
1149077012 17:52607654-52607676 CCCACATGTTGAGGGAGGGAGGG + Intergenic
1150492990 17:65587182-65587204 GCTCCCTGTTGTGGGCGTGTTGG + Intronic
1155546987 18:26925910-26925932 GCTACATGTTGTGAGAGAGAAGG - Intronic
1158297077 18:56010149-56010171 CCCACATGCTGTGGGAGGGACGG - Intergenic
1160786263 19:901384-901406 TCCCCGTGTGGAGGGAGTGAGGG + Intronic
1162737439 19:12754473-12754495 GGCCCAGGTTGTGGGAGAGGGGG - Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1163571562 19:18085162-18085184 GGTCCTTCTTGTGGGAGTGAGGG - Intronic
1163885461 19:19961073-19961095 GCCCCACTGGGTGGGAGTGAGGG - Intergenic
1164309137 19:24030961-24030983 GCCCCATGTGGAGGAAGGGATGG - Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1165100243 19:33434858-33434880 CCTCCCTGTTCTGGGAGTGAAGG + Intronic
1165752378 19:38268105-38268127 GCCCCACCGTGTGAGAGTGAGGG + Intronic
1168132866 19:54332187-54332209 GCCTGACGTTGTGGGGGTGAGGG + Intergenic
926117400 2:10222106-10222128 ACCCCATGTAGTGGGAGTTAGGG + Intergenic
927177837 2:20422706-20422728 ACCCCATGTTGTGGGAGAATGGG - Intergenic
929589165 2:43134053-43134075 GCCACATGGTGTGCGCGTGAGGG + Intergenic
929802139 2:45113073-45113095 GCCCCATGCTGTAGGAGCCAAGG - Intergenic
931145486 2:59512373-59512395 GCCCCATGTTGTGTCTTTGAGGG - Intergenic
933065719 2:77792997-77793019 GCCCCCTGGTTTGGCAGTGAAGG + Intergenic
933083890 2:78030079-78030101 TCCTTATGTTGTGGGAGTGCTGG + Intergenic
935562844 2:104576409-104576431 GCCCCGTGAGGTGGGTGTGACGG - Intergenic
941885819 2:170526002-170526024 GCAGCATGATGTGGGAGTGGTGG + Intronic
942427273 2:175873204-175873226 CCCCCAAGTTCTTGGAGTGATGG + Intergenic
945218510 2:207460748-207460770 GCCTCTTGTTGTAGGAGTGCAGG + Intergenic
948550056 2:238765262-238765284 GGCCCAGGGTATGGGAGTGAGGG - Intergenic
948676236 2:239598518-239598540 GCCTCTTGCTGTGGGAGGGAAGG - Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1168831487 20:847465-847487 TCCCCATGCTGAAGGAGTGATGG + Intronic
1172762361 20:37331695-37331717 GGCCCACGTTGTGGCAGGGAGGG + Intergenic
1175884087 20:62279028-62279050 GCCACATGTTGTGGCATGGAGGG + Intronic
1178719414 21:34995106-34995128 GTGCCATGTTGGGGGACTGAGGG + Intronic
1181530527 22:23514554-23514576 GCCCCATGTGGTGGGAGGCTGGG - Intergenic
1183983755 22:41557927-41557949 CCCCCATGTTGTTTGAGTGATGG - Intergenic
1185088616 22:48753842-48753864 GTTCCATGATGTGGGAGTGGCGG - Intronic
950715078 3:14842210-14842232 GCCACATGTTGAGGGAGCAAGGG - Intronic
951046935 3:18050385-18050407 GCCTCATCTTGTGGGGATGATGG - Intronic
951520762 3:23609123-23609145 GCCCCAATTTGTGGGAGTTGAGG + Intergenic
951809850 3:26687016-26687038 GCCCCAGCTTCTGGGAGTGTTGG - Intronic
956761524 3:72448228-72448250 GCCCCAGGTTAGGGGAGGGACGG + Intergenic
957053281 3:75426326-75426348 CCCGCATGATGTGGGAGTGTGGG + Intergenic
960399378 3:117177539-117177561 GCCCAAAGTTGTGGGATTGCAGG + Intergenic
961016093 3:123469590-123469612 GCCCCATTTTGTGGGTGAGGTGG + Intergenic
961301546 3:125925217-125925239 CCCGCATGGTGTGGGAGTGTGGG - Intergenic
961511071 3:127404088-127404110 TCCCCAGGTTGGGGAAGTGATGG - Intergenic
961835800 3:129658266-129658288 AGTCCATGTTGTGGGAGTGAAGG - Intronic
961886924 3:130102640-130102662 CCCGCATGGTGTGGGAGTGTGGG + Intronic
962275629 3:134011379-134011401 GGCCCATGATGTGGGAGTCCTGG + Intronic
964416390 3:156452527-156452549 GCCACATGTTCTGAAAGTGAAGG - Intronic
964690554 3:159444879-159444901 ACCTGATGTTGAGGGAGTGAAGG + Intronic
966872877 3:184303108-184303130 GCCCCTTGTATTGGGAGTGATGG + Intronic
966911775 3:184563897-184563919 GGCCCTTGTTGTGGGTGTGGTGG + Intronic
968996082 4:3946644-3946666 CCCGCATGGTGTGGGAGTGTGGG + Intergenic
969364651 4:6687160-6687182 GCTCCATGTGGCGGGAGTCAGGG - Intergenic
969817883 4:9699596-9699618 CCCGCATGGTGTGGGAGTGTGGG - Intergenic
971256330 4:25017000-25017022 GCCCCATGTTGTGACAGTGGAGG + Intronic
973852594 4:54976170-54976192 GCCCCCTGGTTTGGCAGTGAAGG - Intergenic
