ID: 1084680102

View in Genome Browser
Species Human (GRCh38)
Location 11:70662033-70662055
Sequence CGCTGCCGCCGCCGCCGTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 640
Summary {0: 1, 1: 0, 2: 8, 3: 98, 4: 533}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084680102_1084680111 18 Left 1084680102 11:70662033-70662055 CCCGAACGGCGGCGGCGGCAGCG 0: 1
1: 0
2: 8
3: 98
4: 533
Right 1084680111 11:70662074-70662096 GCGTCGGGAATGAGCTCCTCCGG 0: 1
1: 0
2: 0
3: 0
4: 44
1084680102_1084680109 3 Left 1084680102 11:70662033-70662055 CCCGAACGGCGGCGGCGGCAGCG 0: 1
1: 0
2: 8
3: 98
4: 533
Right 1084680109 11:70662059-70662081 GCCTCAGCAGCGGCGGCGTCGGG 0: 1
1: 0
2: 1
3: 15
4: 221
1084680102_1084680107 -4 Left 1084680102 11:70662033-70662055 CCCGAACGGCGGCGGCGGCAGCG 0: 1
1: 0
2: 8
3: 98
4: 533
Right 1084680107 11:70662052-70662074 AGCGGCGGCCTCAGCAGCGGCGG 0: 1
1: 1
2: 6
3: 73
4: 634
1084680102_1084680106 -7 Left 1084680102 11:70662033-70662055 CCCGAACGGCGGCGGCGGCAGCG 0: 1
1: 0
2: 8
3: 98
4: 533
Right 1084680106 11:70662049-70662071 GGCAGCGGCGGCCTCAGCAGCGG 0: 1
1: 0
2: 7
3: 104
4: 837
1084680102_1084680108 2 Left 1084680102 11:70662033-70662055 CCCGAACGGCGGCGGCGGCAGCG 0: 1
1: 0
2: 8
3: 98
4: 533
Right 1084680108 11:70662058-70662080 GGCCTCAGCAGCGGCGGCGTCGG 0: 1
1: 0
2: 2
3: 43
4: 453

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084680102 Original CRISPR CGCTGCCGCCGCCGCCGTTC GGG (reversed) Intronic
900512975 1:3069053-3069075 CGCCGCCGCCGCCGCCGCCTCGG - Intergenic
901443540 1:9293319-9293341 CGCTGCCGCCGCTGCAGGGCAGG + Intronic
901629009 1:10639208-10639230 CGCCGCCGCCGCCGCAGCTGGGG - Exonic
902350109 1:15847963-15847985 AGCCGCCGCCGCCGCCGCCCCGG + Exonic
903077908 1:20786660-20786682 CGCCCCCGCCGCCGCCATTACGG - Exonic
903115532 1:21176303-21176325 TGCCGCCGCCGCCGCCGCTCCGG + Exonic
903263485 1:22143258-22143280 GGCGGCAGCCGCCGCCGCTCCGG - Intronic
903324742 1:22563451-22563473 CGCCGCCGCCGCCGCCGCCCCGG - Intergenic
903398296 1:23019622-23019644 CGCTGCAGCCGCCGCCGCCGCGG - Exonic
903750212 1:25616799-25616821 CCCCGCCGCCGCCGCCGCTCGGG - Intergenic
903777141 1:25800350-25800372 CGCCGCTGCCGCCGCCGTCCGGG + Exonic
904039295 1:27575175-27575197 CGCCGCCGCCGCCGCCTCTGGGG + Intronic
904641988 1:31938059-31938081 CGCCGCCGCCGCCGCCGCCGAGG - Exonic
904642013 1:31938139-31938161 CGCCGCCGCCGCCGCCGGGCCGG - Exonic
904642058 1:31938373-31938395 AGCTCCCGCCGCCGCCCCTCAGG + Exonic
904738851 1:32656268-32656290 CACTGCAGCCTCCGCCTTTCGGG + Intronic
904769067 1:32870913-32870935 CGCCGCCACCGCCGCCGCGCGGG - Intronic
904822829 1:33256455-33256477 CGCCGCCGCCGCCGCCGCCTCGG + Intergenic
904822951 1:33256822-33256844 CGCCGCCGCCGCCGCCGCTCTGG - Intronic
905167052 1:36088909-36088931 CGCTGCCGCCATCGCCGCTGCGG - Exonic
905449285 1:38046642-38046664 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
905679655 1:39859505-39859527 CGCTGCAGCCTCCGCCTTCCAGG - Intronic
905862636 1:41361483-41361505 TGCTGCCGCCGCCGCCGCTCCGG - Intergenic
905867030 1:41382128-41382150 CCGCGCCGCCGCCGCCGTGCAGG - Exonic
906204395 1:43979335-43979357 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
906637015 1:47416490-47416512 GGCCGCCGCCGCCGCCGCCCCGG - Exonic
906640560 1:47438395-47438417 CGCTGCGGCCGCCGCCCCCCGGG - Exonic
906960920 1:50419099-50419121 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
906961419 1:50421483-50421505 CGCCGCCGCCGTCGCCGCGCCGG + Exonic
907222990 1:52921176-52921198 CGCTGCCTCCGCCCCCGAACCGG + Intronic
907429965 1:54406049-54406071 CGCCGCCGCCGCTACCGCTCCGG + Exonic
908527581 1:65002685-65002707 CGCCTCCGCCGCCGCCGGCCAGG - Intergenic
909585282 1:77282097-77282119 CGCTCCCGCCGCCCCCGCTTCGG - Exonic
910448995 1:87328536-87328558 CGCCGCCGCCGCCTCCGAGCCGG + Exonic
911664732 1:100539689-100539711 CGCCGCCGCCGCCGCCTTCCCGG + Exonic
912246338 1:107965123-107965145 CGCGGCAGCCGCCGCCGAGCCGG - Exonic
912305199 1:108560098-108560120 CGCCGCCGCTGCCGCCCGTCTGG - Exonic
912515070 1:110211988-110212010 CGCCGCTGCCGCCTCCGTCCGGG - Exonic
913565562 1:120069428-120069450 CGCCGCCGCCGCCGCCGCCTGGG + Exonic
913632568 1:120724125-120724147 CGCCGCCGCCGCCGCCGCCTGGG - Intergenic
914619316 1:149390799-149390821 CGCCGCCGCCGCCGCCGCCTGGG - Intergenic
915246348 1:154558628-154558650 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
915409298 1:155688313-155688335 CGCCGCTGCCGCCGCCATTTTGG - Exonic
916065505 1:161132641-161132663 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
916065512 1:161132650-161132672 CGCCGCCGCCGCGGCCGTGGGGG + Exonic
916588303 1:166166614-166166636 CGCTGCCGCCTCCTCCTCTCCGG - Exonic
917817437 1:178725254-178725276 CGCCGCCGCCGCTGCCGCTCGGG - Exonic
919712095 1:200738936-200738958 AGCCGCCGCCGCCGCCGCTGCGG - Intergenic
920924525 1:210329071-210329093 CGTTGCCGTCGCCGCCGCCCGGG + Exonic
921023823 1:211259632-211259654 CGCTGCCGCCGCCGCCTGCCGGG - Exonic
921155066 1:212432953-212432975 CGCAGCCGCCGCCGCGGCGCGGG - Exonic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
922558193 1:226548927-226548949 CGCCGCCGCCGCCGCCGTCTCGG - Exonic
922739343 1:228006816-228006838 CAACGCCGCCGCCGCGGTTCGGG + Intergenic
922958622 1:229626017-229626039 CGCCGCCCCCGCCGCCGCTCTGG + Exonic
923141332 1:231163149-231163171 CGCCGCCGCCGCTGCCTCTCTGG + Exonic
923171552 1:231421885-231421907 CGCCGCCGCCGCCGCCGCCATGG - Exonic
923506410 1:234609627-234609649 CGCCGCCGCCGCCGCCTTTGCGG - Intergenic
924289724 1:242524715-242524737 CCCCGCCGCCGCCGCCGCCCCGG - Intergenic
924527429 1:244864398-244864420 CGCAGCCGCAGCCGCCGCCCGGG - Exonic
924754786 1:246931492-246931514 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
924754889 1:246931846-246931868 CGCTGCTCCCGCCGCGCTTCTGG + Intronic
1063174349 10:3538166-3538188 TGCTGCCGCTGCCGCCCTTTAGG - Intergenic
1064208971 10:13347776-13347798 CGCCGCCGCCGCCGCCGCGCGGG - Intronic
1064443167 10:15371233-15371255 CGCCGCCGCCGCGGCTCTTCGGG - Intergenic
1064443172 10:15371242-15371264 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1064645441 10:17454592-17454614 TGCTGCCGCCGCCGCCGCGCGGG + Intergenic
1064712435 10:18140768-18140790 CGCCACCGCCGCCGCCGCTGTGG - Exonic
1065023093 10:21516899-21516921 CGCCGCCGCCGCCGCCGCCTTGG + Exonic
1065883823 10:30059507-30059529 CGCCGCCACCGCCGCCGCTCCGG + Exonic
1066464523 10:35640838-35640860 CCCTGCCGCCGCCGCGGTGCGGG + Exonic
1066464807 10:35641993-35642015 CGCCGCCGCCGCCGGAGTTGGGG + Exonic
1069019171 10:63466092-63466114 CGCTGCCGCCTCCGCAGGGCCGG - Intergenic
1070140326 10:73733399-73733421 CGCTGCCGCCGCCCCGTCTCGGG - Intergenic
1070800780 10:79243342-79243364 CGCCGCCGCCGCCGCCGAGGAGG - Intronic
1070800862 10:79243664-79243686 CGCCGCGGCCGCCGCCGGCCGGG + Intronic
1071309534 10:84329061-84329083 CGCGGGCGCCGCCGCCTTTCAGG + Intronic
1071695428 10:87864082-87864104 AGCCGCCGCCGCCGCCGTGTTGG - Exonic
1072123034 10:92420647-92420669 CGCTCCAGCCGCGGCCGTTAAGG - Intergenic
1072409069 10:95183875-95183897 ACCTGCCGCCGCCGCCGCCCCGG + Intergenic
1072719503 10:97771935-97771957 CGCCGCCGCCGCCGCCGCGGAGG + Exonic
1072915540 10:99535511-99535533 CGCCGCCGCCGCCGCCCGCCGGG - Exonic
1073058284 10:100715767-100715789 CACCGCCGCCGCCGCCTGTCAGG - Intergenic
1073414236 10:103368118-103368140 CGTTCCCGCCGCCGCCGTTGGGG - Exonic
1074169678 10:110919828-110919850 CGCCGCCGCCGCCGCTTTCCTGG + Intronic
1074169718 10:110919950-110919972 CGCCGCCGCCGCCGCAGGCCCGG - Intronic
1074182578 10:111077294-111077316 CCCCGCCGCCGCCGCCGTCCCGG + Exonic
1074750994 10:116586817-116586839 CACTGCAGCCTCCGCCTTTCGGG - Intergenic
1074814504 10:117134310-117134332 CGCAGCCGCCGCCGCCGCCCCGG - Exonic
1074843281 10:117375434-117375456 CGCTGCCGCCGCCGCCACACCGG - Exonic
1074865724 10:117543429-117543451 CGCCGCCGCCGCCGCCGGTAGGG + Exonic
1075054589 10:119207835-119207857 CGCTGCTGCTGCCGCTGCTCGGG - Exonic
1075129495 10:119726069-119726091 CGCTGCCGCCGCCGCTGCCGGGG + Intergenic
1075629316 10:123991683-123991705 CGCCGCCGCCGCCACCGCCCCGG - Intergenic
1076554209 10:131311519-131311541 AGCCGCCGCCGCCGCCGCCCTGG - Exonic
1076638910 10:131901015-131901037 CGCCGCCGCCGCCGCCGGGGAGG - Exonic
1076638912 10:131901018-131901040 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
1077214546 11:1389998-1390020 CGCCGCCGCCGCCGCCGCCGAGG - Intronic
1079689409 11:23403540-23403562 CGCCGCCGCCGCCGCGGGACGGG + Intergenic
1081832051 11:46121967-46121989 CGCCGCCGCCGCCGCTGCACTGG - Intergenic
1081925749 11:46826820-46826842 CGCCGCCGCCGCCGCCTGCCGGG - Intronic
1083741419 11:64713474-64713496 CGCAGTCGCCGCCGTCGTCCAGG + Exonic
1084310333 11:68312878-68312900 CGCGGGCGCCGCCGCCGTCTCGG + Intronic
1084680102 11:70662033-70662055 CGCTGCCGCCGCCGCCGTTCGGG - Intronic
1085485667 11:76860952-76860974 CGCCGCCGCCGCCGCCGCCCAGG - Exonic
1085561272 11:77474211-77474233 CGCAGCCGCCGCCGCCGCGCCGG - Intronic
1085643775 11:78209668-78209690 CGCTGTCGCCGCCGCCGCCTGGG + Exonic
1086322324 11:85664225-85664247 AGCGGCCGCCGCCGCCTTCCGGG + Exonic
1086887838 11:92224978-92225000 CGCCGCCGCCGCCGCCGCCGGGG - Intergenic
1087076222 11:94129103-94129125 CGCTGCCTCCGCCGCCGGCGGGG - Exonic
1087672752 11:101127549-101127571 CTCTGCCGCCGCCGCCGGGGCGG - Exonic
1088172849 11:107017878-107017900 AGCTGCCGCTGCCGCCGCCCCGG - Exonic
1088462114 11:110093107-110093129 GGCTGCCGCGGCCGCCGCTAGGG - Intergenic
1089253120 11:117179237-117179259 CGCTGCCACTGCCGCCCTGCCGG + Exonic
1089543664 11:119206281-119206303 CGCCGCCGCCGCCGGCTATCCGG - Exonic
1089966068 11:122655924-122655946 CGCTGCCGCCGCCTCCTGCCTGG + Exonic
1089993427 11:122882898-122882920 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
1091550289 12:1530984-1531006 CGCCGCCGCCGCCGCCGCCCCGG + Intronic
1091558582 12:1594165-1594187 CGCCGCCGCCGCCGCCGCCTCGG + Exonic
1091823166 12:3491295-3491317 CGCCGCCGCCGCCGCCGCGGAGG + Exonic
1092727680 12:11500714-11500736 CGCTGCCGCCGCCACCGCCGGGG + Intronic
1094107887 12:26833032-26833054 CGCAGCCGCCGCCGCCTCCCCGG + Exonic
1094564937 12:31590853-31590875 GGCCGCCGCCGCCGCCGCCCGGG + Exonic
1095958669 12:47820152-47820174 CGGAGCCGCGGCCGGCGTTCCGG - Intronic
1096134591 12:49188801-49188823 CCCCGCCGCCGCCGCAGTGCGGG - Intronic
1096749950 12:53752162-53752184 CGCCGCCGCCGCCGCCTTCCAGG + Intergenic
1096983740 12:55743399-55743421 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1098369169 12:69738996-69739018 CGCGGCCGCTGCCGGCGCTCAGG - Intronic
1098426061 12:70366537-70366559 CGCTGCCGCCGCCGCCGCCGGGG + Exonic
1100089705 12:90954682-90954704 CGCCGCCGCCACCGCCGCCCAGG + Exonic
1101592898 12:106139193-106139215 CGCCGCCGCCGCCGCCGCCGTGG - Exonic
1101605885 12:106247623-106247645 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1101605887 12:106247626-106247648 CGCCGCCGCCGCCGCCGCGGTGG + Exonic
1102370948 12:112382090-112382112 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1102854053 12:116277794-116277816 CGCCGCCGCCGCCGCCACTCCGG - Intergenic
1103308945 12:119989449-119989471 TGCTGCTGCCGCCGCCGGCCGGG - Intergenic
1103407702 12:120687355-120687377 TGCTGCTGCCGCCGGCGATCCGG + Exonic
1103433023 12:120904098-120904120 CGCCGCCGCCGCCGCGGGTGAGG - Exonic
1103433035 12:120904141-120904163 CGCCGCCGCCGCCGCCATGTTGG - Exonic
1103509923 12:121467259-121467281 CGCCGCCGCCGCCGCCCGCCCGG + Intronic
1103527799 12:121579366-121579388 CTCTGCCGCCGCGGCCGCTGGGG - Intronic
1103528051 12:121580480-121580502 CGCAGGCGCCGCCGCCGCCCGGG + Intronic
1103649638 12:122422634-122422656 CGCCGCCGCCGCCGCGGGGCCGG + Intergenic
1103764124 12:123269804-123269826 CGCTGCCGCCGCTGCTCCTCCGG - Intronic
1103764667 12:123271659-123271681 CGCCGCCGCCGCCGCCCTCGCGG - Exonic
1103910081 12:124347290-124347312 CACTGCAGCCTCCGCCTTTCAGG - Intronic
1105943642 13:25171586-25171608 CCCCGCCGCCGCCGCGGCTCCGG + Exonic
1106208405 13:27620500-27620522 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
1106340284 13:28820398-28820420 CGCCGCCGCCGCCGGCTCTCAGG + Exonic
1106956251 13:34942351-34942373 CGCTGCTGCCGCCGCTGCTACGG - Exonic
1107604014 13:42040754-42040776 GGCCGCCGCCGCCGCCGCCCCGG - Intronic
1107624841 13:42272044-42272066 CGCCGCCGCCGCCGCAGCTCCGG - Intergenic
1107779105 13:43879516-43879538 CGCTGCTGCCTCAGCAGTTCCGG - Exonic
1108541498 13:51451736-51451758 CGCCGCCGCCGCTGCCGGGCCGG + Intronic
1110604259 13:77412706-77412728 CGCTGCAGCCACCGACATTCTGG - Intergenic
1111999347 13:95195707-95195729 CGCTGCAGCCTCCGCCTCTCCGG + Intronic
1112216315 13:97434311-97434333 CGCCGCCGCCGCCGGCGCCCAGG + Exonic
1112507810 13:99985444-99985466 CGCCGCTGCCGCCGCCGCTGGGG - Exonic
1113378529 13:109784442-109784464 CACCGCCGCCGCCGCCGTCTCGG + Exonic
1113378632 13:109784820-109784842 GGCCGCCGCAGCCGCCGCTCAGG + Exonic
1113656040 13:112068236-112068258 CGCCGCCGCCGCCACCGAGCCGG - Exonic
1113656099 13:112068501-112068523 GGCCGCCGCCGCCGCCGCTGCGG + Exonic
1113656115 13:112068545-112068567 CGCCGCCGCCGCCGCCGCCACGG - Exonic
1113886000 13:113658635-113658657 CGCTGCGGCCGCCCCGATTCTGG + Intergenic
1114463293 14:22902043-22902065 TGCTGCTGCCGCCGCCGCCCAGG - Exonic
1115320819 14:32077370-32077392 CGCTGCCGCCGCCACCGCCGGGG + Exonic
1115399235 14:32939123-32939145 CGCCGCCGCCGCCGCCGCCACGG + Intronic
1115755013 14:36520745-36520767 CGCTCCAGCCGCCGGGGTTCAGG - Intronic
1116657969 14:47674982-47675004 CGCCGCCGCCGCCGCAGCTGCGG - Intergenic
1116821762 14:49634051-49634073 CGCCGTCGCCGCCGCCGCGCCGG - Exonic
1116928621 14:50668085-50668107 CGCCTCCGCCGCCGCCTGTCCGG + Exonic
1116945250 14:50830571-50830593 CGCAGCCGGCGCAGCGGTTCCGG + Intronic
1117176735 14:53153217-53153239 CGCCGCTGCCGCCGCAGCTCGGG - Intronic
1117353515 14:54902669-54902691 CGCCGCAGCCGCTGCCGTTCGGG + Exonic
1117424418 14:55580243-55580265 CGCCGCCGCCGCAGTCGCTCAGG - Intronic
1117690391 14:58299346-58299368 CGCTGCCGCCACCGCGGGCCCGG + Intronic
1117875893 14:60249620-60249642 GGCTGCCGCCGCCGCCGCCTCGG + Intronic
1118210514 14:63761879-63761901 TGCAGCTGCCGCCGCCGCTCGGG - Intergenic
1118607700 14:67515405-67515427 CGCCGCCGCCGCCGCCGCCGGGG - Intronic
1118849479 14:69573085-69573107 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1119428794 14:74552352-74552374 CGATGCAGCGGCCTCCGTTCAGG + Exonic
1119520250 14:75279577-75279599 CGCTGACGCAGGCGCCGCTCCGG - Intronic
1119743212 14:77027300-77027322 CGCCGCCGCCGCCGCCGCTGCGG - Exonic
1121279385 14:92688180-92688202 CGCCGCCGCCACCACCGTCCAGG - Exonic
1121473717 14:94175056-94175078 CGCTGACGCCGCCCGGGTTCTGG + Intronic
1121711049 14:96039449-96039471 CGCTGCTGCCGCTGCCGCTGCGG - Exonic
1122444991 14:101761696-101761718 CGCCGCCGCCGCCGCCGCCGTGG + Intergenic
1122445014 14:101761778-101761800 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
1122786146 14:104164135-104164157 CGCTGCAGCCGCCGCAGTGGGGG + Intronic
1123024887 14:105419881-105419903 CGCCGCCGCCGCCGCCGCCGAGG - Exonic
1123630890 15:22258838-22258860 GGTGGCCCCCGCCGCCGTTCAGG - Intergenic
1123781380 15:23632370-23632392 CGCTGCAACCTCCGCCTTTCAGG + Intergenic
1124109482 15:26773046-26773068 CGCCGCCGCCGCCGCCGCGCTGG + Exonic
1124427074 15:29571026-29571048 CGCCGCCGCTGCTGCCGTACCGG + Intergenic
1124652506 15:31484004-31484026 CGCCGCCGCCGCCGCCGCCACGG - Exonic
1124922238 15:34038657-34038679 CGCCGGCGCCGCCGCCCGTCTGG + Intronic
1124971146 15:34490544-34490566 CGCCGCCGCCGCCTCCGTGCTGG + Intergenic
1124983357 15:34583561-34583583 CGCAGCCGCCGGCTCCGTCCGGG + Intronic
1125522938 15:40358259-40358281 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1125674249 15:41494062-41494084 CGCTGCGGCCGCCGCCGCGGGGG + Exonic
1125873439 15:43123184-43123206 CGCTGGCGACGCCCCCGGTCGGG - Intronic
1126823735 15:52529170-52529192 CGCTGCCACCGCGGCTGCTCTGG + Intergenic
1126849868 15:52790365-52790387 CGCCGCCGCCGCCGCCGCAGCGG + Intronic
1128028573 15:64460584-64460606 CGCCGCCGCCGCCGCGATCCGGG - Intergenic
1128173117 15:65530437-65530459 TGCTGGCGCCGCCGCCATCCCGG + Intronic
1129785353 15:78306564-78306586 AGCTGCCTCCGCCCCAGTTCCGG + Intergenic
1129893779 15:79089476-79089498 CGCCGCCGCCGCCGCAGTCGCGG - Intronic
1129983712 15:79897291-79897313 CGCTGCCGCCTCCGCGGTCCCGG - Intronic
1130115551 15:81001893-81001915 CGCCGCCGCCGCCGCCTTCTTGG - Exonic
1130564420 15:84981685-84981707 CGCCGCCGCCGCCGCCTCCCCGG - Intronic
1130908604 15:88256350-88256372 CGCCGCCGCCGCCGCCGGGTGGG + Exonic
1131375011 15:91916133-91916155 CGATGCCGCCGCAGCCGATCAGG - Exonic
1131735471 15:95326950-95326972 CGCAGCCGCCGCGGCCAATCCGG - Intergenic
1131827011 15:96330395-96330417 CGCCGCCGCCGCCGCCGAGAGGG - Intronic
1132055465 15:98648198-98648220 CAATGCCCCCGCCGCCGGTCCGG - Intergenic
1132641872 16:981774-981796 CGCCGCCGCCGCCGAGGCTCGGG - Intergenic
1132641876 16:981780-981802 CGCCGCCGCCGCCGCCGCCGAGG - Intergenic
1132837093 16:1959609-1959631 CGCGCCCGCCGCCGCCATGCCGG + Exonic
1132877959 16:2148664-2148686 CGCCGCCGCCGCCGCCGCCAGGG + Exonic
1133232219 16:4372159-4372181 CGCTCCCTCCCCCGCCGTCCTGG + Intronic
1133273793 16:4624905-4624927 CGCTGTCGCCGCTCCCGTTCCGG + Exonic
1133784352 16:8963358-8963380 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1134615765 16:15650253-15650275 CTCTGCCGCCGCCGCCGCGTTGG + Intronic
1135023799 16:18983992-18984014 CGCCGCCGCCGCCGCCTCCCCGG - Exonic
1135296537 16:21283933-21283955 CGCCGCCGCCTCCGCCGCTGCGG - Intronic
1136365176 16:29806409-29806431 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1136546529 16:30958013-30958035 CGCCGCCGCCGCCACCGCTGCGG + Intronic
1138360746 16:56425436-56425458 TGCCGCCGCCGCCGCCGCGCCGG + Exonic
1138471960 16:57245138-57245160 CGCCGCCGACGCCGCAGGTCCGG - Exonic
