ID: 1084680908

View in Genome Browser
Species Human (GRCh38)
Location 11:70665855-70665877
Sequence CAGGGTCACCCAGCTCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 1, 2: 2, 3: 38, 4: 290}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084680908_1084680916 12 Left 1084680908 11:70665855-70665877 CCTTCTTGAGCTGGGTGACCCTG 0: 1
1: 1
2: 2
3: 38
4: 290
Right 1084680916 11:70665890-70665912 CCTCTGAGCTTGTCTCTTGTGGG 0: 1
1: 0
2: 4
3: 55
4: 812
1084680908_1084680917 13 Left 1084680908 11:70665855-70665877 CCTTCTTGAGCTGGGTGACCCTG 0: 1
1: 1
2: 2
3: 38
4: 290
Right 1084680917 11:70665891-70665913 CTCTGAGCTTGTCTCTTGTGGGG 0: 1
1: 0
2: 0
3: 21
4: 171
1084680908_1084680914 11 Left 1084680908 11:70665855-70665877 CCTTCTTGAGCTGGGTGACCCTG 0: 1
1: 1
2: 2
3: 38
4: 290
Right 1084680914 11:70665889-70665911 CCCTCTGAGCTTGTCTCTTGTGG 0: 1
1: 1
2: 2
3: 14
4: 163
1084680908_1084680921 19 Left 1084680908 11:70665855-70665877 CCTTCTTGAGCTGGGTGACCCTG 0: 1
1: 1
2: 2
3: 38
4: 290
Right 1084680921 11:70665897-70665919 GCTTGTCTCTTGTGGGGGAGGGG 0: 1
1: 0
2: 2
3: 46
4: 295
1084680908_1084680919 17 Left 1084680908 11:70665855-70665877 CCTTCTTGAGCTGGGTGACCCTG 0: 1
1: 1
2: 2
3: 38
4: 290
Right 1084680919 11:70665895-70665917 GAGCTTGTCTCTTGTGGGGGAGG 0: 1
1: 0
2: 3
3: 24
4: 190
1084680908_1084680920 18 Left 1084680908 11:70665855-70665877 CCTTCTTGAGCTGGGTGACCCTG 0: 1
1: 1
2: 2
3: 38
4: 290
Right 1084680920 11:70665896-70665918 AGCTTGTCTCTTGTGGGGGAGGG 0: 1
1: 0
2: 2
3: 26
4: 216
1084680908_1084680918 14 Left 1084680908 11:70665855-70665877 CCTTCTTGAGCTGGGTGACCCTG 0: 1
1: 1
2: 2
3: 38
4: 290
Right 1084680918 11:70665892-70665914 TCTGAGCTTGTCTCTTGTGGGGG 0: 1
1: 0
2: 1
3: 12
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084680908 Original CRISPR CAGGGTCACCCAGCTCAAGA AGG (reversed) Intronic
901701259 1:11045785-11045807 CGAGGTCACCCAGCTAATGAGGG + Intronic
902113746 1:14104215-14104237 CAGGGTCACTTGGCACAAGAAGG - Intergenic
902392132 1:16112949-16112971 AAGGGTCACACAGCACACGATGG + Intergenic
902450716 1:16495139-16495161 CAGGGTCACACAGCTGGTGAGGG - Intergenic
902502151 1:16918200-16918222 CAGGGTCACACAGCTGGTGAGGG + Intronic
902932791 1:19743180-19743202 CAGGGTCACCCAGCTAGTCAGGG - Intronic
903179934 1:21600072-21600094 CAGGGTCACTCAGCACAGGTGGG + Intronic
903474110 1:23607598-23607620 CAGAGTCACCCAGCTCAGACTGG - Intronic
903908191 1:26701531-26701553 CAGGGTCACACAGCTTAATCTGG - Intronic
904317255 1:29673481-29673503 CAAGGTCACACAGCTCAAGATGG - Intergenic
904369720 1:30040677-30040699 CAAGGTCACCCAGCCCATCAAGG - Intergenic
904556620 1:31369076-31369098 CAGGGTCACCCAGCTGGAGCTGG + Intronic
904662075 1:32092846-32092868 CAAGGTCACCCAGCCAATGAGGG + Intronic
904858688 1:33519174-33519196 CAAGGTCACACAGCTCAGAAGGG - Intronic
904976448 1:34460568-34460590 CAAGGTCACGCAGCTAATGAGGG + Intergenic
905935215 1:41817964-41817986 CCTAGTCACTCAGCTCAAGAGGG - Intronic
906798689 1:48717819-48717841 CAGTGTCACACAGCTAAAAAGGG - Intronic
907516882 1:54998456-54998478 CAAGGTCACACAGCTAAAGATGG - Intergenic
907525834 1:55053494-55053516 CAGGGTCGCACAGCTCAAGCTGG + Intronic
910710827 1:90178387-90178409 CATGGTCTACCAGCTTAAGATGG - Intergenic
911354483 1:96799159-96799181 CTGGGTGACCCAGCTGATGAGGG + Intronic
912469337 1:109895855-109895877 CAGGGTCTTCCTGCTGAAGAAGG - Intergenic
912618748 1:111133877-111133899 CAGGGACACTCAGCTGAAGCTGG - Intronic
913538435 1:119796190-119796212 CAGGGTCACACAGCTCAGCTAGG + Intronic
914804732 1:150983677-150983699 CAAGGTCACTCAGCTCATGACGG + Intronic
915024721 1:152816959-152816981 CAGGGTCAGCCTCCTCAAGTGGG - Intergenic
915496510 1:156285970-156285992 CAGGCTCACCCAGCACAATGGGG - Exonic
916564619 1:165962873-165962895 CAGGGTCACCAGGTCCAAGAGGG - Intergenic
917675008 1:177310524-177310546 CAGAGTCACCCAGCTATAGTTGG - Intergenic
917677600 1:177334790-177334812 CTGGGACTCCCAGCTCTAGAGGG - Intergenic
919774491 1:201185250-201185272 CAGGGTCTCCCAACTCAAGGTGG + Intergenic
920351223 1:205339291-205339313 CAGGGTCACAAAGCTGGAGAAGG + Exonic
921956039 1:220984005-220984027 CCAGGTCACCCAGCTATAGACGG - Intergenic
922182068 1:223243281-223243303 CAGGGTCATCCAGGGCAAGGCGG - Intronic
922316592 1:224447949-224447971 CAGGGTCACACAGCTCGTCAAGG + Intronic
922792766 1:228319197-228319219 CCTGGTCACCTACCTCAAGAAGG + Exonic
1067157607 10:43795120-43795142 CAAGGTCACCAAGCTCACAAAGG + Intergenic
1067758629 10:49026170-49026192 CAAGGCCAACCTGCTCAAGATGG + Intronic
1067878705 10:50025545-50025567 CAGGATCAACCAGAACAAGAAGG - Intergenic
1068650628 10:59518654-59518676 CAAGGTCACTCAGCATAAGAGGG - Intergenic
1069866425 10:71506503-71506525 CAGGGTCCCCCAGCCAGAGATGG + Intronic
1070388407 10:75947581-75947603 CAAGGTCACCCAGCTAAAAGGGG - Intronic
1070798295 10:79230004-79230026 CAGGGTCACACAGCTAGGGAGGG + Intronic
1070964118 10:80519064-80519086 CAGGGAGCCCCAGCCCAAGATGG + Exonic
1072330015 10:94338658-94338680 CAGGCTCATCCAGTTCAGGAAGG + Exonic
1075439345 10:122467112-122467134 CAGGATCACACAGCTCCAAACGG - Intronic
1076266888 10:129115635-129115657 CAAGGTCACACAGCCAAAGATGG + Intergenic
1077585222 11:3446390-3446412 CACGGTCGCCCAGCTGAGGAAGG + Intergenic
1077632566 11:3820932-3820954 CAAGGTCACCCAGCTAATAAAGG + Intronic
1081598339 11:44474682-44474704 CAGGGTCACCTTGCTGATGAGGG - Intergenic
1083312265 11:61790136-61790158 CCAGGTCACACAGCTCATGAGGG + Intronic
1083359455 11:62096002-62096024 AATGGTTACCCAGCTCAAGGCGG + Intergenic
1083359995 11:62100016-62100038 AATGGTTACCCAGCTCAAGGCGG - Intergenic
1084242126 11:67828953-67828975 CATGGTCACCCAGCTGAGGAAGG + Intergenic
1084489109 11:69468766-69468788 CAGGGTCCCACAGCTCATAAGGG + Intergenic
1084531858 11:69732177-69732199 CAGGTAAACCCAGCTCAAGAGGG + Intergenic
1084680908 11:70665855-70665877 CAGGGTCACCCAGCTCAAGAAGG - Intronic
1085274774 11:75291481-75291503 CATGGTCACCCAGCTGGATAAGG + Intronic
1085401257 11:76236896-76236918 CAAGGTCACACAGCTTCAGATGG + Intergenic
1085456692 11:76669603-76669625 CAGAGTTACCCAGCTCATAAGGG + Intronic
1087716296 11:101612619-101612641 CAGGGTCACCCATCGGAAGTTGG - Intronic
1087854946 11:103080487-103080509 CATGGTAACCCAGATCATGAGGG + Intronic
1088713934 11:112532158-112532180 TAGGGTCACCCAAATCAAAAAGG - Intergenic
1089684624 11:120138852-120138874 CATGACCACCCAGCTGAAGAAGG - Intronic
1089731745 11:120523645-120523667 CAGGGTCACACAGCTGAACCTGG + Intronic
1091015855 11:132050241-132050263 CAGGGTCAAGCAGCTGGAGAGGG + Intronic
1091624987 12:2115015-2115037 CAAGGTCACCCAGCTAAACCAGG + Intronic
1091879972 12:3969080-3969102 CAGGGTCACCCAGCTTCGAAGGG + Intergenic
1092412374 12:8263652-8263674 CACGGTCGCCCAGCTGAGGAAGG + Intergenic
1094852368 12:34388024-34388046 CAGGGACACCCAGCTTAACCTGG + Intergenic
1095521900 12:43076453-43076475 CATGGAGACCCAGCTCAAGGCGG + Intergenic
1096481952 12:51948172-51948194 CAGGGTCATTCATCCCAAGAAGG - Intergenic
1097962699 12:65547906-65547928 CAAGGTCACTCAGCTGAAAAGGG - Intergenic
1098848050 12:75562026-75562048 CAGGGTCACATAGCTACAGAGGG - Intergenic
1101733265 12:107443949-107443971 CAGGGTCACCTAGATGAGGATGG + Intronic
1102435618 12:112920903-112920925 CAGGGTCACCCAGCTGGTCAGGG + Intronic
1102638778 12:114347788-114347810 CAGTGTTACCCAGCTCATGGTGG - Intergenic
1103227013 12:119296368-119296390 CAAGGTCACCTAGCTCATAAGGG - Intergenic
1104037429 12:125107321-125107343 CAGGGCCTCCCAGCTGATGATGG + Intronic
1104714592 12:131008013-131008035 CAGGGTCACACAGATAAGGAGGG - Intronic
1104902621 12:132197577-132197599 CAGGGTCACACAGCCAGAGAGGG - Intronic
1104943760 12:132406581-132406603 CGGCGTCCCCCAGCTCAAGGCGG - Intergenic
1105892614 13:24692415-24692437 CAGGGTCACCTAGCAGGAGAGGG - Exonic
1113786513 13:113004665-113004687 CAGAGTCACACAGCTCAGGGAGG + Intronic
1114411918 14:22508994-22509016 AAGGGTCACACAGCCAAAGACGG + Intergenic
1115768357 14:36646785-36646807 CAGGGTGGCCCTGCTCAAGTTGG + Intergenic
1118911493 14:70065536-70065558 CAAGGTCACCCAGCTAGTGAGGG - Intronic
1118995965 14:70836290-70836312 CAGAGACACACAGCTCATGATGG + Intergenic
1119485953 14:74986714-74986736 CAAGGTCACCCAGCTTGTGAGGG + Intergenic
1119653680 14:76401315-76401337 CAGTGTCACCCAGCTGATGGTGG + Intronic
1119779238 14:77267079-77267101 CAAGGTCACCCAGCTGATGAAGG - Intronic
1121961149 14:98261395-98261417 CAGGGTCACACAGGTCACCAGGG - Intergenic
1122155120 14:99746242-99746264 TGGGGTCACCCACCTCAGGAGGG + Intronic
1122164860 14:99814972-99814994 CAGGGTCACACAGCTAGGGAGGG + Intronic
1122347454 14:101069389-101069411 CAAGGTCACCCAGCTGGAGGTGG + Intergenic
1123033192 14:105460726-105460748 CAGGGTCACCCGGGCCAAGGTGG - Intronic
1124369530 15:29096017-29096039 CAGGCAGACCCAGCTCAAAAAGG + Intronic
1125361619 15:38870773-38870795 AAGGGTGTCCCAGCTCCAGAAGG - Intergenic
1125578458 15:40770123-40770145 CAGCCTCACCCAGCCCGAGAAGG + Exonic
1126993899 15:54417308-54417330 CAAGGTCACACAGCAAAAGACGG - Intronic
1128389632 15:67174339-67174361 GAGGCCGACCCAGCTCAAGATGG + Intronic
1128494408 15:68185532-68185554 CAGGAACACGCAGCTGAAGAAGG + Intronic
1129059311 15:72848216-72848238 CAGGGTCACCCAGCAAGAGCTGG + Intergenic
1129296871 15:74604554-74604576 CACAGGCACCCAGCTCAAGCTGG + Intronic
1129869202 15:78929919-78929941 CAGGGCCACACAGCTAAAGCTGG + Intronic
1129999103 15:80031995-80032017 CAGTGTCAGCCAGCACAGGAGGG + Intergenic
1130298632 15:82664244-82664266 CAGCCCCACCCAGCTCACGAGGG + Intronic
1131686922 15:94778189-94778211 GTGGGTTACCCAACTCAAGAAGG + Intergenic
1132200986 15:99954596-99954618 CAAGGTCACACAGCACATGAGGG - Intergenic
1132226973 15:100150400-100150422 CAGGCTCACCCAGCTGGAAAGGG - Intronic
1133269130 16:4602095-4602117 AGGTGTCACCCAGGTCAAGAGGG - Intergenic
1133330933 16:4973444-4973466 CAGTGTCACCCAGCTGATGAAGG - Intronic
1133353638 16:5119888-5119910 CACGGTCACCCAGCTGAGGAAGG + Intergenic
1133447865 16:5877660-5877682 CAGGGTAGCCCTGCTCAGGAAGG - Intergenic
1134627500 16:15732823-15732845 CAAGGTCACACAGCTAGAGAGGG - Intronic
1134777852 16:16868430-16868452 CAAGGTCACACAGCTCAAAAAGG - Intergenic
1135134931 16:19880579-19880601 CAGGGCCAACCACCCCAAGAGGG - Intronic
1135161995 16:20104676-20104698 CAGGTTCACCCAGCTAGAAAGGG + Intergenic
1136004498 16:27319367-27319389 CAGGGTCACACACCTGAAGGTGG + Intronic
1136008925 16:27349712-27349734 CAGGGTCACACAGCTGGAAATGG + Intronic
1136143489 16:28301871-28301893 CAAGGTCACACAGCTAAAAAGGG + Intronic
1136545065 16:30949931-30949953 AAGGGTCACCCAGCTGAAGGTGG + Intronic
1137420503 16:48329306-48329328 CAGGGTCACACAGAGCAGGATGG - Intronic
1137720510 16:50625020-50625042 CAGGGTCACACAGCTGTGGAGGG + Intronic
1137853915 16:51773887-51773909 CAAGGTCAGCCTGCTCAACATGG + Intergenic
1137966226 16:52936236-52936258 CAGGCCCACCCACCTCAACAGGG - Intergenic
1140122948 16:72099114-72099136 CAGGGCCATGCAGCTCCAGAAGG - Intronic
1140122992 16:72099322-72099344 GAGGGTCACCCATCTACAGACGG - Intronic
1140551359 16:75869692-75869714 CAGGGTCACCCAGGGCAGGTTGG + Intergenic
1141174947 16:81712738-81712760 CAGGGTCCCCCAGCTCAGCAGGG + Intergenic
1141492230 16:84381888-84381910 CAGGGTCACACAGCTCTTCATGG + Intronic
1141995619 16:87634878-87634900 CAGTGTCACCCAGCTAGAGCGGG - Intronic
1142171603 16:88625374-88625396 CAGGGTGACTCAGATCCAGAAGG - Intronic
1144767636 17:17741358-17741380 GAGGGTCCCCCTGCTCAGGAAGG - Intronic
1145271379 17:21406641-21406663 CAAGGTCACACAGCTTATGAGGG + Intronic
1145309584 17:21694045-21694067 CAAGGTCACACAGCTTATGAGGG + Intronic
1145797799 17:27666094-27666116 CAGGCCCACCCAGCTGAGGATGG + Intergenic
1145976656 17:28987839-28987861 CAAGGTCACGCAGCTAATGATGG + Intronic
1146842279 17:36164319-36164341 CAGGCCCACCCAGCTGAGGATGG + Intergenic
1146854589 17:36252278-36252300 CAGGCCCACCCAGCTGAGGATGG + Intronic
1146866031 17:36336098-36336120 CAGGCCCACCCAGCTGAGGATGG - Intronic
1146870489 17:36376170-36376192 CAGGCCCACCCAGCTGAGGATGG + Intronic
1146877847 17:36427251-36427273 CAGGCCCACCCAGCTGAGGATGG + Intronic
1147068900 17:37936710-37936732 CAGGCCCACCCAGCTGAGGATGG - Intergenic
1147073372 17:37976794-37976816 CAGGCCCACCCAGCTGAGGATGG + Intergenic
1147080424 17:38016247-38016269 CAGGCCCACCCAGCTGAGGATGG - Intronic
1147084894 17:38056332-38056354 CAGGCCCACCCAGCTGAGGATGG + Intronic
1147096371 17:38140207-38140229 CAGGCCCACCCAGCTGAGGATGG - Intergenic
1147100841 17:38180298-38180320 CAGGCCCACCCAGCTGAGGATGG + Intergenic
1147442576 17:40456446-40456468 CAGTGTCACCCAGCTCTGGATGG + Exonic
1147498281 17:40938152-40938174 GAGGGTCACCCAACTCATGCAGG - Intergenic
1147663480 17:42130071-42130093 CAAGGCCACACAGATCAAGAAGG + Intronic
1147769115 17:42855716-42855738 TATGGACACCCAGCTCAGGAAGG - Intronic
1148229152 17:45920433-45920455 CATGGTCCCTCAGCTCATGAGGG + Intronic
1148573212 17:48687675-48687697 CAGGGTCCCGCTGCTCAAAATGG + Intergenic
1148606965 17:48937300-48937322 CAGGGTCAGACGGCTCCAGAGGG + Intronic
1148670173 17:49404366-49404388 CAGGCCCACCCACCTCAACAGGG + Exonic
1148774369 17:50087437-50087459 CAAGGTCACACAGCTCATCAGGG + Intronic
1149845434 17:60006762-60006784 CAGGCCCACCCAGCTGAGGATGG + Intergenic
1150083782 17:62263345-62263367 CAGGCCCACCCAGCTGAGGATGG + Intergenic
1150624515 17:66833225-66833247 TAGGGTCACACAGATCAAAAAGG + Intergenic
1152377666 17:79927103-79927125 CAAGGTCACACAGCAAAAGAGGG + Intergenic
1152898660 17:82927863-82927885 CAGAGACACCCAGCTTGAGAGGG - Intronic
1154193765 18:12251580-12251602 CAAGGTCACCCAGCTAGAGGAGG + Intergenic
1154981861 18:21508961-21508983 GTGGTTCACCCAGATCAAGAGGG + Intronic
1157323354 18:46650874-46650896 CAGGGTCACCTTGCTCAAAGTGG - Intronic
1159537137 18:69728334-69728356 CACAGTCACCCAGGTCCAGATGG + Intronic
1161537130 19:4826750-4826772 CAGAGTCACACAGCTCATAAGGG + Intronic
1161577948 19:5065126-5065148 CAGCGTCACCTAGCACAGGAGGG + Intronic
1162322817 19:9979873-9979895 CAGGGTCACCAAGGTAAAGATGG - Exonic
1162324236 19:9989347-9989369 CAGGGTCACCCAGGACATGAGGG - Exonic
1162381403 19:10333852-10333874 CAGCGTCACTCAGCTCTGGACGG + Exonic
1162450166 19:10749602-10749624 CAGGGCCACACAGCCCAGGAGGG + Intronic
1162470164 19:10868308-10868330 TAGGGTCACCCAGCTTGGGAGGG + Intronic
1162870684 19:13584253-13584275 CAGGGTCGCCCAGCTCTAACAGG + Intronic
1164677622 19:30112310-30112332 CAGGGCCACACAGCACAGGAGGG - Intergenic
1165195612 19:34100477-34100499 CAGGAACACCTAGCTGAAGAAGG + Intergenic
1165788922 19:38479104-38479126 TGGTGTCACCCAGCTCAAGAGGG - Intronic
1165933125 19:39373079-39373101 CAGTGACACCCAGCCCAGGAAGG - Intronic
1166325269 19:42046107-42046129 CAAGGCCACCCAGCTGAAGCAGG + Intronic
925910949 2:8573423-8573445 CAGGGCCACCCAGGTAATGAGGG + Intergenic
927508371 2:23629010-23629032 GAGGGTCACCGTGCTCAGGAGGG + Intronic
927903643 2:26841783-26841805 CAGGGTCAAACAGCTCAAAGGGG - Intergenic
929027892 2:37623009-37623031 CAGGGTCCCCTTGCTCAAGAGGG + Intergenic
929435757 2:41927242-41927264 CAGGGTCCCCTAGTCCAAGAGGG - Intergenic
929993919 2:46813115-46813137 CAGAGTCACCCAGCTAGTGAGGG + Intergenic
930146743 2:48015056-48015078 CAGGGTCTCCCAGATGAAGAGGG + Intergenic
931123695 2:59249908-59249930 AAGTGACACCCAGCTCAAGATGG - Intergenic
933315027 2:80705116-80705138 CACGGTCACACAGGACAAGAGGG + Intergenic
933844622 2:86315245-86315267 CAAGGTCACTCAGCTCAGCAAGG + Intronic
936383671 2:112010313-112010335 CTGGGCCACCCAACTCAAGTTGG - Intronic
936979845 2:118254415-118254437 CAGAGTCACACAGCTCAACAAGG + Intergenic
937896514 2:126980291-126980313 CACGGCCACCCAGCTAAAGATGG - Intergenic
937983645 2:127628935-127628957 CAGGGTCACACAGCTCAAGGGGG + Intronic
938979885 2:136516298-136516320 CAGGGTCACACAGCTCATTGTGG - Intergenic
939881550 2:147636920-147636942 CAGGATGACTCTGCTCAAGAAGG - Intergenic
940070484 2:149681845-149681867 CAAGGACACCCAGTTCAATATGG + Intergenic
945039631 2:205733235-205733257 CAGCGTCACCCAGCTCCCGTGGG + Intronic
947712074 2:232321981-232322003 CAGGGTCACCCATCTGAACCTGG - Intronic
947731315 2:232433100-232433122 CAGGGTCACCCATCTGAACCTGG - Intergenic
948229254 2:236337553-236337575 CAGGGTCACCCAGCTATGCAGGG + Intronic
1169062146 20:2668596-2668618 CATGGTCACCAACCTCAACAGGG - Intergenic
1169759308 20:9074140-9074162 CAGGGTCACACAGCTAAAAGAGG - Intronic
1171407051 20:24918418-24918440 CAAGGTCTCACAGCTGAAGAGGG + Intergenic
1172243805 20:33431888-33431910 CAGGGTCACACAGCTCGTCAGGG + Intronic
1172634189 20:36398732-36398754 CAAGGTCACACAGCTCCAAATGG + Intronic
1172899517 20:38324201-38324223 CTGGGTCACCCAGCTGGAGAGGG - Intronic
1173682025 20:44889946-44889968 CAGGGTCACACAGCTATATATGG - Intronic
1173849037 20:46206269-46206291 CAAAGCCACCCAGCTCAAAAGGG - Intronic
1173965606 20:47110183-47110205 CAAGGTCACCCAGCTTAGGAGGG + Intronic
1174164999 20:48578198-48578220 CAGGGTCACGGAGCTCAAACTGG - Intergenic
1174201062 20:48806793-48806815 CAGGGATACCAAGGTCAAGATGG + Intronic
1174400536 20:50273585-50273607 CAGGGACACCCAGCCGGAGATGG + Intergenic
1175872905 20:62216813-62216835 CAGGTACTCCCAGCTCAGGATGG + Exonic
1176119000 20:63445747-63445769 CAGGGTCCCCCAGCTCAGACAGG - Intronic
1176119006 20:63445766-63445788 CAGGGTCCCCCAGCTCAGACAGG - Intronic
1176119017 20:63445804-63445826 CAGGGTCCCCCAGCTCAGACAGG - Intronic
1176119028 20:63445842-63445864 CAGGGTCCCCCAGCTCAGACAGG - Intronic
1176119034 20:63445861-63445883 CAGGGTCCCCCAGCTCAGACAGG - Intronic
1176119045 20:63445899-63445921 CAGGGTCCCCCAGCTCAGACAGG - Intronic
1176119051 20:63445918-63445940 CAGGGTCCCCCAGCTCAGACAGG - Intronic
1176119062 20:63445956-63445978 CAGGGTCCCCCAGCTCAGACAGG - Intronic
1176119068 20:63445975-63445997 CAGGGTCCCCCAGCTCAGACAGG - Intronic
1176119074 20:63445994-63446016 CAGGGTCCCCCAGCTCAGACAGG - Intronic
1176119098 20:63446077-63446099 CAGGGTCCCCCAGCTCAGACAGG - Intronic
1176973024 21:15288515-15288537 CATGGTGTCCCAGCTCAAGCAGG - Intergenic
1177548907 21:22595964-22595986 CAGTGTCATCCAGTTGAAGATGG + Intergenic
1178404239 21:32311525-32311547 AAGGGTCAGCCAGCTCACAAAGG - Exonic
1181119263 22:20654663-20654685 CAGGATCACCCAGAACAAGAAGG + Intergenic
1181151274 22:20885218-20885240 CAGGGTGACCCAGGTCACCACGG - Intronic
1181601369 22:23953743-23953765 CAGGGTCACACAGCCCTACACGG - Intergenic
1181607138 22:23987594-23987616 CAGGGTCACACAGCCCTACACGG + Intergenic
1181759995 22:25051696-25051718 CAGGGTGACCCAGCAGAGGAGGG + Intronic
1181998171 22:26899467-26899489 CAGGGTCACCCAGCTATTTAGGG - Intergenic
1182006862 22:26967966-26967988 TAAGGTCACACAGATCAAGAGGG + Intergenic
1182422959 22:30257480-30257502 CAGGGCCACCCAGCTCTGGACGG - Intergenic
1182711234 22:32324711-32324733 CAGGGTCACACAGCTTGTGAGGG - Intergenic
1183352262 22:37340904-37340926 CAAGGTCACACAGCTCAGGAAGG + Intergenic
1184200251 22:42963679-42963701 CAAGGTCACCCAGCTAATAAGGG + Intronic
1184398760 22:44261515-44261537 CAGGGTCACACAGCTTCTGAGGG - Intronic
1184457737 22:44621071-44621093 CTGGGTCACCCAGCACACCAGGG + Intergenic
949473552 3:4420913-4420935 CAGGGTCACCCAGCTAATGTTGG - Intronic
949757352 3:7427813-7427835 CAAGGTCACACAGCACAAAATGG + Intronic
950180791 3:10911793-10911815 CAGGGTCACACAGCTGAGGCCGG + Intronic
952521845 3:34168687-34168709 CAGGGCCCCCTACCTCAAGAAGG - Intergenic
954819729 3:53315335-53315357 CAAGGTCAGCCAGGTCAAGATGG + Intronic
955405586 3:58623720-58623742 CAGGGTCACCCAGCTAGTAAGGG - Intronic
955780472 3:62478954-62478976 TAGGGTGACTCAGATCAAGAGGG + Intronic
956699973 3:71950379-71950401 CAGGGTCACACAGCTCCAAGTGG - Intergenic
957057591 3:75455880-75455902 CACGGTCGCCCAGCTGAGGAGGG + Intergenic
961889937 3:130122312-130122334 CACGGTCGCCCAGCTGAGGAAGG + Intergenic
962901282 3:139764159-139764181 TATGCTCACCCAGCTAAAGATGG + Intergenic
964369822 3:155988269-155988291 CAGGGTGACAGAGCACAAGAGGG - Intergenic
965097695 3:164255127-164255149 GAAGGTCCCCCAGCTCCAGAAGG + Intergenic
966249460 3:177846811-177846833 AAGGGTCAGCCAGATCAAGTAGG + Intergenic
967118987 3:186365934-186365956 CAGGGTCACCAACCGCAAGGTGG + Intergenic
968483558 4:848183-848205 CAGGCTGACCCAGCTCAGAAGGG - Intergenic
969000417 4:3976290-3976312 CACGGTCGCCCAGCTGAGGAAGG + Intergenic
969055212 4:4397404-4397426 CAAGGTCACCCAGCTAATGAGGG + Intronic
969753605 4:9132375-9132397 CACGGTCGCCCAGCTGAGGAAGG - Intergenic
969813502 4:9668560-9668582 CACGGTCGCCCAGCTAAGGAAGG - Intergenic
970557648 4:17250901-17250923 CATGGTCACCTAGCTCATGATGG - Intergenic
973207506 4:47576677-47576699 TGAGGTCACCCAGCTCAAAATGG + Intronic
979219904 4:118210795-118210817 CGGGGGGACCCTGCTCAAGAGGG + Intronic
981584778 4:146289141-146289163 CAGTGCCACCCAGCTAATGACGG - Intronic
982263205 4:153514128-153514150 TACGGTCACCCAGGGCAAGAGGG - Intronic
986447867 5:7838702-7838724 CAGGGTCAGCCAGGTCAGGAGGG - Intronic
992450959 5:76875359-76875381 CATGCCCACCCAGCTCGAGATGG + Exonic
996410322 5:123151763-123151785 CAGGGTCCCCCAGCTCACCTTGG + Intronic
997744207 5:136284695-136284717 AAGAGGCACCCAGCCCAAGAAGG + Intronic
999596378 5:153209874-153209896 CAGGAACACCCATCTCAAGCAGG + Intergenic
999628791 5:153548086-153548108 CAGGCTCAGCCTGCTCAAGCAGG - Intronic
1000409612 5:160924301-160924323 CAGGGGCACCCAGCTGAAGGTGG - Intergenic
1001009811 5:168087278-168087300 CAGGATCACCCAGGAAAAGATGG - Intronic
1003129917 6:3386707-3386729 CAGGGTCACCCAGCGTGGGAGGG + Intronic
1004193427 6:13484467-13484489 CAGGGGCACCCTGCAAAAGAAGG + Intronic
1005117122 6:22351342-22351364 CATGGTCACCCATCTGAGGAGGG + Intergenic
1005286290 6:24330657-24330679 CAGGATCCCACAGCTCAAGGGGG + Intronic
1006297561 6:33176746-33176768 CAGGGTCACCCAGGGAAGGAAGG - Exonic
1010090823 6:71979392-71979414 CAGGGTCACCCAGCAGGACAGGG + Intronic
1011615751 6:89196935-89196957 CAGGGAGAACCAGCTCAACATGG + Intronic
1017014163 6:150086402-150086424 CAGGGTCACCCAGCAATAGTGGG - Intergenic
1017711209 6:157169970-157169992 CAGGGTATCCCAGCTCCAGCAGG + Intronic
1017911887 6:158800451-158800473 CAAGGACACTTAGCTCAAGAAGG - Intronic
1024588560 7:50861469-50861491 TAGGGTCACACAGCTCATAAAGG - Intergenic
1026828808 7:73599589-73599611 CAGGGTCCCACTGCTGAAGAGGG + Exonic
1030381424 7:108815796-108815818 CAAGGTCATACAGCTCATGAGGG - Intergenic
1031313903 7:120233184-120233206 CTGGCTAACCCAGCTCAAGATGG - Intergenic
1031499927 7:122501538-122501560 CAAGGTCACCCAGATAAAAAGGG + Intronic
1032269295 7:130388949-130388971 CAGGATCACCAAGCTGAAGAAGG - Intergenic
1033483634 7:141766206-141766228 CAAGGTCACCCAGTTCAAAAGGG - Intronic
1034630747 7:152528805-152528827 CAGGGTCACCCCACTCAAAGCGG - Intergenic
1035393283 7:158519603-158519625 CAGAGTCACCCAGATCAACATGG - Intronic
1036376818 8:8207707-8207729 CACGGTCGCCCAGCTGAGGAAGG - Intergenic
1036852719 8:12215430-12215452 CACGGTCGCCCAGCTGAGGAAGG + Intergenic
1036874090 8:12457952-12457974 CACGGTCGCCCAGCTGAGGAAGG + Intergenic
1036960465 8:13239655-13239677 CAGGGGCACAGACCTCAAGAGGG + Intronic
1038223199 8:25630346-25630368 CAGGGTCACACAGCTGATGGGGG - Intergenic
1040848316 8:51870213-51870235 TAAGCTCACCCAGCTCTAGAGGG + Intronic
1044749499 8:95402458-95402480 CAGGGTCTCCCCGCTCCAGCAGG + Intergenic
1045326520 8:101121456-101121478 CAAGGTCACCCAGCTAGAAAAGG - Intergenic
1046403731 8:113743734-113743756 CAGGGTCACACAGCCAAAAACGG - Intergenic
1047364135 8:124196912-124196934 CAAGGCCAGCCTGCTCAAGATGG - Intergenic
1047753432 8:127899771-127899793 CAGGCACACACAGCACAAGAGGG - Intergenic
1047762666 8:127965708-127965730 CTCGGACACCCAGCTCAAAATGG - Intergenic
1048057816 8:130885435-130885457 CAGGGTTACACAGCACGAGACGG + Intronic
1048140430 8:131789017-131789039 CAGGGTCACGCAGCTAGCGAAGG + Intergenic
1048704123 8:137131301-137131323 CAGGGTCGCCCTGCTTAACATGG + Intergenic
1049578039 8:143398537-143398559 CAGGCTCCCCCAGCCCAAGCAGG - Intergenic
1049763560 8:144342368-144342390 CAGGCACCCCCAGCTCAAGCTGG - Intergenic
1051374207 9:16387766-16387788 GAGGGGCACCCAACTCAAGCAGG + Intergenic
1054810286 9:69428802-69428824 CAGGTCCACCCAGCTGAAGTGGG - Exonic
1055641704 9:78324007-78324029 CAGGGACACCCATCCCACGAAGG - Intronic
1056264259 9:84880328-84880350 CAGGGTCACCCTGTACAAGGAGG + Intronic
1057955496 9:99403902-99403924 AGGGGTCACCCAGCTCTAGGAGG + Intergenic
1060025246 9:120165334-120165356 CAGGGTCACCCAGCTCATGAGGG - Intergenic
1060660230 9:125401082-125401104 CAGGGTCTCCCAGCTCCCAACGG + Intergenic
1060697089 9:125718613-125718635 CAGGTTCTCCCAGGTGAAGAGGG - Intergenic
1061149240 9:128819512-128819534 CAGTGTCACACAGCAGAAGAAGG + Intronic
1061154084 9:128846675-128846697 CAGGGTCACCCAGCCAAGGTGGG - Intronic
1061256842 9:129458583-129458605 CAGGGTCACCCAGCTGTTGATGG - Intergenic
1061630662 9:131870300-131870322 CAAGGTCACACAGCTCACAAGGG - Intronic
1061712615 9:132498491-132498513 CAGGGTCACACAGCAGAAGCGGG - Intronic
1062312742 9:135948032-135948054 CAGGCTCCCCCAGCTCATCAAGG - Intronic
1185611774 X:1397466-1397488 CAGGGTCACCCCCCTGAAAAGGG + Intergenic
1187888463 X:23911244-23911266 CAGGCTCATCCAGGTCAAGTCGG - Intronic
1187923468 X:24228790-24228812 CAGTGGCATCCAGCTCACGATGG + Intergenic
1188660982 X:32758335-32758357 CAAGCTCACGCAGCTCTAGATGG + Intronic
1192784546 X:74323540-74323562 CAGTGTCACCCAGCTACCGAGGG - Intergenic
1192804089 X:74494779-74494801 CAGTGTCACCCAGCTACTGAGGG + Intronic
1196904480 X:120418425-120418447 CAGGGGCACCAAGCTCTGGATGG + Intergenic
1197723642 X:129761393-129761415 CAAGGTTACCCAGCTCCACAGGG + Intronic