978552610 4:109943890-109943912 TCTCGATGGTGTGGGAGTGAAGG + Exonic
978567812 4:110102901-110102923 CCCACGTGTTGTGGGAGGGATGG + Intronic
981760103 4:148184953-148184975 GCCCCATGTTTTGGTAATGGTGG - Intronic
983790230 4:171787433-171787455 GCTCCATGTTGTGTGAGTACTGG + Intergenic
985990920 5:3560585-3560607 GCCCAGTGTTGTGGGAGTGGAGG - Intergenic
986308175 5:6531094-6531116 GCCCCATGGAGCAGGAGTGAAGG - Intergenic
986883764 5:12208529-12208551 GCTCCATGTTCTGAGAGTGTGGG + Intergenic
987570412 5:19650253-19650275 GCCCAATGTTTTGGGAAAGAGGG - Intronic
988619179 5:32805000-32805022 ACCCAAGGTTGTGGGTGTGAGGG + Intergenic
991601278 5:68353736-68353758 CCCCCATGCTGTTGGAGTGGGGG + Intergenic
992793468 5:80234513-80234535 GCCCTTTGTGGTGGGAGTGGTGG - Intronic
996459472 5:123725073-123725095 GCCAGGTGTTGTGGGAGGGATGG - Intergenic
997827757 5:137122920-137122942 GCCCCCTGTTCTGGGAGGGCTGG + Intronic
999152318 5:149434425-149434447 GGCCCATGTGGTGGCATTGAGGG - Intergenic
1001401496 5:171449027-171449049 GCCTGATTTTGGGGGAGTGAGGG + Intronic
1002081191 5:176738452-176738474 TCCCCATGGTGAGGGTGTGAGGG + Intergenic
1002761820 6:208393-208415 TCCCCATGTTGTGTGAGAGCAGG - Intergenic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1006621858 6:35370872-35370894 GCCCCATGGTGGGGCAGTTAAGG + Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007579135 6:42945534-42945556 GCTCCATGTTGTGTGTTTGAGGG + Intergenic
1014146918 6:118008533-118008555 GCCCAATATTCTGTGAGTGATGG - Intronic
1017343437 6:153353269-153353291 CCCCCAACTTCTGGGAGTGACGG - Intergenic
1019075308 6:169382454-169382476 ACCAGATGTGGTGGGAGTGAGGG + Intergenic
1019351827 7:557621-557643 CGCCCATGTCGTGGGAGTGCTGG - Intronic
1019909259 7:4089279-4089301 GCCACACGTTGTGGGTGTGGAGG + Intronic
1020320355 7:6935054-6935076 CCCGCATGGTGTGGGAGTGTGGG + Intergenic
1022845749 7:34208162-34208184 ACCCGGTGTTGTGGGACTGAGGG - Intergenic
1023981464 7:45073099-45073121 GCCCCAGGTGGTGGCAGAGATGG - Intronic
1026219233 7:68378056-68378078 GCCCAATTTTGTCGGAGAGAGGG - Intergenic
1028968855 7:96833985-96834007 GCCCCATATTATGTGATTGATGG + Intergenic
1033106294 7:138528335-138528357 TCCCCATGTTGGGGGAGTGCTGG + Intronic
1033238354 7:139656286-139656308 GCCCCGTTTTGTGGGGGTGGAGG - Intronic
1037560164 8:20066194-20066216 GCCCCATGTGAAAGGAGTGATGG - Intergenic
1039230273 8:35438952-35438974 GACCCCTGTTCTGGGAGAGATGG + Intronic
1039839200 8:41281363-41281385 CCCCCATGCTGAGGGAGTGAGGG - Intronic
1039965426 8:42280461-42280483 GCAGCATGTTTTGGGAGTGGGGG + Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1044752811 8:95432208-95432230 GCACCCTTTTGTGGGAGGGAGGG + Intergenic
1047733700 8:127747554-127747576 GACCCATTTTGATGGAGTGAAGG + Intergenic
1048008488 8:130438276-130438298 GCCCCATCTTCTGAGAGTAAAGG - Intronic
1052799859 9:32956957-32956979 GCCCCATGTAGGGGGTGGGAGGG + Intergenic
1056765317 9:89441511-89441533 GGCCCATGATGTGGGAATGGGGG - Intronic
1056837375 9:89967640-89967662 GTCCTGTGTTGTGGCAGTGAGGG + Intergenic
1056846129 9:90039718-90039740 GCCTCATGGTGTGGGTGTGAAGG - Intergenic
1057892427 9:98879595-98879617 GCTCTTTGTGGTGGGAGTGAGGG + Intergenic
1060421526 9:123472787-123472809 GCCCCGTGTTATGGGAATGCAGG - Intronic
1060704142 9:125782344-125782366 CCCACATGTTGTGGGAGGGGAGG - Intronic
1061194565 9:129100726-129100748 GTCTCATGGTGTGGGAGAGATGG + Intronic
1061327966 9:129875487-129875509 GCCCCCTGTGGTGGGAGAGCAGG + Intronic
1061846382 9:133390809-133390831 CCCCCAGGTTGTGGGAGAGGGGG + Intronic
1062410560 9:136422077-136422099 GCCCCAGATTCTGGGTGTGATGG - Intronic
1062460932 9:136662315-136662337 GGCCCATGGTGAGGGGGTGACGG - Intronic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1190528517 X:51351815-51351837 TCCACGTGTTGTGGGAGGGACGG - Intergenic
1190909379 X:54757687-54757709 GCCCCAAGTTGGGGGTGCGATGG + Exonic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic