ID: 1084681116

View in Genome Browser
Species Human (GRCh38)
Location 11:70666982-70667004
Sequence CTGTGGAAGGTGAAGGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1091
Summary {0: 1, 1: 0, 2: 5, 3: 97, 4: 988}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084681106_1084681116 9 Left 1084681106 11:70666950-70666972 CCTCTTTTGCCAACATCTGCTTG 0: 1
1: 0
2: 1
3: 16
4: 238
Right 1084681116 11:70666982-70667004 CTGTGGAAGGTGAAGGGGGTGGG 0: 1
1: 0
2: 5
3: 97
4: 988
1084681105_1084681116 10 Left 1084681105 11:70666949-70666971 CCCTCTTTTGCCAACATCTGCTT 0: 1
1: 0
2: 0
3: 39
4: 338
Right 1084681116 11:70666982-70667004 CTGTGGAAGGTGAAGGGGGTGGG 0: 1
1: 0
2: 5
3: 97
4: 988
1084681108_1084681116 0 Left 1084681108 11:70666959-70666981 CCAACATCTGCTTGCAGCAGGAG 0: 1
1: 0
2: 0
3: 24
4: 170
Right 1084681116 11:70666982-70667004 CTGTGGAAGGTGAAGGGGGTGGG 0: 1
1: 0
2: 5
3: 97
4: 988
1084681102_1084681116 21 Left 1084681102 11:70666938-70666960 CCCCAAATGTACCCTCTTTTGCC 0: 1
1: 0
2: 2
3: 23
4: 191
Right 1084681116 11:70666982-70667004 CTGTGGAAGGTGAAGGGGGTGGG 0: 1
1: 0
2: 5
3: 97
4: 988
1084681104_1084681116 19 Left 1084681104 11:70666940-70666962 CCAAATGTACCCTCTTTTGCCAA 0: 1
1: 0
2: 1
3: 8
4: 137
Right 1084681116 11:70666982-70667004 CTGTGGAAGGTGAAGGGGGTGGG 0: 1
1: 0
2: 5
3: 97
4: 988
1084681103_1084681116 20 Left 1084681103 11:70666939-70666961 CCCAAATGTACCCTCTTTTGCCA 0: 1
1: 0
2: 0
3: 24
4: 189
Right 1084681116 11:70666982-70667004 CTGTGGAAGGTGAAGGGGGTGGG 0: 1
1: 0
2: 5
3: 97
4: 988

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084681116 Original CRISPR CTGTGGAAGGTGAAGGGGGT GGG Intronic
900132446 1:1092811-1092833 CTCTGGAAGGTGGGGGTGGTCGG + Intronic
900418644 1:2546240-2546262 GTGTGGGGGGTGAGGGGGGTGGG + Intergenic
901042118 1:6370734-6370756 CTGTGGGAGGCCAAGGTGGTTGG - Intronic
901204379 1:7485423-7485445 CTGGGGAAGGTGAAAGGGTTTGG + Intronic
901563260 1:10090225-10090247 CTCAGGAAGCTGAGGGGGGTGGG - Intronic
901677509 1:10894861-10894883 CTTTGGAAGGCGGAGGGGGGAGG - Intergenic
902210791 1:14903110-14903132 CTGTGGGAGGTGGAGGCGGGTGG - Intronic
902300982 1:15502581-15502603 CTGGGGAAGGTGAAGTGGCAGGG + Intronic
903347960 1:22699816-22699838 CCGTGGATGGTGACGGGGGTGGG - Intergenic
903506775 1:23841751-23841773 CTTTGGAAGGTGGAGGTGGGAGG + Intergenic
903514134 1:23898894-23898916 CTTTGGTAGGTGGAGGTGGTTGG - Intronic
903639867 1:24851487-24851509 CTCGGGAGGGTGAAGGGGGGAGG - Intergenic
903695233 1:25201447-25201469 GTGCGGAAGGTGAAATGGGTAGG - Intergenic
903950317 1:26992891-26992913 CTTTGGGAGGTCAAGGCGGTCGG - Intergenic
904013506 1:27403747-27403769 CTGAGGAAGGCGAGGGGGCTGGG - Intergenic
904593416 1:31627871-31627893 CTGGGGAAGGTAAGGGGGGCCGG + Intronic
904771398 1:32883279-32883301 CTTTGGGAGGCCAAGGGGGTTGG - Intergenic
904937028 1:34138411-34138433 CTCAGGGAGGTGAAGGAGGTTGG - Intronic
904963164 1:34350569-34350591 CAGTGGTAAGTGTAGGGGGTAGG + Intergenic
905018583 1:34793496-34793518 CTTTGGAGGTGGAAGGGGGTGGG + Intronic
905965557 1:42092484-42092506 TGGTGGAAGGTGAAGGGGAGTGG + Intergenic
906098362 1:43239442-43239464 CTGTAGAGGGTGGAGGGGGTGGG + Intronic
906117589 1:43366731-43366753 CAGTGGCATGTGAAGGGGTTGGG + Intronic
906305639 1:44717090-44717112 CTTTGGGAGGTCAAGGCGGTTGG - Intronic
906420785 1:45665043-45665065 CTTTGGGAGGCCAAGGGGGTTGG + Intronic
906650056 1:47506653-47506675 CTGTGGTAGGATAATGGGGTGGG + Intergenic
906990309 1:50730075-50730097 CTCTGGAGGGTGAAGGGGGTTGG + Intronic
907079901 1:51611725-51611747 CTCTGGAAGGTCAAGGGGTGGGG + Intronic
907102493 1:51849571-51849593 CTTTGGAAGGTGGAGGTGGATGG + Intronic
907330069 1:53664939-53664961 CTGTGGCAGGAGGAGGGGGAGGG + Intronic
907371277 1:54005130-54005152 CTGTGGATGGTTTGGGGGGTGGG + Intergenic
907574685 1:55515464-55515486 CTGTGAAAAATGAAGGGGGTTGG - Intergenic
907728624 1:57044251-57044273 CCGTGGAAGGTGACCTGGGTTGG + Intronic
908861248 1:68492461-68492483 CTTTGGAAGGTCAAGGTGGGTGG + Intronic
910332513 1:86090565-86090587 TGGTGGAAGTAGAAGGGGGTGGG - Intronic
910510833 1:88002106-88002128 CTGAGGAAGTTGGTGGGGGTCGG + Intergenic
910880665 1:91919791-91919813 CTGAGGAAGGGAAAGGTGGTTGG - Intergenic
910975185 1:92898868-92898890 CTCGGGAAGGTGAAGTGGGAGGG - Intronic
911273015 1:95826509-95826531 CTTTGGAAGGTCAAGGTGGGTGG + Intergenic
911653306 1:100414220-100414242 CTTTGGAAGGCCAAGGCGGTAGG + Intronic
912534199 1:110352559-110352581 CTGTGGGAGGCCAAGGTGGTTGG + Intergenic
913064725 1:115239902-115239924 CTGAGGTAGGTAAAGGGGTTGGG + Intergenic
913185213 1:116364478-116364500 CAGTGGAAAGAGAAGGGGCTGGG + Intergenic
913209296 1:116570162-116570184 GTGTGGAGGGTGAAGGAGGATGG + Intronic
914442852 1:147722310-147722332 GTGGAGAAGGTGATGGGGGTGGG + Intergenic
914713741 1:150237292-150237314 CTTTGGAAGGCCAAGGCGGTTGG + Intergenic
914783888 1:150810672-150810694 CTGAGGAAGGTAAAGGGTGAGGG + Exonic
914894767 1:151659488-151659510 CTTTGGAAGGTGAAGACGGGCGG - Intronic
914999032 1:152571320-152571342 CTTTGGGAGGTGAAGGTGGGTGG + Intronic
915079662 1:153343410-153343432 CTCTGAAAAGGGAAGGGGGTAGG - Intronic
915283568 1:154838820-154838842 CTGTGCAAGGTGCTGGGGGTGGG - Intronic
915301286 1:154953048-154953070 CTGAGGAGGGAGAAGGGGGTTGG - Intronic
915413603 1:155722470-155722492 CTTTGGGAGGTGAAGGTGGGAGG + Intronic
915511840 1:156390882-156390904 GTGTGGGAGGCGATGGGGGTTGG + Intergenic
915615762 1:157036880-157036902 CTGTGGGAGGTGGAGGCGGGCGG + Intronic
915622977 1:157097530-157097552 CTGGGGCAGGTGAAGGAGGTGGG - Intronic
916098970 1:161377216-161377238 CTTTGGAAGGCCAAGGGGGGCGG + Intergenic
916295587 1:163215819-163215841 CCGTGGAAGGTCAAGGTGGGAGG + Intronic
916508027 1:165445500-165445522 CTGTGAAAGGAGGAGGGGGTGGG + Intergenic
916717273 1:167456009-167456031 CTGAGGAAGGGGGAGGGGGCGGG - Intronic
917459205 1:175214573-175214595 CTGTGGCAGGGGACAGGGGTGGG + Intergenic
917470193 1:175319919-175319941 TTCTGGAAGGTGAAGGGGTCAGG - Exonic
917711248 1:177687602-177687624 CTGTGGGAAGTGAGGGAGGTAGG + Intergenic
917712946 1:177705793-177705815 CTGTGGAGGATGAAGGGTCTGGG - Intergenic
917805235 1:178607179-178607201 CTGTAGAAGGTGATGTTGGTTGG - Intergenic
917971748 1:180212470-180212492 CTTTGGAAGGCTAAGGTGGTAGG + Intergenic
918230249 1:182523282-182523304 CTTTGGAAGGTTAAGGTGGGAGG - Intronic
918507730 1:185275626-185275648 CTTTGGAAGGTCAAGGTGGGAGG - Intronic
918686442 1:187421560-187421582 CTTTGGAAGGTGAATTGGGTGGG + Intergenic
918952888 1:191162686-191162708 CTGTGGGAGGCCAAGGTGGTTGG - Intergenic
920377196 1:205515418-205515440 CTGTGGGAGGTCAAGGTGGGTGG - Intronic
920494401 1:206444392-206444414 CTGTGGAAGATGAAGAATGTTGG - Intronic
920660818 1:207912718-207912740 CTGAGGAAGTTGAGGGGAGTGGG - Intergenic
920826230 1:209426411-209426433 GTGTGGAAGGTCTAGAGGGTGGG - Intergenic
921058608 1:211563736-211563758 CTTTGGAAGGTCAAGGTGGGAGG + Intergenic
921191007 1:212708736-212708758 CTGTGGAAGTTGGATGGGGGCGG - Intergenic
921403385 1:214751891-214751913 CTTTGGGAGGTGAAGGTGGGCGG - Intergenic
921599143 1:217088947-217088969 CTCGGGAAGGTGAAAGGGTTGGG + Intronic
922195412 1:223355460-223355482 CTTTGGGAGGCGAAGGTGGTTGG - Intronic
923082860 1:230675896-230675918 CTTTGGAAGGTTGAGGGGGAAGG - Intronic
923232396 1:231999497-231999519 CTCTGGGAGGGGAAGGGAGTTGG - Intronic
923600561 1:235399196-235399218 CTTTGGGAGGTGAAGGCGGGTGG - Intronic
924064829 1:240210224-240210246 CTGTGGAATGTGTAGGTGGCAGG + Intronic
924111006 1:240700028-240700050 CTTTGGAAGGTCAAGGTGGGTGG - Intergenic
924262898 1:242250386-242250408 CCCTGGAAGGTGAAGGGGAATGG + Intronic
924630513 1:245735420-245735442 CTGTGGAAGGCCAAGGCGGGTGG + Intergenic
924690584 1:246346039-246346061 CTGTGGGAGGCCAAGGGGGGTGG + Intronic
924789782 1:247235281-247235303 CTTTGGGAGGTCAAGGGAGTAGG + Intergenic
1062876931 10:950017-950039 CTGTGGAAGGCCAAGGAGGGTGG - Intergenic
1063042901 10:2360814-2360836 CTGTGGTAGGTGGAGGTGGGTGG + Intergenic
1063243614 10:4195537-4195559 CTTTGGAAGGTGGAGGTGGGCGG + Intergenic
1063300255 10:4844430-4844452 GTGTGGAAGGGGACGGGAGTGGG + Intronic
1063334238 10:5195852-5195874 CTTTGGAAGGCCAAGGCGGTAGG - Intronic
1063348057 10:5329623-5329645 TAGAGGAAGGGGAAGGGGGTTGG - Intergenic
1063485961 10:6421239-6421261 CTTTGGAAGGCTAAGGGGGAAGG + Intergenic
1063885737 10:10576677-10576699 CTGAAGGAGGTGAAGGGGCTAGG - Intergenic
1064275755 10:13903483-13903505 CTTTGGAAGGTGAAGGCAGGAGG + Intronic
1064471111 10:15636899-15636921 CTTTGGAAGGTCAAGGCGGGTGG + Intronic
1064840757 10:19588884-19588906 CTTTGGAAGGCCAAGGCGGTCGG - Intronic
1064883347 10:20081795-20081817 CTTTGGGAGGTGAAGGTGGGCGG + Intronic
1065085409 10:22169847-22169869 CTTTGGGAGGTGAAGGTGGGTGG + Intergenic
1065113545 10:22462781-22462803 CTCTGGGAGGCGAAGGGGGGAGG - Intergenic
1065156010 10:22870860-22870882 CTCTGGAGGGTGAAGGAGGGAGG - Intergenic
1065243516 10:23733254-23733276 CTTTGGAAGGTCAAGGAGGGAGG - Intronic
1065485475 10:26232744-26232766 CTTTGGGAGGTGAAGGCGGATGG - Intronic
1065802935 10:29368894-29368916 CTTTGGAAGGTGGAGGCGGGTGG - Intergenic
1066168051 10:32808929-32808951 CTTTGGGAGGTGAAGGTGGCAGG + Intronic
1066721888 10:38348068-38348090 CCCTGGAAGGTGAAGGGGAATGG - Intergenic
1067695981 10:48535996-48536018 CTGTGGAAGGAGAAAGGCGCAGG + Intronic
1067698121 10:48549931-48549953 CTGTGGCAGGAGAATGGTGTCGG - Intronic
1069054699 10:63832459-63832481 CTTTGGGAGGTCAAGGTGGTTGG + Intergenic
1069325283 10:67225192-67225214 CTGTGGCTGCTGTAGGGGGTGGG - Intronic
1069483518 10:68805530-68805552 CTTTGGAAGGCCAAGGCGGTAGG + Intergenic
1069647488 10:70013091-70013113 CTTTGGAAGGCCAAGGGGGAAGG - Intergenic
1070146119 10:73774434-73774456 CTTTGGGAGGTCAAGGGGGGAGG + Intronic
1070183584 10:74038238-74038260 CTTTGGAAGGTCAAGGCGGGTGG - Intronic
1070755259 10:78988050-78988072 GTGTGGGGGTTGAAGGGGGTGGG + Intergenic
1070778177 10:79122371-79122393 CGCTGGAAGGTAAATGGGGTGGG - Intronic
1073213284 10:101821828-101821850 CTGTTGTAGGTGTTGGGGGTGGG - Intergenic
1073727231 10:106247629-106247651 CTGTGGCAGTGGATGGGGGTTGG - Intergenic
1074147543 10:110730059-110730081 CTGTGGGAGGTCAAGGCGGGTGG - Intronic
1074293309 10:112158172-112158194 CTTTGGGAGGTGAAGGCGGGTGG - Intronic
1074481170 10:113822352-113822374 CTGCGGAAGGAGAATGGTGTGGG - Intergenic
1075696183 10:124437266-124437288 CTGTGGAAGGCCGAGGGGGGTGG - Intergenic
1075883638 10:125877441-125877463 CTTTGGGAGGTGAAGGTGGGAGG + Intronic
1076207884 10:128617722-128617744 CTGTGGAGTGTGAAGGGTGGGGG - Intergenic
1076292585 10:129358875-129358897 TTTTGTAAGGTGAAGGGGGAAGG + Intergenic
1076571626 10:131437202-131437224 GGGTGGAGGGTGATGGGGGTGGG - Intergenic
1076578174 10:131485597-131485619 ATGTGGAAGGGGAAATGGGTAGG + Intergenic
1076762357 10:132611861-132611883 GTGTGGGAGGTGAAGTGGGCAGG + Intronic
1076762375 10:132611906-132611928 GTGTGGGAGGTGAGGGGGGCAGG + Intronic
1076762404 10:132611996-132612018 GTGTGGGAGGTGAGGAGGGTAGG + Intronic
1077206024 11:1344829-1344851 CTTTGGGAGGTGAAGGTGGGCGG + Intergenic
1077243094 11:1521671-1521693 CTTTGGAAGGTGAAGGTGGGTGG + Intergenic
1077534114 11:3111147-3111169 CTGTGGCAGGGGGTGGGGGTGGG - Intronic
1077922556 11:6652591-6652613 CTGTGGAAGAGGAAGGGGATGGG + Intronic
1078636531 11:13055473-13055495 GTTTGGGAGGTGAAGGTGGTGGG + Intergenic
1078643133 11:13114447-13114469 CTGGGGGAGGTGATGAGGGTGGG - Intergenic
1078781539 11:14443609-14443631 CTCTGGAAGGTGTTGGGGGCGGG - Intronic
1078984674 11:16581444-16581466 CTGTGGAGGGTGGAAGGGGAGGG + Intronic
1079156678 11:17954442-17954464 CTGTGGAAAGTGTAGGGGCCTGG + Intronic
1079252902 11:18800416-18800438 CTTGGAAGGGTGAAGGGGGTGGG + Intergenic
1080016802 11:27516250-27516272 CTCTGGAAGGTCAAGGTGGGTGG - Intergenic
1081031137 11:38085087-38085109 CTTTGGGAGGTGGAGGTGGTTGG - Intergenic
1081585403 11:44380526-44380548 CTGTGCAAGGTAAAGGGAGAGGG + Intergenic
1081814239 11:45929643-45929665 CTGGGGAAGGGGTAGGGGGGTGG + Intronic
1081871079 11:46382751-46382773 CAGCGAAAGGAGAAGGGGGTGGG + Intronic
1081994032 11:47352306-47352328 CTGTGGAAGGTGAAGGCAATGGG + Intronic
1082657055 11:55869002-55869024 CTGAGCAAAGAGAAGGGGGTGGG + Intergenic
1082715156 11:56603241-56603263 CTGTGGAAAGGGAAGGGGAGAGG - Intergenic
1082740629 11:56907103-56907125 CTGTGGAAAGGGAAGGTGGGCGG + Intergenic
1082813874 11:57495580-57495602 CTTTGGAAGGGCAAGGGGGGAGG + Intronic
1082822262 11:57552113-57552135 CTGGGGAATGTAAAGGGTGTGGG + Exonic
1082850686 11:57761773-57761795 CTTAGGAAAGCGAAGGGGGTAGG + Intronic
1082860182 11:57848033-57848055 CTGGGGAAGCTCAAGGGGTTGGG + Intergenic
1083044534 11:59721976-59721998 CTTTGGAAGGTCAAGGCGGGTGG - Intronic
1083882816 11:65556947-65556969 CTGGGGAGGGTGTAGGGGCTTGG + Intronic
1084171396 11:67402649-67402671 CTTTGGGAGGTCAAGGGGGGTGG - Intronic
1084681116 11:70666982-70667004 CTGTGGAAGGTGAAGGGGGTGGG + Intronic
1084868703 11:72081004-72081026 CTGTGAAAGGTGATGAGGGTCGG - Intronic
1084903999 11:72331991-72332013 ATGTGGGAGGTGGAGGGGGAAGG + Intronic
1084944404 11:72631046-72631068 CAGTGGAGGGAGAAGTGGGTGGG - Intronic
1085114381 11:73917626-73917648 CTTTGGAAGGTCAAGGTGGGTGG + Intronic
1085178052 11:74507829-74507851 GTGAGGAAGGTGAAGGAAGTGGG - Intronic
1085534631 11:77210684-77210706 GTCTGGAAGTTCAAGGGGGTGGG + Intronic
1086607552 11:88714276-88714298 CAGTGGTAGGTGAAAGGGGAGGG + Intronic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1087084602 11:94203857-94203879 CTTTGGAAGGTCAAGGTGGGAGG + Intergenic
1087447088 11:98268904-98268926 ATGTGGAAGGTGCAGGGTTTGGG + Intergenic
1087504803 11:99005876-99005898 CTGTAGAAGGTGAGGTGGGTAGG - Intergenic
1087888928 11:103514317-103514339 CTGGGGAGGGTAAAGGGGATGGG + Intergenic
1088222054 11:107579943-107579965 CTGTGGAAGGCTGAGGGGGGAGG - Intergenic
1088712342 11:112519833-112519855 CTTTGGGAGGCCAAGGGGGTTGG - Intergenic
1088867256 11:113860566-113860588 CTTTGGAAGGTGAAGGCAGGCGG + Intronic
1088976849 11:114823362-114823384 CTGAGGAAGGTGAAGCTGGCCGG - Intergenic
1089187087 11:116625442-116625464 CTGTGGAAGGATAAGGTGGAAGG + Intergenic
1089335998 11:117724402-117724424 CTGTGGAAGGTGAGGGTGGGAGG + Intronic
1089376463 11:117998727-117998749 CTGATGAAGATGAAGGGGCTGGG - Exonic
1089700618 11:120241794-120241816 CTGTGGAAGTGGGAGGGGGTGGG + Intronic
1089799995 11:121019790-121019812 CTTTGGAAGGTCAAGGTGGAAGG + Intergenic
1089850206 11:121489056-121489078 CTGTGGAAGTTGAGGGGCTTTGG + Intronic
1090229072 11:125088830-125088852 CAGTGGAAGGTGATGGGGGCCGG + Exonic
1090334189 11:125951762-125951784 CTGTGGAAGGAGGAAGGGCTTGG - Intergenic
1090751063 11:129746970-129746992 CTGTGGAAGTTGCAGATGGTGGG - Intergenic
1090872900 11:130763589-130763611 CTGAGGGAGGTGATGGGGCTTGG - Intergenic
1090908081 11:131094750-131094772 CTGTGGAAAGAGAAGGAGTTGGG + Intergenic
1091231687 11:133991786-133991808 CTGTCGGAGGTCAATGGGGTCGG + Intergenic
1091319986 11:134642524-134642546 CTGTGGAAGGTGCAGGAAGAGGG - Intergenic
1091583236 12:1801159-1801181 CTGAGGCAGGGGCAGGGGGTGGG - Intronic
1091730882 12:2879245-2879267 CTGTGAAAGGTGAAGGTGGGAGG - Intronic
1091848797 12:3678646-3678668 GTGAGGAAGGTAGAGGGGGTGGG + Intronic
1092331967 12:7593310-7593332 CTGAGGAGGGTGTAGGGGTTAGG - Intergenic
1092822383 12:12364721-12364743 CTTTGGAAGGCCAAGGCGGTTGG + Intronic
1093139833 12:15496383-15496405 TTGTGGAAGGTCAAGGCGGGTGG - Intronic
1093373033 12:18387522-18387544 CAGTGGAGGGTGAAGGGGCGAGG - Intronic
1093481571 12:19609268-19609290 CTTTGGAAGGTCGAGGCGGTTGG - Intronic
1095313795 12:40733487-40733509 CTCTGGCAGGGGAAGGGGGAGGG - Intronic
1095489503 12:42718319-42718341 CTTTGGGAGGTGAAGGTGGGTGG + Intergenic
1095498371 12:42809269-42809291 CTGTGGAAAGTGAAGAGAATGGG - Intergenic
1095800798 12:46268701-46268723 CGGAGGAAGGTGAAGGGCGGAGG + Intronic
1095954809 12:47799874-47799896 CTGGAGAAGGGGAAGTGGGTGGG + Intronic
1096229861 12:49890813-49890835 CTGAGGAGTGTGGAGGGGGTTGG - Intronic
1096498463 12:52051775-52051797 AAGTGGAAGCTGTAGGGGGTTGG + Intronic
1096589171 12:52646003-52646025 CAGTTGAAGCTGAAGAGGGTGGG - Intronic
1096741751 12:53698601-53698623 CTGTGGGAGGTCAAGGTGGGTGG - Intergenic
1097050427 12:56219907-56219929 CTGAGGAGGCTGAAGGGGGAAGG + Intronic
1097062456 12:56295709-56295731 CTGTGGGAGGTGGAGGCGGGCGG + Intronic
1098365046 12:69693506-69693528 CTTTGGAAGGTGGAGGCGGGCGG - Intronic
1098739537 12:74154951-74154973 CTGGGGAAGCTGAAGTGGGAGGG - Intergenic
1099174202 12:79401910-79401932 CTTTGGAAGGTCAAGGTGGGAGG - Intronic
1100277360 12:93083219-93083241 CTTTGGAAGGTGTAGGTGGGTGG - Intergenic
1100356264 12:93833587-93833609 CTTTGGAAGGCCAAGGGGGGAGG - Intronic
1100511752 12:95281787-95281809 CTTTGGGAGGTGAAGGCGGATGG - Intronic
1100640793 12:96480788-96480810 CTTTGGGAGGTGAAGGCGGGTGG - Intergenic
1101245167 12:102878066-102878088 CTTTGGGAGGCCAAGGGGGTGGG - Intronic
1101623487 12:106415173-106415195 CTGTGGAAGATGAATGGAGTTGG - Intronic
1101751335 12:107584980-107585002 CTTTGGAAGGTGAAGGAGTGGGG + Intronic
1101879511 12:108616854-108616876 CTGTGGAAGGCCAAGGTGGGCGG - Intergenic
1102130194 12:110521797-110521819 CTTTGGGAGGTCAAGGGGGGTGG - Intronic
1102229098 12:111250132-111250154 GAGTGGAAGGGAAAGGGGGTGGG - Intronic
1102255233 12:111411120-111411142 CTTTGGAAGGTCAAGGTGGGAGG + Intronic
1102258630 12:111430182-111430204 ATGGGGAAGGCGGAGGGGGTTGG + Intronic
1102329138 12:112013992-112014014 CTGTGGAAGCTGGGAGGGGTTGG + Intronic
1102661121 12:114529444-114529466 CTTTGGGAGGTGAAGGTGGGAGG + Intergenic
1102666669 12:114580072-114580094 CTGTGGGAGGCGAAGGTGGGGGG + Intergenic
1102902494 12:116649077-116649099 CTTTGGAAGGTGGAGGTGGGAGG + Intergenic
1103180049 12:118902889-118902911 CTTTGGAAGGTCAAGGCGGGCGG - Intergenic
1103216226 12:119203352-119203374 CTTTGGAAGGTCAAGGTGGGTGG - Intronic
1103303080 12:119943005-119943027 CTTTGGAAGGCCAAGGTGGTTGG - Intergenic
1103407119 12:120683916-120683938 CTTTGGAAGGTCAAGGCGGGAGG + Intergenic
1104184489 12:126416888-126416910 CTTTGGAAGGCCAAGGGGGGCGG + Intergenic
1104548342 12:129732603-129732625 TTGTGGAAGGGGAAGTGGGAGGG - Intronic
1104622973 12:130332167-130332189 CTGGGGGAGGGGAACGGGGTTGG - Intergenic
1104679318 12:130738394-130738416 CTGTCGAGGGTGGAGGGGCTGGG - Intergenic
1104986969 12:132602812-132602834 CTGGGGAAGGGGAAGGGGCCTGG + Intergenic
1105042743 12:132973720-132973742 CTTTGGGAGGTGAAGGTGGGAGG + Intergenic
1105260557 13:18776092-18776114 CGGTGGAAGGTAAAAGGGATGGG - Intergenic
1105479102 13:20756985-20757007 CATTGGAGGGTGAAGAGGGTGGG - Intronic
1105666853 13:22569160-22569182 CTTTGGAAGGTGGAGGCGGACGG - Intergenic
1105698479 13:22915030-22915052 CTTTGGGAGGTGAAGGCGGGTGG - Intergenic
1105850147 13:24327266-24327288 CTTTGGGAGGTGAAGGCGGGTGG - Intergenic
1106163631 13:27222362-27222384 CTGTGGGAGGTCAAGGTGGGTGG + Intergenic
1106291704 13:28369279-28369301 CTTTGGGAGGCCAAGGGGGTCGG + Intronic
1106787006 13:33117352-33117374 CTTTGGGAGGTGGAGGTGGTTGG - Intronic
1107093953 13:36514907-36514929 CTGAGGAAGGTGAAGAGAGGAGG + Intergenic
1107186660 13:37530082-37530104 CTGTGGAAGGTGAGGGAGTTGGG + Intergenic
1107937961 13:45361156-45361178 CTTTGGGAGGTGGAGGGGGAAGG - Intergenic
1107945612 13:45415505-45415527 CTTTGGAAGGTGGAGGAGGGTGG + Intronic
1108353203 13:49606142-49606164 CTTTGGAAGGTCAAGGCGGGTGG + Intergenic
1108385555 13:49896219-49896241 CTGTGGAAGGTCAAGGTGGGTGG + Intergenic
1109378215 13:61524932-61524954 CTGGGGATGGTGAAGAGAGTTGG + Intergenic
1110636662 13:77774812-77774834 CTTTGGGAGGTGGAGGTGGTAGG - Intergenic
1111760442 13:92457405-92457427 CTGGGGAAGGAGAAGGGTGCTGG - Intronic
1111777236 13:92679895-92679917 CTCTTGAAAGAGAAGGGGGTGGG - Intronic
1112346700 13:98596231-98596253 CTGTGGAAGGCCAAGGGGGGTGG - Intergenic
1112718292 13:102212421-102212443 CTGTGGGAGGTGAAGGGTGGAGG - Intronic
1112720018 13:102233372-102233394 CTTTGGAAGGTCAAGGTGGGTGG - Intronic
1112963777 13:105161618-105161640 CTGTGGAAGGAGGAGGGCCTGGG + Intergenic
1113954646 13:114091186-114091208 CTGTGAAAGATGAAGGGTCTGGG + Intronic
1114517744 14:23310772-23310794 CTTGGGGAGATGAAGGGGGTGGG + Exonic
1114732493 14:25008258-25008280 CTGTGGGAGATGAAGGTGGGAGG + Intronic
1115305258 14:31927372-31927394 CAGTGGAAGGAGAAGGAGTTGGG - Intergenic
1115437234 14:33388484-33388506 CTGTGGCAGGTGAATGGGGGCGG + Intronic
1116008639 14:39324977-39324999 CTTTGGGAGGTCAAGGTGGTGGG + Intronic
1116542684 14:46117880-46117902 CTTTGAAAGGTAATGGGGGTGGG + Intergenic
1117146981 14:52845595-52845617 CTTTGGAAGGTGGAGGCGGGTGG + Intergenic
1117154617 14:52925885-52925907 CTTTGGGAGGCCAAGGGGGTTGG - Intronic
1117516024 14:56502134-56502156 GTGTGGAGGGTGGAGGGGGTGGG - Intronic
1118382774 14:65230964-65230986 CTTTGGAAGGTGGAGGTGGGCGG + Intergenic
1118913270 14:70079686-70079708 CTGAGGAAAATGAAGGGGGAGGG - Intronic
1119443776 14:74647303-74647325 CAGAGGAAGGAGAAGGGAGTCGG - Intergenic
1119533032 14:75376483-75376505 TGGTGGAAGGTGAAGAGGGAGGG - Intergenic
1120820790 14:88910244-88910266 CTGTGGAAGGGGAAAGTGGCTGG - Intergenic
1121084880 14:91138246-91138268 CTTTGGGAGGTGAAGGTGGGTGG + Intronic
1121400110 14:93668599-93668621 CTTTGGGAGGTGAAGGTGGGTGG + Intronic
1121554406 14:94825367-94825389 ATGGGGAAGATGAATGGGGTGGG + Intergenic
1121717679 14:96087954-96087976 CTTGGGAAGGTGTGGGGGGTGGG - Exonic
1121764503 14:96474363-96474385 CTTTGGAAGGTCAAGGTGGGAGG + Intronic
1121857637 14:97284518-97284540 CTTTGGGAGGTGAAGGTGGGTGG - Intergenic
1121994165 14:98589021-98589043 TGGTGGAAGGTGAAGGGGAGTGG - Intergenic
1122267112 14:100551862-100551884 GTGGGGAAGGGGAAGTGGGTCGG + Intronic
1122587857 14:102822760-102822782 CTTTGGGAGGTGAAGGCGGGTGG + Intronic
1122589541 14:102837380-102837402 CTTTGGAAGGTCAAGGTGGAAGG - Intronic
1122729082 14:103781893-103781915 CTGTGGGAGGCCAAGGAGGTTGG - Intronic
1122752470 14:103948258-103948280 CTTTGGGAGGTGAAGGTGGGAGG - Intronic
1122896811 14:104761912-104761934 CTGTGGGAGGTCAAGGCGGGTGG + Intronic
1123058607 14:105584245-105584267 GTGAGGAAGGTGATGGTGGTGGG + Intergenic
1123082938 14:105704479-105704501 GTGAGGAAGGTGATGGTGGTGGG + Intergenic
1123116111 14:105894786-105894808 CTGGGGCAGGTGCAGGGGGTGGG + Intergenic
1123120342 14:105913499-105913521 CTGGGGCAGATGCAGGGGGTGGG + Intergenic
1202870224 14_GL000225v1_random:156086-156108 CTGGGGAGGCTGAAGTGGGTTGG - Intergenic
1123403068 15:20005076-20005098 CTGGGGTAGGTGCAGGGGGTGGG + Intergenic
1123512407 15:21011730-21011752 CTGGGGTAGGTGCAGGGGGTGGG + Intergenic
1124622476 15:31282069-31282091 CTTTGGGAGGTGAGGGGGGGCGG - Intergenic
1124641834 15:31400696-31400718 GTGTGGAAGGTGGAGGAGGGTGG + Intronic
1124793695 15:32754477-32754499 TGGTGGAAGGTGAAGGGGAGAGG - Intergenic
1125507542 15:40275734-40275756 CTGTGGAAGGGGCAGAGGATTGG - Intronic
1125615441 15:41007928-41007950 CTGTGGAAGGTCGAGGTGGGTGG + Intronic
1125846573 15:42860501-42860523 CTTTGGGAAGTCAAGGGGGTTGG + Intronic
1125850061 15:42894506-42894528 CTGTGGGAGGCGAAGGCGGGTGG + Intronic
1125956853 15:43796425-43796447 CTGTATGAGATGAAGGGGGTGGG - Exonic
1126033690 15:44526780-44526802 CTGTGTGAGCTGAAGGGGCTGGG - Exonic
1126312731 15:47335872-47335894 CTGTGGAAGGTCAAGTGGACCGG + Intronic
1126476917 15:49074933-49074955 CTGTGGGAGGTGAGGGGGTAGGG + Intergenic
1126640017 15:50814868-50814890 CTTTGGGAGGTGGAGGGGGTAGG - Intergenic
1126744792 15:51815016-51815038 CTTTGGGAGGTGAAGGTGGGTGG + Exonic
1126935950 15:53708019-53708041 ATGTGGAAGGTGAAGGCAGAGGG - Intronic
1127233661 15:57023827-57023849 CTGTGGATGGTGAGGGTTGTAGG + Intronic
1127545341 15:59989143-59989165 CTGTGGGAGGTCAAGGTGGGTGG + Intergenic
1127883224 15:63176253-63176275 GGGGAGAAGGTGAAGGGGGTAGG - Intergenic
1127996475 15:64155896-64155918 CTGTGGAATGTGAGGGGAGTGGG + Exonic
1128073703 15:64813014-64813036 CTGCGGAAGGGGAAGGGGCTGGG + Intergenic
1128140121 15:65293764-65293786 CTTTGGAAGGCGGAGGTGGTCGG + Intronic
1128170210 15:65504736-65504758 CTTTGGAAGGTCAAGGTGGGAGG + Intronic
1128254039 15:66184368-66184390 CTGTGGAAGAGGGAGGGGGATGG - Intronic
1128257211 15:66205787-66205809 CTCTGGCAGGGGAAGGAGGTGGG - Intronic
1128378266 15:67092637-67092659 CTGAGGAGGGTGCTGGGGGTAGG + Intronic
1129013800 15:72447629-72447651 CTGTGGGAGGTCAAGGCGGGCGG + Intergenic
1129067149 15:72914802-72914824 CTGTGGAAGGAGAAGGCAGAAGG - Intergenic
1129156140 15:73719394-73719416 CCGTGAAAGGAGAAGGGGGAGGG - Intergenic
1129158087 15:73731325-73731347 GTGGGGAAGGGGAAGGGGGAGGG - Intergenic
1129210308 15:74064509-74064531 CTGTGGCAGGGGAGGTGGGTGGG - Intergenic
1129368712 15:75073784-75073806 CTTTGGAAGGTCAAGGTGGGTGG - Intronic
1129403714 15:75300893-75300915 CTGTGGCAGGGGAGGTGGGTGGG + Intergenic
1129556961 15:76520459-76520481 CTTTGGGAGGTCAAGGTGGTTGG - Intronic
1129740059 15:77985797-77985819 ATGAGGCAGGTGAAGGGCGTGGG - Intronic
1129764881 15:78157904-78157926 CTTTGGGAGGTGAAGGTGGGAGG - Intronic
1130417805 15:83710471-83710493 CTGTTGAAGGTGGTGGGGGGAGG - Intronic
1131133854 15:89917968-89917990 CTTTGGGAGGTCAAGGAGGTAGG + Intergenic
1131466715 15:92661380-92661402 GTTTGGAAGATGAAGAGGGTGGG - Intronic
1131853403 15:96566534-96566556 CTGTAGAAGGAGAGGGGGCTGGG - Intergenic
1132059150 15:98677178-98677200 CTTTGGGAGGTGAAGGTGGGAGG - Intronic
1132671150 16:1102779-1102801 CTGTGGGAGGTGAGGGGGGCTGG - Intergenic
1132983325 16:2750474-2750496 CTTTGGGAGGTTAAGGGGGGAGG + Intergenic
1133061048 16:3174880-3174902 CTTTGGAAGGCCGAGGGGGTAGG - Intergenic
1133229517 16:4359965-4359987 CAGGGGAGGGTGAGGGGGGTAGG - Intronic
1133480381 16:6164719-6164741 CTTTGGAAGGCCAAGGGGGGTGG - Intronic
1133903182 16:9996268-9996290 CTCTGGAAGGTGAAAGAGGCAGG - Intronic
1134141146 16:11720658-11720680 CTTTGGAAGGTCAAGGCGGGTGG - Intronic
1134247441 16:12550291-12550313 CTGTGGGAGGCCAAGGTGGTTGG + Intronic
1134562012 16:15219039-15219061 CTGAGGAGGGGGAAGTGGGTGGG - Intergenic
1134630735 16:15753960-15753982 CTGTGGAAGGCCAAGGTGGGTGG + Intronic
1134661042 16:15984857-15984879 CTTTGGCAGGTGAAGGTGGGAGG + Intronic
1134922550 16:18130665-18130687 CTGAGGAGGGGGAAGTGGGTGGG - Intergenic
1135713709 16:24742077-24742099 CTTTGGAAGGCCAAGGTGGTAGG - Intronic
1135775372 16:25253382-25253404 CTGGGGAAGGGAAAGGGGGTAGG - Intronic
1135975652 16:27107719-27107741 CTTTGGGAGGTCAAGGTGGTTGG - Intergenic
1135983498 16:27167005-27167027 CTGTGGTTGGTGGAGTGGGTGGG - Intergenic
1136000040 16:27285569-27285591 CTGTGGAAGGCCAAGGCGGGAGG + Intronic
1136077045 16:27824339-27824361 CTGTGGAAAGAGCAGGGGTTTGG - Intronic
1136161861 16:28425278-28425300 CTTTGGGAGGTGAAGGTGGGTGG - Intergenic
1136201105 16:28689710-28689732 CTTTGGGAGGTGAAGGTGGGTGG + Intronic
1136217448 16:28803896-28803918 CTTTGGGAGGTGAAGGTGGGTGG + Intergenic
1136345829 16:29675201-29675223 GTCTGGAAGGTGAAAGAGGTTGG + Intronic
1136478663 16:30527734-30527756 CTGGGGAAGGTGGAGGGGAGAGG - Intronic
1137245164 16:46696896-46696918 CTTTGGGAGGTGAAGGGGGCGGG - Intronic
1137359951 16:47805266-47805288 CTTTGGGAGGCCAAGGGGGTAGG - Intergenic
1137567018 16:49539658-49539680 CTGTGCAAGGTGGTGGGTGTGGG + Intronic
1137649140 16:50104104-50104126 CTATGGAAGGCCAAGGTGGTAGG + Intronic
1137669530 16:50271348-50271370 CTTTGGGAGGTGAAGGTGGGAGG - Intronic
1137725885 16:50656319-50656341 CAGTGGAAGGTGAAGGGGAGCGG - Intergenic
1137794008 16:51199461-51199483 CTTTGGAAGGCCAAGGTGGTAGG - Intergenic
1138313293 16:56046679-56046701 CTTTGGAAGGTCAAGGTGGGAGG - Intergenic