1139433812 16:66925152-66925174 CTCCGCTGCCGCCGCCGTTCAGG + Exonic
1139637119 16:68264515-68264537 CGCCGCCGCCGCGGCAGCTCAGG - Intronic
1139761435 16:69187385-69187407 CGCCCGCGCCGCCGCCGTTTGGG - Exonic
1140187428 16:72787742-72787764 CACCGCCGCCGCCGCCGGTGGGG + Exonic
1140209183 16:72957815-72957837 CACCGCCGCCGCCGCCGCCCCGG + Exonic
1140376253 16:74447758-74447780 CGCTCCCGCTGCCGGCTTTCCGG + Intergenic
1141418894 16:83899090-83899112 CGCCGCCGCTGCCGCGCTTCCGG - Intergenic
1141456384 16:84145123-84145145 CGCGGCCGCCGCCCCCGTCTCGG + Exonic
1141582724 16:85011324-85011346 CGCCGCCGCCGCCGCAGGCCGGG - Exonic
1141608590 16:85169273-85169295 CGCCGCCGCCGCCGCGTTCCGGG + Intergenic
1141828987 16:86498991-86499013 CGCCGCCGCCGGCGCCTTCCTGG + Intergenic
1141972150 16:87491728-87491750 CGTGGCCCCCGCCGCCGTTCAGG + Exonic
1142163334 16:88570628-88570650 CGCGGCCGCCGCCGCCGCCTCGG - Intronic
1142631445 17:1229011-1229033 CGCTGCGGCCGCCGCCCCCCGGG + Intronic
1142664756 17:1456226-1456248 CGCGGCTGCCGCCGCCATTTCGG - Exonic
1142764328 17:2057104-2057126 CGCCGCCGCCGCCGCCCCGCAGG - Exonic
1143590887 17:7885330-7885352 CGCCGCCGCCGCCGCCACCCCGG + Intronic
1144109804 17:12020901-12020923 CGGAGCCGCCGCCGCCGCTCGGG - Exonic
1144339728 17:14301586-14301608 CGCCGCCCCCGCCGCCGGTGAGG + Exonic
1144910058 17:18673038-18673060 CGCCGCCGCCGCCGCCGCCTGGG + Exonic
1145925655 17:28644952-28644974 CGCCGCCGCCGCCGCCGGCGCGG + Intronic
1146132628 17:30291949-30291971 CGCCGCCGCCGCCGCCGAGCCGG - Exonic
1146763483 17:35498062-35498084 CGCCGCCCTCGCCGCCGCTCTGG - Intronic
1147161783 17:38572827-38572849 CGCCGCGGCCGCCGCCGTGCCGG + Intronic
1147200647 17:38799427-38799449 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1147719826 17:42532207-42532229 CGCCGCCGCCGCCGCCGCCCAGG + Intergenic
1147967395 17:44200339-44200361 CGCTGCCCCCGCCCCCGAGCCGG - Intergenic
1148035448 17:44656487-44656509 CGCAGCCGCCTCCGCCGCCCGGG - Exonic
1148356381 17:46978544-46978566 CTCTGCCGCCGCCTCCGGGCGGG - Exonic
1148549995 17:48544545-48544567 TCCGGCCGCCTCCGCCGTTCCGG - Exonic
1148786920 17:50150085-50150107 CGCCGCCGCACCCGCCGTCCCGG - Exonic
1149599652 17:57885279-57885301 CGCTGCTGCCACCGCCCTCCAGG + Exonic
1149659050 17:58324871-58324893 CGCTCCCGCTCCCGCCGTCCTGG - Exonic
1149994707 17:61400361-61400383 TGCTGCCGCCGCCGCCGCCGCGG - Exonic
1150003657 17:61456655-61456677 CGCCGCCGCCGCCGCGGAGCAGG + Exonic
1150168366 17:62966225-62966247 CGCTAGCGCCGCCGCCGCGCTGG - Intergenic
1150239857 17:63622666-63622688 CGCTGCCGTCCCCGCCGCCCGGG + Exonic
1150918455 17:69459634-69459656 CACTGCAGCCTCCGCCTTTCGGG - Intronic
1151755335 17:76072449-76072471 CGCCGCCGCCGCCGCCGCCTGGG + Exonic
1152049141 17:77958950-77958972 CGCCGCCGCCGCCGCCGCCTAGG + Intergenic
1152924525 17:83080990-83081012 CGCAGCCGCAGCCTCCGTTCCGG + Intronic
1153040816 18:812015-812037 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1153514204 18:5890359-5890381 TGCTGTGGCCGCCCCCGTTCTGG - Exonic
1154268212 18:12897117-12897139 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1155456004 18:26013856-26013878 CACTGCAGCCTCCGCCGCTCAGG - Intergenic
1156213839 18:34976943-34976965 CGCCGCCGCCGCCGCCGCTCCGG - Intronic
1157425036 18:47577629-47577651 TGCTGCCACCACCGCCTTTCAGG - Intergenic
1157464415 18:47931144-47931166 GGCTGCGGGCGCCGCCGGTCCGG - Intronic
1157662819 18:49460480-49460502 CGCTGTCGCCGCCGCAGCCCAGG + Exonic
1157834274 18:50884928-50884950 CACTGCAGCCGCCGCCTCTCGGG + Intronic
1158954158 18:62523597-62523619 TGCCGCCGCCGCCGCCGCCCCGG + Exonic
1158976539 18:62715860-62715882 CGCTGCCGTTCCCGCCGCTCGGG - Exonic
1160242393 18:77132898-77132920 CGCGGCCGCCGGCGCCGCCCCGG + Intronic
1160763559 19:797553-797575 CCCTGCCCCCGCCGCCGCGCCGG + Intronic
1160788737 19:913172-913194 CGCCGCCGCCGCCGCCCGGCAGG + Exonic
1160873168 19:1286079-1286101 CGCCGCCGCCGCCGCCGAGCGGG - Intergenic
1160930464 19:1567639-1567661 CCCCGCCGCCGCCGCCGCCCCGG - Exonic
1161072457 19:2269712-2269734 TGCTGCCGCCGCGGCTGTGCAGG - Exonic
1161080595 19:2308160-2308182 CGCCGCCGCCGCCGCCTCCCGGG + Intronic
1161241159 19:3224704-3224726 CGCCGCCGCCGCCGCCGGCTCGG + Exonic
1161628764 19:5340883-5340905 CGCCGCCGCCGCCGCCGGGTCGG + Intergenic
1162030916 19:7916920-7916942 CGCCGCCGCCGCCGCCATCGCGG + Exonic
1162470892 19:10871558-10871580 CGCCGCCGCAGCCGCCGTGCAGG - Exonic
1162751759 19:12833852-12833874 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1163138800 19:15332444-15332466 CGCTGCCGCCGCCACTGCTTCGG + Intronic
1163158137 19:15449914-15449936 CGCCGCCGCCTCCACCGCTCGGG + Exonic
1163282147 19:16324748-16324770 CGTTTCCGCCGCCGCCGCTTTGG + Intergenic
1163606979 19:18280983-18281005 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
1163804147 19:19386004-19386026 CGCTGCCGCCGCCGCCACAGCGG + Exonic
1163807252 19:19406450-19406472 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1163847029 19:19643614-19643636 CGCAGCCGCCGCCGCCGCCTCGG + Exonic
1164834726 19:31349766-31349788 CGCAGCCGCCGCCGCGGCCCGGG + Intergenic
1164835092 19:31350798-31350820 CGCCGCCGCCCGCGCCGCTCGGG - Intergenic
1165080116 19:33302105-33302127 CGCCGCCGCCGCCGCCCGTGGGG + Exonic
1165850875 19:38849741-38849763 CACCGCCGCCGCCTCCGTGCTGG + Exonic
1165854203 19:38870152-38870174 CGCCGCAGCCGCCGCAGCTCCGG + Exonic
1165928642 19:39342542-39342564 CGCCGCCACCGCCGCCGCTCGGG - Exonic
1165962302 19:39545343-39545365 CGCTGCAGCCTCCGCTCTTCAGG + Intergenic
1165994269 19:39833339-39833361 CGCCGCCACCGCCGCCATGCTGG - Exonic
1166078104 19:40425625-40425647 CGCCCCCGCCGCCGCCGCTTCGG - Intronic
1166210367 19:41302903-41302925 CGCTGCCTCCCCCTCGGTTCTGG - Exonic
1166361253 19:42253868-42253890 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
1166807694 19:45496977-45496999 CGCCGCCGCCGCCGCCGCCCTGG + Exonic
1167391280 19:49196725-49196747 GGCTGCCCCCGCCTCCGCTCAGG - Exonic
1167557473 19:50205306-50205328 CGCCGCCGCCGCCGCCCACCTGG + Intronic
1167996091 19:53403528-53403550 CGCAGCCGGCTCCGCCTTTCAGG + Intronic
925191940 2:1892192-1892214 TGCTGCCCCCGCCGCAGCTCAGG + Exonic
925610504 2:5697200-5697222 CGCTGCGGGCGCCGCAGCTCGGG - Exonic
925984822 2:9206996-9207018 CGCCGCTGCCGCCGCCGCTCCGG - Exonic
926217100 2:10912357-10912379 CGCCGCCGCCGCTGCCGCTGGGG - Exonic
926297957 2:11582134-11582156 CGCTGCTGCGGCCTCCCTTCTGG + Intronic
927572749 2:24174768-24174790 CGAGGCCCCCGCCGCCCTTCTGG - Intronic
927881457 2:26692709-26692731 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
928511883 2:32010441-32010463 TGCTGCCGCCGCCACCGCCCCGG - Exonic
929701408 2:44166331-44166353 CGCTGCCGGCGCCCGCGCTCAGG + Intergenic
929983220 2:46699572-46699594 CGCTGCCTCCGCCGCGGTGCGGG - Intronic
930820433 2:55641146-55641168 CACTGCCACCTCCGCCTTTCGGG - Intronic
930872757 2:56184638-56184660 CGCAGCCGCCGCCGCGCCTCCGG - Exonic
931748890 2:65313899-65313921 CGCTGCCCCCGCGGCCTTTGGGG + Exonic
932827928 2:74958675-74958697 CGCCGCCGCCGCCGCCATCCCGG - Exonic
933666860 2:84971283-84971305 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
933684709 2:85133690-85133712 CGCCGCCCCCGCCGCCGAGCTGG - Exonic
934031903 2:88055744-88055766 CGCCGCCTCCGCCGCCGAGCAGG + Intergenic
934079052 2:88452278-88452300 CGCCGCCGCCGCCGCCCCCCGGG - Exonic
934079114 2:88452454-88452476 CGCCGCCACCGCCGCCGCCCCGG - Exonic
934248169 2:90324632-90324654 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248184 2:90324693-90324715 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248358 2:90325306-90325328 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248369 2:90325344-90325366 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248380 2:90325382-90325404 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248396 2:90325446-90325468 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934261193 2:91478105-91478127 CGCCGCCGCCGCCGCCGCCCCGG + Intergenic
934304465 2:91809922-91809944 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
934328792 2:92042828-92042850 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934686441 2:96325314-96325336 CGCAGCCGCTCCCGCCGTCCGGG - Intronic
934966853 2:98731105-98731127 CGCCGCTGCCGCCGCCGCTGCGG + Intronic
935112318 2:100104804-100104826 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
935196643 2:100820239-100820261 CGCCGCCGCCGCCGCGGCTGCGG - Exonic
935196646 2:100820245-100820267 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
935592441 2:104855292-104855314 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
935592617 2:104855837-104855859 CGCTGCCGCCGCCGCCGCCGTGG + Exonic
935592618 2:104855840-104855862 TGCCGCCGCCGCCGCCGTGGAGG + Exonic
935592778 2:104856383-104856405 CGCCGCCGCCGCCGTGGTGCGGG - Exonic
935592782 2:104856389-104856411 CGCCGCCGCCGCCGCCGCCGTGG - Exonic
936122652 2:109760337-109760359 CGCCGCCGCCGCCGCTCTTAGGG - Intergenic
936122758 2:109760663-109760685 CGCCGCCGCCGCCGAAGCTCGGG - Intergenic
936221935 2:110610810-110610832 CGCCGCCGCCGCCGAAGCTCGGG + Intergenic
938038145 2:128053527-128053549 CGCCGCCGCCGCCCCAATTCTGG + Intergenic
939629760 2:144517172-144517194 CGCCGCCGCCGCCGCCGCCTCGG + Intronic
940774973 2:157875963-157875985 CACCGCAGCCGCCGCCGCTCTGG - Intergenic
941029311 2:160493439-160493461 CGCTGCCGCCGCCGCCGGAAAGG - Exonic
942046519 2:172102301-172102323 CGCCGCCGCCGCCGCCCGCCGGG + Exonic
942046552 2:172102430-172102452 GGCCGGCGCCGCCGCCGCTCGGG + Exonic
942241115 2:173964682-173964704 CGCCGCCGCCGCCGCCGCCGGGG - Intronic
942278193 2:174337443-174337465 CGCCGCCGCTGCCGCCGCCCGGG - Exonic
942346215 2:175005257-175005279 CGCCGCCGCCGCCGCCAGTGCGG - Intronic
942448373 2:176092973-176092995 CGCCGCCGCCGCCACCGATGAGG - Exonic
942748719 2:179264623-179264645 CGCTGCTGCCGCCGCCGCCCGGG - Exonic
943571506 2:189580771-189580793 CGCCGCCGCCGCCGCCGCCGTGG + Exonic
944675846 2:202033872-202033894 CGCCGCCGCCGCCGCCCGCCGGG - Intergenic
944831219 2:203535342-203535364 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
945431725 2:209772234-209772256 CGCTGCCGCCGCCGCCGCTGAGG + Intronic
945466017 2:210171322-210171344 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
946191646 2:218010687-218010709 TGCTGCCGCCGCCGCCGCCCCGG - Intergenic
946921468 2:224585301-224585323 CGCCGCCGCCGCCGCCATCGCGG - Exonic
948140476 2:235669506-235669528 CGCCGCCGCCGCCGCGCTCCCGG + Intronic
948553468 2:238791568-238791590 AGCTCCCGCAGCCGCCCTTCCGG + Intergenic
1169084875 20:2820585-2820607 CGCTGACACCGCCTCCGCTCCGG - Intergenic
1169214727 20:3786510-3786532 CGGCGCCGCCGCCGCCGCCCCGG + Exonic
1169231149 20:3889563-3889585 GGCTCCTGCCGCCGCCCTTCGGG - Exonic
1169244540 20:4015386-4015408 CGCGGCCGCCGCCCCCGGGCTGG - Intronic
1172474460 20:35226680-35226702 CGCCGCCGCCGCCGCCGCCTCGG - Exonic
1173166205 20:40688864-40688886 CGCAGCCGCCGCTGCCGCCCGGG + Exonic
1173243435 20:41317605-41317627 CGCCGCCGCCGCCGCCTCTGCGG - Intronic
1173454158 20:43189991-43190013 CGCCGCCGCCGCCGCCCGCCCGG + Intergenic
1173672875 20:44810298-44810320 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1174494729 20:50931307-50931329 CGCCGCCGCCTCCGCCGGCCCGG - Intergenic
1175429054 20:58889963-58889985 CGCAGCCGCCGCCGCAGCTTCGG - Intronic
1175429537 20:58891708-58891730 CGCCGCCGCCGCCGCCGCCATGG + Intronic
1175847371 20:62065825-62065847 CGCCGCCGCCGCCGCCGCTCGGG + Intergenic
1176145605 20:63564051-63564073 GACTGCCCCCGCCGCCGTGCAGG + Exonic
1176207109 20:63895197-63895219 CGCCGCCGCCGCCGCCGCCCGGG + Exonic
1176548597 21:8212233-8212255 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176556491 21:8256441-8256463 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176567528 21:8395268-8395290 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176575430 21:8439483-8439505 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1177011053 21:15730366-15730388 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1177011057 21:15730369-15730391 CGCCGCCGCCGCCGCCGCGGGGG + Exonic