1139356728 16:66371265-66371287 CTGTGGAATGGGAAAGCGGTGGG + Intronic
1139405165 16:66712224-66712246 CTTTGGGAGGTGAAGGAGGCAGG + Intergenic
1139524439 16:67505503-67505525 CTTTGGGAGGTGAAGGCGGGAGG - Intergenic
1139598622 16:67972540-67972562 CTTTGGGAGGTCAAGGTGGTTGG + Intergenic
1140110341 16:71998692-71998714 CTTTGGAAGGTGGAGGTGGATGG - Intronic
1140597294 16:76431434-76431456 CTTTGGAAGGTGGAGGTGGGGGG + Intronic
1140898768 16:79349324-79349346 CTTTGGAAGGTGTAGGGTCTTGG - Intergenic
1141061207 16:80872764-80872786 CTCTGGAAGGTGGAGGTGGGAGG + Intergenic
1141093847 16:81148731-81148753 CTTTGGAAGGTCAAGGTGGGTGG + Intergenic
1141295746 16:82767579-82767601 CTGGGGAAGTTAAAGGGGGCAGG - Intronic
1141543233 16:84743304-84743326 CTGTGGGGGGTGAAGGGTGGTGG - Intronic
1141585376 16:85030006-85030028 CTGTGGAATGGGAAGTGGGGCGG + Intronic
1141989940 16:87603724-87603746 CTGTGCCAGCTGAAGGGTGTTGG + Intronic
1142014871 16:87740099-87740121 CTGGAGAAGGTGCAGGGGGTTGG - Intronic
1142152007 16:88516795-88516817 TTGTAGAAGGAGAAGGGGGAGGG + Intronic
1142473478 17:176462-176484 CTTTGGGAGGTGAAGGCGGGAGG - Intronic
1142488291 17:260819-260841 CTGTGCCTGGTGATGGGGGTGGG - Intronic
1143177245 17:4963008-4963030 CTTTGGAAGGTCAAGGTGGGAGG - Intronic
1143660197 17:8319874-8319896 CTTTGGGAGGTGAAAGGGGACGG - Intronic
1144070196 17:11664591-11664613 CTGAGGAAGGAGGATGGGGTTGG - Intronic
1144190827 17:12843898-12843920 CTTTGGAAGGTCAAGGTGGGTGG - Intronic
1144566299 17:16362363-16362385 CTTTGGAAGGTCAAGGCGGGTGG - Intergenic
1144938481 17:18919120-18919142 CTGTGGAAGGCTAAGGTGGAAGG + Intronic
1144948925 17:18983698-18983720 CTGTGGAGGGTGGAGAGGGGTGG + Intronic
1145030610 17:19502079-19502101 CTTTGGGAGGCCAAGGGGGTAGG + Intronic
1145779521 17:27553108-27553130 CTTTGGAAGGTGAAAGGGCTTGG - Intronic
1145881512 17:28356174-28356196 CTGTGGGAGGTCAGGAGGGTGGG - Intronic
1145962835 17:28897476-28897498 CTGTGGAGGGTGCTCGGGGTGGG - Intronic
1146013694 17:29215875-29215897 CTTTGGAAGGTCAAGGTGGGAGG + Intergenic
1146018020 17:29249212-29249234 CTGTTGGATGTGATGGGGGTGGG - Intronic
1146542213 17:33706465-33706487 CTTTGGGAGGTGAAGGTGGGTGG - Intronic
1146958011 17:36948363-36948385 CTGAGCAAGGGAAAGGGGGTGGG - Intergenic
1146970127 17:37065698-37065720 CTGGGGTAGGTGGAGGGCGTGGG + Intergenic
1147112958 17:38277451-38277473 CAGAGGAAGGAGAATGGGGTGGG - Intergenic
1147287550 17:39414576-39414598 CTTTGGGAGGTGAAGGCGGGTGG - Intronic
1147335233 17:39723610-39723632 CTGAGGAAGGTGAAGGTGCTTGG + Exonic
1147378073 17:40034862-40034884 CTGTGCTAGGTGCTGGGGGTGGG - Intronic
1147432322 17:40379920-40379942 CTTTGGAAGGCCAAGGGGGGCGG - Intergenic
1147471520 17:40666484-40666506 ATGGGGAAGGTGCAGGAGGTAGG - Intergenic
1147574902 17:41593431-41593453 ATGGGCAAGGTGAAGGGGGTGGG - Intergenic
1147683081 17:42266629-42266651 CTGTGGAAGGTTGAGGTGGGAGG + Intronic
1147794707 17:43034159-43034181 CTGAGGAAGGTGTGGGGGGAGGG + Intergenic
1147882243 17:43661395-43661417 TGGTGGAAGGAGAACGGGGTGGG + Exonic
1147975330 17:44244531-44244553 CTGTGGGAGGTTGAGGGGGGAGG - Intergenic
1148122542 17:45221638-45221660 CTGCGGCAGGTGAAGCGGCTCGG + Intronic
1148150008 17:45391378-45391400 CTGAGGAGGGTGTAGGGGGCAGG + Intergenic
1148247583 17:46044686-46044708 CTGTGGAAGGTGGAGAGACTAGG - Intronic
1148416663 17:47511774-47511796 CAGAGGAAGGAGAATGGGGTGGG + Intergenic
1148484015 17:47978928-47978950 CTCTGGAAGATGCAGGGGGGAGG + Intronic
1148591983 17:48823305-48823327 CTTTGGGAGGTGAAGGTGGGAGG - Intergenic
1148722388 17:49763568-49763590 GAGTGGAAGATGCAGGGGGTGGG - Intronic
1148805825 17:50263512-50263534 CTTGGGAGGGTGAAGGGAGTGGG + Intergenic
1148812056 17:50299625-50299647 CTTTGGGAGGTGAAGGTGGGAGG - Intergenic
1148925191 17:51078036-51078058 CTTTGGGAGGTGAAGGTGGGAGG - Intronic
1149141815 17:53440274-53440296 CTGTGTATGGTGAGGGGGGATGG - Intergenic
1149460030 17:56821164-56821186 CTTTGGGAGGCCAAGGGGGTAGG - Intronic
1149734024 17:58975391-58975413 CTGTGGAAGGCCAAGGAGGGAGG + Intronic
1150072527 17:62163960-62163982 CTGTGGTAGGTGAAGGGGCAAGG - Intergenic
1150270564 17:63861805-63861827 CTTTGGAAGGTCAAGGCGGGCGG + Intergenic
1150351647 17:64449690-64449712 CTTTGGAAGGCTAATGGGGTAGG + Intronic
1150457336 17:65317372-65317394 ATGAGGAAGGGGAAGGGGCTTGG + Intergenic
1150723973 17:67636660-67636682 CTGTTGAAGGTGATGGGGCTGGG - Intronic
1150834491 17:68552161-68552183 CTTTGGGAGGTGAAGGCGGGAGG + Intronic
1151509078 17:74547312-74547334 CTGTGGAGAATGAAAGGGGTGGG - Intergenic
1151522683 17:74641569-74641591 CTGGGGAAGGGGAGGTGGGTGGG - Intergenic
1151669578 17:75564617-75564639 CTGTGGGAGGCCAAGGTGGTAGG + Intronic
1151688958 17:75668142-75668164 ATCTGGAAAGTGAAGGGGATTGG + Intronic
1151714320 17:75823694-75823716 CTGGGGAAGGTGAAAAGGCTGGG + Intronic
1151716372 17:75833092-75833114 CAGGGGAAGGGGATGGGGGTGGG - Intronic
1151868820 17:76822654-76822676 AGGTGGAAGGTGGAGGAGGTGGG + Intergenic
1152175540 17:78784531-78784553 CTCTGGAAGCTGAAGTGGGAGGG + Intergenic
1152401533 17:80069448-80069470 CTGAGGAAGCTGAAGGGGTCAGG + Intronic
1152491788 17:80639809-80639831 CTTTGGAAGGTGAAATGGATAGG + Intronic
1152504376 17:80738001-80738023 CTGTGAGAGGTTAAGAGGGTGGG + Intronic
1152572665 17:81127434-81127456 CTCTGGAAGGTGGTGGGGGCAGG + Intronic
1152830930 17:82496725-82496747 CTGTGGAAGGCGCAGGGGCCAGG + Intergenic
1153579724 18:6560752-6560774 CTTTGGAAGGTCAAGGCGGGCGG - Intronic
1154239276 18:12637698-12637720 CTGTTGAAGGGGAATGGGCTTGG - Intronic
1154247200 18:12709741-12709763 CTCTGGAAGGCCAAGGTGGTTGG - Intronic
1154293744 18:13132206-13132228 CTTTGGAAGGCCGAGGGGGTTGG + Intergenic
1154330110 18:13422451-13422473 CTTTGGGAGGTGAAGGTGGGAGG + Intronic
1154344176 18:13528554-13528576 CTTTGGAAGGTGAAGGTGGGTGG - Intronic
1154426386 18:14275303-14275325 GGGTGGAAGGAAAAGGGGGTGGG + Intergenic
1156628946 18:38943912-38943934 CTGTGGAAGGAGACCAGGGTGGG + Intergenic
1157294305 18:46431520-46431542 CTGTGGAGGGTGCAGGGGAGGGG + Intronic
1157327911 18:46682116-46682138 CTGGGGAGGGTGCAGGGGGAGGG + Intronic
1158589168 18:58765324-58765346 GTGTGGAAGTTGGTGGGGGTTGG - Intergenic
1158718220 18:59899714-59899736 AGGTGGGAGGAGAAGGGGGTCGG - Intergenic
1158836335 18:61334380-61334402 CTGTGGGAGGAGAATGTGGTGGG + Intronic
1158976925 18:62717196-62717218 CTGTGGAGGGTGCAGGAGGAAGG + Exonic
1159215939 18:65390653-65390675 CTGTGGGAGGTGGAGGGGTGAGG + Intergenic
1159500410 18:69261719-69261741 CTTTGGAAGGTCAAGGTGGGAGG + Intergenic
1159574084 18:70155071-70155093 CTTTGAAAGTTGAAGGCGGTGGG - Intronic
1160075157 18:75667570-75667592 CTGTGGGAGGTGGCGGGGGTGGG - Intergenic
1160136762 18:76278604-76278626 CTTTGGAAGGCCAAGGGGGGTGG + Intergenic
1160342657 18:78102597-78102619 TTGTGGAGCGTGAAGGGGGAGGG + Intergenic
1161170644 19:2810821-2810843 CCTGGGAAGGTGAAGGGAGTTGG + Intronic
1161275038 19:3411261-3411283 CTTTGGAAGGTCAAGGAGGGAGG - Intronic
1161540116 19:4845524-4845546 CTTTGGGAGGCCAAGGGGGTTGG + Intronic
1161865764 19:6831119-6831141 CTGTGGTAGGTGAGGGTGGGAGG + Intronic
1161922720 19:7278613-7278635 CTTTGGGAGGTCAAGGGGGGTGG + Intronic
1162005946 19:7779350-7779372 CTTTGGAAGGTCAAGGTGGGAGG - Intergenic
1162077511 19:8197864-8197886 CTTTGGGAGGTGAAGGTGGGCGG + Intronic
1162146096 19:8612792-8612814 CTTTGGGAGGTCAAGGTGGTCGG - Intergenic
1162305017 19:9867125-9867147 CTTTGGGAGGTGAAGGTGGGCGG + Intronic
1162309992 19:9900587-9900609 GTGTGAAACGTGATGGGGGTGGG + Intronic
1162398061 19:10429579-10429601 CTTTGGGAGGTGAAGGTGGGCGG - Intronic
1162604648 19:11697335-11697357 CTGTGGAAGGCTGAGGGGGGAGG - Intergenic
1162645542 19:12047318-12047340 CTTTGGGAGGTGAAGGCGGGCGG + Intronic
1162717350 19:12642442-12642464 CCGTCGCAGGTGAATGGGGTAGG - Intergenic
1162863442 19:13525455-13525477 CTTTGGGAGGTGGAGGGGGGTGG + Intronic
1162932753 19:13965547-13965569 CTGTGGGCGGTGGCGGGGGTCGG + Intronic
1163109657 19:15151893-15151915 CTGGGGTGGGTGCAGGGGGTTGG - Intergenic
1163234878 19:16024408-16024430 CTGTGGAAGGTGGCAGTGGTGGG - Intergenic
1163401943 19:17099362-17099384 CTGCAGAAGGTGATGGGGGGAGG + Intronic
1163500820 19:17675082-17675104 CTTTGGGAGGTCAAGGGGGGAGG + Intronic
1163525758 19:17820412-17820434 CTTTGGAAGGTCAAGGTGGGAGG + Exonic
1163666175 19:18605147-18605169 CAGGCGAAGGTGTAGGGGGTGGG - Intronic
1163742250 19:19022624-19022646 CTGTGGGAGGGTAAGTGGGTGGG + Intronic
1163768033 19:19174191-19174213 CTGTGGACGGAGCAGGGGGCAGG + Intronic
1163870097 19:19814163-19814185 CTGTGGGAGGCCAAGGGGGGTGG + Intronic
1164539838 19:29114251-29114273 CTCTAGAAGGTGATGGGGCTGGG + Intergenic
1164714702 19:30383044-30383066 CTTTGGAAGGTCAAGGTGGGCGG + Intronic
1164853774 19:31504989-31505011 CTTTGGGAGGTGAAGGTGGGCGG - Intergenic
1165007716 19:32820073-32820095 CTATCGAAGGAGAAGAGGGTGGG + Intronic
1165151612 19:33763928-33763950 CTGTGGATGGTGAAAGGAGCTGG + Intronic
1165246809 19:34502661-34502683 CTTTGGAAGGTCAAGGCGGATGG - Exonic
1166065765 19:40358023-40358045 CTCTGAATGGTTAAGGGGGTGGG - Intronic
1166151760 19:40880251-40880273 GTGTGGAGGGAGAAGGGGGTTGG + Intronic
1166178406 19:41090375-41090397 GTGTGGCGGGAGAAGGGGGTTGG - Intronic
1166702327 19:44889240-44889262 CTGTGGGATGTGAAGGGGATGGG + Intergenic
1166703320 19:44894669-44894691 CTTTGGAAGGTCAAGGTGGGAGG - Intronic
1166762301 19:45232550-45232572 CGTTGGACAGTGAAGGGGGTGGG - Intronic
1167201362 19:48067717-48067739 CTGGAGTAGGGGAAGGGGGTGGG - Intronic
1167262643 19:48467677-48467699 CTGGGGAAGGGGAAGGGGAAGGG + Intronic
1167499649 19:49837881-49837903 CTGTGGATGGGGAAGACGGTGGG + Intronic
1167636701 19:50659778-50659800 TTGGGGAGGGTGTAGGGGGTGGG - Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1167793352 19:51693772-51693794 CTGGGGAAGGTGCAGAGGGAGGG + Intergenic
1168253549 19:55154933-55154955 CTGAGGGAGGAGAAGGGGCTGGG + Intronic
1168379076 19:55905113-55905135 CTGTGGAAGGTGCAGGTGCAAGG + Intronic
925260899 2:2527671-2527693 TGGTGGAGGGTGAAGAGGGTCGG - Intergenic
925411031 2:3640431-3640453 CTGTGGGATGTGACAGGGGTGGG - Intronic
925411039 2:3640460-3640482 CTGTGGGATGTGACGGGGGTGGG - Intronic
925411048 2:3640489-3640511 CCGTGGGATGTGACGGGGGTGGG - Intronic
925411058 2:3640518-3640540 CCGTGGGATGTGACGGGGGTGGG - Intronic
925411068 2:3640547-3640569 CCGTGGGATGTGACGGGGGTGGG - Intronic
925411086 2:3640607-3640629 CTGTGGGATGCGACGGGGGTGGG - Intronic
925411095 2:3640636-3640658 CTGTGGGATGTGACGGGGGTGGG - Intronic
925411104 2:3640665-3640687 CCGTGGGATGTGACGGGGGTGGG - Intronic
925411114 2:3640694-3640716 CCGTGGGATGTGACGGGGGTGGG - Intronic
925411124 2:3640723-3640745 CCGTGGGATGTGACGGGGGTGGG - Intronic
925411142 2:3640783-3640805 CTGTGGGATGTGACGGGGGTGGG - Intronic
925411151 2:3640812-3640834 CCGTGGGATGTGACGGGGGTGGG - Intronic
925411161 2:3640841-3640863 CCGTGGGATGTGACGGGGGTGGG - Intronic
925411171 2:3640870-3640892 CCGTGGGATGTGACGGGGGTGGG - Intronic
925411181 2:3640899-3640921 CCGTGGGATGTGACGGGGGTGGG - Intronic