1178992449 21:37367036-37367058 CGCTGCCGCCGCCGGCGAGCAGG + Intronic
1179674910 21:42974753-42974775 CGCCGCCGCCGCTGCCGCCCGGG + Intronic
1180014710 21:45074595-45074617 CGCCGCCGCCGCCGCCGCCACGG - Intronic
1180559227 22:16601981-16602003 GGCCGCCGCCGCCGCTGCTCGGG - Intergenic
1180891407 22:19291655-19291677 CGCTGCCGCCGCCGCCGCCGAGG - Exonic
1181026853 22:20131825-20131847 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1181299188 22:21867423-21867445 CGCCGCCGCCGCCGCCATGTTGG + Exonic
1181478092 22:23180833-23180855 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1182236952 22:28883653-28883675 CGCCGCCGCCGCCGCCGTGATGG + Exonic
1182586357 22:31346196-31346218 CGCCGCCGCCACCGCCCTCCAGG - Exonic
1182629671 22:31675496-31675518 CACTGCAGCCTCCGCCTTTCCGG - Intergenic
1183247212 22:36703231-36703253 CGCCGCCGCCGCCGCTGCCCGGG - Exonic
1183479777 22:38057172-38057194 CCCTGCCGCCGCCGCCATCTTGG - Intronic
1183702502 22:39457990-39458012 GGCTGCCGCCGCCGCAGTCTGGG - Intronic
1184759590 22:46537104-46537126 GGCCGCCGCCGCCGCCCTGCCGG - Exonic
1184767035 22:46577398-46577420 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1185374291 22:50474964-50474986 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1185409439 22:50674438-50674460 CGCCGCCGCCGCCGCCCCTGCGG + Intergenic
1203238467 22_KI270732v1_random:30913-30935 CGCCGCCGCCGCCGCCGCCGGGG + Intergenic
1203238469 22_KI270732v1_random:30916-30938 CGCCGCCGCCGCCGCCGGGGCGG + Intergenic
1203261535 22_KI270733v1_random:173616-173638 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
949414382 3:3799849-3799871 TGCTGCCGCCGCCGCCGCCGTGG + Exonic
951078513 3:18425155-18425177 CGCCGCCGCCGCTGCCGCTGTGG + Intronic
951907893 3:27721907-27721929 CGCCGCCGCCGCCGCGGCTGCGG - Exonic
951907896 3:27721913-27721935 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
952484725 3:33798703-33798725 CAGCGCCTCCGCCGCCGTTCGGG - Exonic
952816643 3:37452620-37452642 CAGCGCCGCCGCCGCCTTTCCGG + Intronic
953485080 3:43286931-43286953 CGCGGCCGCCGCCGCAGTGACGG - Intronic
953891663 3:46755847-46755869 TGTTGCCGCCGCCGCCGATCTGG - Intronic
953947773 3:47164011-47164033 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
953989873 3:47475816-47475838 CGCCGCCGCCGCCGCAGCTTGGG - Exonic
954367814 3:50155515-50155537 CCGTGCCGCCGCCGCCGCCCGGG + Exonic
955239341 3:57165363-57165385 CGCTGCCGCCGCGGCCGCCGCGG - Exonic
955911573 3:63863958-63863980 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
956678016 3:71753646-71753668 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
959530734 3:107431541-107431563 CGCCGCCGCCGCCGGGGCTCGGG + Intergenic
960664217 3:120094381-120094403 CGCCGCCGCCGCCGCCGCCCGGG - Intronic
961827177 3:129605301-129605323 CGCCGCCGCCGCCACCGCCCGGG + Intronic
962301893 3:134250658-134250680 CGCCGCCGCCGCCGCCGAAGAGG + Exonic
962677113 3:137765300-137765322 GGCTGCCGAAGGCGCCGTTCTGG - Exonic
963253092 3:143120068-143120090 AGCAGCCGCCGCCGCCGCTGCGG + Exonic
963882716 3:150546396-150546418 CGCCGCCGTCGCCGCCGCTTTGG + Exonic
965225129 3:165979307-165979329 CACTGCCACCTCCGCCTTTCGGG + Intergenic
965560973 3:170062263-170062285 CGCTGCTGCCTCCGCCGCACGGG - Intronic
966182200 3:177197562-177197584 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
967685306 3:192409987-192410009 CGGAGCCGCCGCCGCCCCTCCGG + Intronic
968583698 4:1406337-1406359 CGCTCCCGCCGCCGCTGCCCAGG - Intergenic
968701299 4:2059400-2059422 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
968729267 4:2262004-2262026 GGCAGCGGCCGCCGCCGTCCCGG - Exonic
970333008 4:15003720-15003742 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
972321553 4:37977360-37977382 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
972738413 4:41867017-41867039 CGCAGCCGCTGCCCCCATTCAGG + Intergenic
975118592 4:70705254-70705276 TGCTGCCGCCGCCGCCGCTCGGG - Intronic
975118764 4:70705790-70705812 CGCCGCCGCCGCCGCCAGTGCGG + Intronic
975986117 4:80202701-80202723 CGCCGCCGCCGCCAGCGTCCTGG - Exonic
979685316 4:123505639-123505661 CGCTGCCGCCGCCGCCGCCGAGG + Intergenic
979785647 4:124712702-124712724 CGCCGCCGCCGCCGCCGTCAGGG + Exonic
979832037 4:125315643-125315665 CGCCGCCGCCGCCCCTGTTGCGG - Intergenic
981270744 4:142845723-142845745 CGCCGCCGCCGCCGCCGGCCTGG - Intronic
982288803 4:153759967-153759989 CTCCGCCGCCGCCGCAGATCCGG - Exonic
982712275 4:158769191-158769213 TGATGCCGCCGCCGCAGCTCCGG - Exonic
983904439 4:173169215-173169237 CGCTGCCGCGGCAGCGGCTCGGG + Intronic
983904499 4:173169415-173169437 CGATGCCGCCACCGCTGGTCCGG + Intronic
986813630 5:11385047-11385069 CGCTGCCCGCGCCGCCGCGCGGG - Exonic
986813660 5:11385161-11385183 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
987087973 5:14487495-14487517 CGCCGCCGCCGCCCCCGCTGTGG - Exonic
987106076 5:14640956-14640978 CGCTAGCGCCACCTCCGTTCGGG + Intergenic
988825323 5:34929736-34929758 CGCCGCCGCCGCCGCCGCTTCGG + Exonic
989812671 5:45696209-45696231 CGCCGCCGCCGCCGCCGCGACGG - Intergenic
990308589 5:54517724-54517746 CGCCGCAGCCGCCGCCGGTCGGG - Intergenic
990825429 5:59893356-59893378 CGCCGCCCCCGCCGCCGCCCGGG - Exonic
990955023 5:61332320-61332342 CGCCGCCGCCGCCGCCCGGCCGG - Exonic
990955144 5:61332803-61332825 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
990955148 5:61332806-61332828 CGCCGCCGCCGCCGCCGCGGGGG + Exonic
992105521 5:73447213-73447235 CGCTGCCGCCGCCGCCGCGCAGG - Exonic
992105782 5:73448196-73448218 CGCCGCCGCCGCCGCTGCGCGGG + Exonic
992187455 5:74257792-74257814 CGGTGCGGCCGCCTCCCTTCTGG - Intergenic
994107323 5:95961738-95961760 TGCCGCCGCCGCCGCCGCTCCGG + Exonic
995224708 5:109689791-109689813 CGCCGCCGCCGCCGACGCTGCGG - Exonic
996862770 5:128084104-128084126 CGCGGACCCCGCCGCCGTCCCGG - Exonic
996862877 5:128084506-128084528 CGCCGCCGCCGCCGGAGTGCAGG - Exonic
997302078 5:132813630-132813652 GGCCGCCGCCGCCGCCGCTGCGG + Exonic
997539321 5:134648701-134648723 CGCAGCAGCCGCCGCCGCGCCGG - Intronic
998152635 5:139765825-139765847 CGCCGCCACCGCCGCCGTCGTGG + Intergenic
999782233 5:154858679-154858701 GGCTGCCGTCGCCGCCGTCGGGG + Exonic
1001402065 5:171451482-171451504 CCCTGCCACCGCCTCTGTTCTGG + Intronic
1001496026 5:172188227-172188249 CGCCGCCGCCTGCGCGGTTCCGG - Exonic
1001556562 5:172641238-172641260 CGCCGCCGCCGCCTCCCTCCCGG + Intergenic
1002456016 5:179345649-179345671 CGCCGCCGTCGCCGCGGTGCCGG + Intergenic
1002524166 5:179806428-179806450 CGCTCCCGCCGCCGACGCCCAGG + Intronic
1002591074 5:180291981-180292003 CGCCGCCGCCGCCGCCGCAGTGG + Exonic
1002888012 6:1312761-1312783 CGCTGCCGCCCGCGCCCTCCAGG - Exonic
1002897960 6:1390052-1390074 CGCCGCCGCCGCCGCCGCCCCGG + Exonic
1003391998 6:5722479-5722501 CACTGCCTCCGCAGCCTTTCAGG - Intronic
1003551833 6:7107683-7107705 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1004044689 6:12012448-12012470 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1004864278 6:19837867-19837889 CGCCGCCGCCGCCGCGGCTGCGG - Exonic
1004924052 6:20402373-20402395 CGCCGCCGCTGCCGCCGCCCCGG + Exonic
1005040345 6:21595191-21595213 CGCCGCCGCCGCCGCCTGCCAGG - Exonic
1006302352 6:33200321-33200343 CGCCGCCGCCGCCGCCGCTGCGG + Exonic
1006472508 6:34236742-34236764 CGCCGCCGCCGCTGCCGCGCGGG - Intergenic
1006617944 6:35342571-35342593 CGCTGCGGCCGCCGCGGACCTGG + Intronic
1007387225 6:41528154-41528176 CGCTGCCACCGCTGCCGCTGCGG - Intergenic
1007406573 6:41639017-41639039 CGCAGCCGCAGCCTCTGTTCAGG - Intronic
1007656817 6:43455564-43455586 AGCAGCCGCTGCCGCCGCTCGGG - Intronic
1008932469 6:56954936-56954958 CGCCGCCGCCGCGGCCGCCCGGG + Intergenic
1013117652 6:107115046-107115068 CGCTGCCGCCGCCGCGCGGCCGG + Intronic
1013117808 6:107115543-107115565 CGCGGCCGCCGCCCCCGCCCCGG - Intergenic
1013155827 6:107490357-107490379 GGATGCCGCCGCCGTCGCTCCGG - Exonic
1013514653 6:110875021-110875043 CGCCGCTGCCGCCGCCGCTGCGG - Exonic
1014947491 6:127515667-127515689 CTCCGCCGCCGCCGCCATTGGGG + Exonic
1015773648 6:136792677-136792699 GGCTGCCGCTGCTGCTGTTCCGG - Intergenic
1016842153 6:148535216-148535238 CTGTGCCGCCGCCACCTTTCCGG + Intronic
1017164158 6:151391553-151391575 CGCCGCCGCCGCCGCCGCGCCGG - Intergenic
1017842334 6:158232163-158232185 CACCGCCGCCGCCGCCGGCCCGG - Intergenic
1018156654 6:160991711-160991733 CGCCGCCACCGCCGCCGATCTGG + Intronic
1018400491 6:163415138-163415160 CGCCGCCGCCGCCGCCGGAGAGG - Exonic
1018613055 6:165662158-165662180 CCCGGCCGCCGCCGCCGCCCCGG - Intronic
1019111926 6:169724007-169724029 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1019404517 7:876684-876706 CGCGGTTGCGGCCGCCGTTCCGG - Exonic
1019474246 7:1236431-1236453 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1019474251 7:1236437-1236459 CGCCGCCGCCGCCGCGGGGCTGG + Exonic
1020103213 7:5407188-5407210 TGTGGCCACCGCCGCCGTTCTGG + Intronic
1020275538 7:6622402-6622424 CGCCGCCGCCGCTGCCGTGCAGG - Exonic
1021231103 7:18086899-18086921 CGCCGCCGCCGCCGCCGCGCGGG - Intergenic
1021827916 7:24573272-24573294 CGCCGCCGCCGCCGCCGCTTGGG - Intronic
1022106157 7:27199456-27199478 CGCCGCCGCCGCCGCCTTCGCGG - Exonic
1022410511 7:30135582-30135604 CGCTGCTGCGGGCGCCGTTTCGG + Intronic
1022923394 7:35037620-35037642 CGCCGCCGTTGCCGCCGCTCCGG + Intronic
1023054983 7:36283981-36284003 CGCTGCTGCCGCCGCCACTGGGG - Intronic
1023405880 7:39833517-39833539 CGCCGCCGCCGCTACCGCTCCGG - Intergenic
1025069679 7:55887596-55887618 CGCCGCCGCCGCCGCCGCGGTGG - Intronic
1025069681 7:55887599-55887621 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1025615709 7:63114426-63114448 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1025829654 7:65038294-65038316 CTCAGCCGCCGCCGCCCGTCGGG - Intergenic
1025899435 7:65731992-65732014 CGCTGCCGCCACCGCCACTTGGG + Intergenic
1025916912 7:65873310-65873332 CTCAGCCGCCGCCGCCCGTCGGG - Intronic
1026665560 7:72337242-72337264 CTCTGCCGGCGCCCGCGTTCAGG + Intronic
1026822274 7:73557572-73557594 CGCTCCCGCCGCCGCCATGTCGG - Exonic
1027025858 7:74851328-74851350 CGCCGCCGACGCCGCCATTAAGG - Intronic
1027061903 7:75092791-75092813 CGCCGCCGACGCCGCCATTAAGG + Intronic
1027421154 7:78019488-78019510 CGCCGCTGCCGCCGCCGCCCGGG + Exonic
1028762259 7:94509687-94509709 CGCAGCCGCCGCCGCCCGCCGGG + Intronic
1029281591 7:99439067-99439089 GGCCGCCGCCGCCGCCATGCAGG + Exonic
1029640034 7:101815220-101815242 CGCTGGCACCGCCGCTGTCCGGG + Intergenic
1029996754 7:105014154-105014176 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
1030727198 7:112939762-112939784 CGCCGCCGCCGCCGCCCCTCAGG + Exonic
1031043449 7:116862571-116862593 CGCTGCCGCCGCCGCCGCCGCGG + Exonic
1031051882 7:116953440-116953462 CGCCGCCGCCGCCGCGGCCCGGG - Exonic
1031317371 7:120273813-120273835 GGCAGCCGCCGCCGCCGTGGCGG - Exonic
1031604230 7:123749034-123749056 TGCGGCCGCCGCCGCCGCTGCGG - Exonic
1032174357 7:129611695-129611717 CGCCGCCGCCGCCGCCGAGGAGG - Exonic
1032306232 7:130734191-130734213 CGCTGCCGCCGCCGCCCGCGCGG + Intergenic
1033253190 7:139777818-139777840 CGCCGCCGCCGCTGCCGCCCGGG + Intronic
1033299992 7:140176911-140176933 GGCCACCGCCGCCGCCGCTCCGG + Exonic
1034147257 7:148884212-148884234 CGCCGCCGCCGCCGCCGCCGGGG + Exonic
1034306284 7:150047674-150047696 CGCCGCCGCCGCCGCGCTCCCGG + Intergenic
1034469722 7:151248756-151248778 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1034618022 7:152435854-152435876 CGCCGCCGCCGCTGCTGCTCGGG + Exonic
1034800563 7:154052979-154053001 CGCCGCCGCCGCCGCGCTCCCGG - Intronic
1035169498 7:157009829-157009851 CGCAGCCGCCGCCGCCGCCGCGG + Exonic
1035169538 7:157009945-157009967 CGCCGCCGCCGCCGCCGCTGGGG - Exonic
1035280488 7:157775463-157775485 CGCTGCCGCCTCCGCCCTGTGGG - Intronic
1035553015 8:544655-544677 GGCCGCCGCCGCCGCCGCCCAGG - Exonic
1038554183 8:28494768-28494790 CGCTGCCGCCGGCTCCGGCCGGG - Intronic
1038727614 8:30095461-30095483 CGCTGCTGCCGCCGCCGCCTCGG + Exonic
1039879437 8:41615286-41615308 TGCTGCTGCCGCCACCATTCGGG + Intronic
1040065592 8:43141294-43141316 CGCCGCCGCCGCCGCCGCCTGGG + Intronic
1041059501 8:54022275-54022297 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1041552684 8:59119264-59119286 CGCTGCCGCCGCCGCCGGGCAGG + Intergenic
1041689916 8:60678763-60678785 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1041690085 8:60679355-60679377 CGCCCCCGCCGCCGCCGGCCCGG - Intronic
1041690272 8:60680037-60680059 AGCTGCCGCCGCCGGCGGCCCGG - Intronic
1042040035 8:64580732-64580754 CGCTGCCGCCGCCGCCGCCTCGG - Exonic
1042040220 8:64581387-64581409 CCCCGCCGCCGCCGCCGCCCAGG - Exonic
1043463894 8:80486696-80486718 CGCCCCCGCCCCCGGCGTTCCGG - Exonic
1043502957 8:80874323-80874345 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1043847286 8:85177524-85177546 CGCCCCCGCCGCCGCAGCTCGGG + Exonic
1045516297 8:102863628-102863650 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
1045547365 8:103140795-103140817 CGCCGCCGCCGCCTCCTTGCGGG + Exonic
1045737921 8:105318457-105318479 CGGCGCCGCCGCCGCCGCTCCGG - Intronic
1045738011 8:105318838-105318860 CGCCGCCGCCGCCGCTGGCCAGG - Exonic
1046103901 8:109644685-109644707 CGCCGCCGCTGCCGCCGTCCAGG + Exonic
1048214267 8:132480871-132480893 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1049109852 8:140635788-140635810 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1049784657 8:144444574-144444596 CGCGCCCGCCGCCGCCGTCGAGG - Intergenic
1049788438 8:144462373-144462395 CGCCGCCGCCGCCGCCGCCTCGG + Intronic
1050437929 9:5629199-5629221 CGCCGCCGCCGCCGCCGACTCGG + Exonic
1051148706 9:14058046-14058068 CCCTGCCTCCACCCCCGTTCTGG - Intergenic
1051351047 9:16198158-16198180 TGCTGCCGCCGCCGCTGCCCTGG + Intergenic
1052192792 9:25678180-25678202 CGCCGCCGCCGCCGCCGCTGGGG + Exonic
1052358591 9:27529741-27529763 AGCTGCAGCCGCCGTCGCTCCGG + Exonic
1052888839 9:33677021-33677043 CGCCGCCGCCGCCGCCGTGTTGG + Intergenic
1052903989 9:33817739-33817761 CGCCGCCGCCGCCGCCGCGATGG + Exonic
1053070207 9:35096573-35096595 CGCCGCCGCCGCCGCACTTCCGG - Intronic
1053114611 9:35490123-35490145 CGCCGCCGCCGCCGCCGGCGCGG + Intronic
1053434908 9:38068291-38068313 CGCTGCCGCCGCAGTAGTCCAGG + Exonic
1053697501 9:40651086-40651108 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1054308790 9:63450486-63450508 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1054798629 9:69325390-69325412 CGCCGCTGCCGCCGCCGCTCAGG + Intronic
1054835655 9:69672554-69672576 CGGTGCCGCCGCCGCCGCCGCGG - Intergenic
1055091114 9:72365281-72365303 CGCCGCCGCCGCCGCCGCCGGGG - Intergenic
1055514207 9:77020319-77020341 CGCCGCCGCCGCCGCCGCCACGG - Exonic
1057259764 9:93576983-93577005 CGCCGCCGCCGCCGCATTCCGGG + Intronic
1057489129 9:95508310-95508332 TGCCGCCGCCGCCGCGGTCCTGG + Exonic
1057489144 9:95508367-95508389 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1057869777 9:98708894-98708916 CGCTGCCGCCGCCGCCGCCGCGG - Exonic
1058058670 9:100473673-100473695 CGCTGCCGCCGCCACCACCCGGG - Exonic
1059483712 9:114611527-114611549 CGCCGCCGCCGCCGCCACCCCGG - Exonic
1060111382 9:120909236-120909258 CGCTGCTGCCGTGGCCCTTCCGG - Exonic
1060389799 9:123268217-123268239 GGCCGCCGCCGCCGCCGCTGCGG - Intronic
1061044992 9:128160173-128160195 CTCCGCCCCCGCCGCTGTTCTGG - Intergenic
1061144121 9:128787270-128787292 CGCCGCCGCCGCCGCCCCCCAGG - Exonic
1061196662 9:129110569-129110591 CGCCGCCGCCGCCGCGGCTGGGG + Exonic
1062022631 9:134326591-134326613 CGCTGCCTGCGCCGCCGGCCGGG + Exonic
1202779846 9_KI270717v1_random:24374-24396 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1203469881 Un_GL000220v1:111685-111707 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1203477702 Un_GL000220v1:155657-155679 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1185457753 X:319231-319253 CGCCGCCGCCGCCGAGGCTCGGG - Intergenic
1185457757 X:319237-319259 CGCCGCCGCCGCCGCCGCCGAGG - Intergenic
1185892766 X:3835468-3835490 TGCTGCCGCCGCGGCCCATCAGG - Intronic
1185897874 X:3873888-3873910 TGCTGCCGCCGCGGCCCATCAGG - Intergenic
1185902993 X:3912319-3912341 TGCTGCCGCCGCGGCCCATCAGG - Intergenic
1186107841 X:6226466-6226488 TGCTCCCGCCCCCGCCGCTCCGG + Intronic
1186452926 X:9688135-9688157 AGCCGCCGCCGCCGCCGCACTGG - Exonic
1186660563 X:11664684-11664706 CGCTCCCGCAGCCGCCGATCAGG + Exonic
1187648427 X:21374633-21374655 CGCCGCCGCCGCCGCCTTAGCGG + Intronic
1189324667 X:40105336-40105358 CGCCGCCGCCGCCGCAGTCACGG + Intronic
1189325561 X:40109015-40109037 CGCCGCCGCCGCCGCGTTCCCGG - Intronic
1189332316 X:40151718-40151740 CGCCGCCGCCGCCACCGCTGCGG - Intronic
1190337205 X:49269851-49269873 TGCCGCCGCCGCCGCCGATATGG + Exonic
1190474402 X:50813133-50813155 CGCCGCCGCCGCCGCCGCCAGGG - Intronic
1190542867 X:51496503-51496525 CGCTGCCGCTGCCGCCGCCGGGG + Exonic
1194666822 X:96685069-96685091 CGCTCCCGACGCCGCCGCCCCGG - Exonic
1194977593 X:100409720-100409742 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1195138207 X:101931892-101931914 CGCCGCCGCCGCTGCCGCGCAGG + Intronic
1195954795 X:110317831-110317853 CGCCGCCGCCGCCGCAGCCCTGG + Exonic
1198388138 X:136147716-136147738 CCCCGCCGCCGCCGCCGCTCGGG + Intronic
1198767093 X:140091339-140091361 CGCCGCCGCCGCCGCCGCCTCGG - Intergenic
1199500369 X:148500673-148500695 CGCCGCCGCCGCTGCCGCCCCGG + Exonic
1200092490 X:153642452-153642474 GGCAGCCGCCGCCGCCGCTGCGG - Intergenic
1200100746 X:153688279-153688301 CGCCGCCGCCGCCGCCCGGCCGG + Exonic
1200229538 X:154437163-154437185 CGCCGCCGCCGCCACCGCACTGG - Exonic