925411191 2:3640928-3640950 CCGTGGGATGTGACGGGGGTGGG - Intronic
925459853 2:4051540-4051562 CTTTGGAAGGTGGAGGTGGAAGG + Intergenic
925911009 2:8573649-8573671 CTGTGCAAGGTGGTGGGGGAAGG + Intergenic
926000758 2:9330406-9330428 CTCAGGAGGGTGAAGGGAGTGGG + Intronic
926429102 2:12767703-12767725 CTGAGGAAGATGGAGGTGGTAGG - Intergenic
927477368 2:23423928-23423950 CTAAGGATGGTGAATGGGGTCGG - Intronic
927754351 2:25697002-25697024 CTTTGGAAGCTGAAGTGGGAGGG - Intergenic
927784811 2:25966347-25966369 CTTTGGAAGGTCAAGGTGGGTGG - Intronic
927839177 2:26427357-26427379 CTTTGGAAGGTGGAGGTGGGTGG - Intronic
927901760 2:26824716-26824738 CTTTGGAAGGTCAAGGCGGGTGG + Intergenic
928098953 2:28423641-28423663 CTGTAGAAAGTGAGGGGGCTGGG - Intergenic
928162598 2:28941836-28941858 CTTTGGGAGGTCAAGGTGGTAGG - Intronic
928392955 2:30923305-30923327 CTTTGGAAGGTCAAGGTGGGTGG - Intronic
928849290 2:35723809-35723831 CTTTGGAAGGCGAAGGAGGGAGG - Intergenic
929128740 2:38545228-38545250 CTTTGGAAGGCCAAGGTGGTTGG - Intergenic
929147866 2:38722296-38722318 CTGTGGAGGGTGTAGGGGGTGGG - Intronic
929906105 2:46048110-46048132 CTATGGAAGGGGCAGGGGGTGGG - Intronic
929918415 2:46155073-46155095 CTGTGGAAGGTGAACAGGACTGG + Intronic
930024860 2:47023867-47023889 CTGGGGATGGTGGAAGGGGTGGG - Intronic
930946144 2:57078371-57078393 CTGTGTAAGGAGAGGGGGGCGGG - Intergenic
931412300 2:62044750-62044772 CTTTGGTAGGTGAAGGGAGAAGG - Intronic
931717566 2:65041218-65041240 CTGTGGGAGGCCAAGGGGGGAGG + Intergenic
932343646 2:70982130-70982152 CTGGGGGAGGGGAAGGGGGTGGG - Intronic
932448250 2:71793831-71793853 TTGTGTCAGGTGGAGGGGGTTGG - Intergenic
932538240 2:72622468-72622490 CTTTGGAAGGTCAAGGAGGGTGG + Intronic
932769784 2:74494176-74494198 CTGTGAAAGGTAAGGGGGTTGGG - Exonic
932912857 2:75822511-75822533 CTTTGGAAGGTGGAGGTGGGTGG - Intergenic
933331441 2:80897274-80897296 CTGTGGTAGGTGAATGGAGTAGG - Intergenic
933650067 2:84843382-84843404 ATGTGAAAGGAGAAAGGGGTTGG - Intronic
933733134 2:85473258-85473280 CTGGGTATGGTGAAGGGGCTGGG - Intergenic
935234380 2:101126116-101126138 TGGTGGAAGGTGAAGGGAGCTGG + Intronic
935277057 2:101484181-101484203 CTAGGGAAGGAGAAGGGGGAAGG - Intergenic
935376232 2:102400373-102400395 TTGTGGTATGTGGAGGGGGTGGG - Intergenic
935455305 2:103260364-103260386 CTTTGGGAGGTGAAGGCAGTTGG - Intergenic
935580219 2:104750147-104750169 CTGTGGAGGTTGAAGGGGGGAGG + Intergenic
936393782 2:112102119-112102141 CTTTAGAAGGTAAAGGAGGTGGG + Intronic
936462592 2:112723737-112723759 CTGGGGAAGATGAAGGAGGTTGG + Exonic
936679635 2:114755400-114755422 CTCTGGAGGGTGAAGCGGGGAGG - Intronic
936929847 2:117777302-117777324 CTTTGGAAGGCCAAGGGGGGTGG + Intergenic
937218440 2:120327449-120327471 CCGGGGGAGGTGAAGGGGTTCGG + Intergenic
937307505 2:120881449-120881471 CTGTGGAAGGTGGACAGGTTGGG + Intronic
937584186 2:123525968-123525990 CTTTGGAAGGTGGAGGTGGGAGG - Intergenic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
938102866 2:128510026-128510048 CTTTGGGAGGTCAAGGCGGTTGG - Intergenic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
938787277 2:134642371-134642393 CTGTGGGAGGTCAAGGCGGGTGG - Intronic
939736916 2:145858506-145858528 CTTTGGAAGGTGGAGGCGGGTGG + Intergenic
940052730 2:149480873-149480895 CTGAGGTAGGTGATGGGGGCTGG - Intergenic
940249546 2:151659542-151659564 CTTTGGAAGGTGAAGGCAGGTGG - Intronic
940525535 2:154808821-154808843 CAGGAGAAGGTGAAGGAGGTGGG + Intronic
940816254 2:158301100-158301122 CTTTGGAAGGTTAAGGTGGGAGG - Intronic
941076391 2:161010602-161010624 CGGTGGGGGGTGAGGGGGGTGGG + Intergenic
941524858 2:166594678-166594700 CTTTGGAAGGCCAAGGGGGATGG + Intergenic
941596011 2:167478271-167478293 AGTTGGAAGGTGAAGTGGGTTGG - Intergenic
941841882 2:170094598-170094620 CTTTGGGAGATGAAGGGGGGAGG + Intergenic
941923735 2:170875706-170875728 CTGAGGAGGGTAAAGGAGGTTGG - Intergenic
944069184 2:195650948-195650970 GTGGGGAAGGCGAAGGAGGTGGG + Intronic
944575884 2:201090666-201090688 CTGTGGGAGGTCAAGGTGGGAGG - Intergenic
944670041 2:201986892-201986914 CTTTGGGAGGTGAAGGCGGGCGG + Intergenic
944722478 2:202438068-202438090 CTTTGGGAGGTGAAGGTGGGCGG + Intronic
944811790 2:203334182-203334204 CTGTGGAAGGCCAAGGCGGGTGG - Intronic
945006862 2:205417741-205417763 CAGTGAAAGGTTAAGGGGGCTGG - Intronic
945125727 2:206507457-206507479 CAGTGGAAGGTGAAGGTGGGAGG - Intronic
945909898 2:215636443-215636465 CTGTGGAAGGTGAAATGAGTGGG - Intergenic
945955012 2:216078387-216078409 CTTTGGGAGGTCAAGGGGGATGG + Intronic
946021923 2:216646226-216646248 CAGTGGAAGGGGAGGGTGGTGGG + Intronic
946320653 2:218952313-218952335 TGGTGGAAGGTGGAGGGGGGCGG + Intergenic
946332873 2:219020151-219020173 CTGGGGAGGGTGAATGGGGAGGG - Intronic
946341312 2:219071161-219071183 CAGGGGATGGTGAAAGGGGTTGG - Intergenic
946418047 2:219550402-219550424 CAGTGGCAGGAGATGGGGGTGGG + Exonic
946758761 2:222972628-222972650 CTGGGGCAGGTGAAGGGGCAGGG + Intergenic
946828292 2:223701559-223701581 CTTTGGGAGGTGGAGGGGGGAGG - Intergenic
946947150 2:224832957-224832979 CTCTGGAAGGTGGGGTGGGTGGG - Intronic
947411813 2:229849365-229849387 GTTTGGTAGGTGAATGGGGTGGG + Intronic
948073192 2:235144090-235144112 CTCTGGAAGGGGATGAGGGTGGG - Intergenic
948155306 2:235776719-235776741 GTGTGCAAGGGGAAGGGGGAGGG - Intronic
948543378 2:238705597-238705619 CTGTGGAAGGCCAAGGTGGGTGG - Intergenic
948633842 2:239321220-239321242 CTTTGGAAGGTGAAGGTGGGCGG + Intronic
948729136 2:239952357-239952379 CTGTGGAAGGTGAAGAGTTCAGG + Intronic
1168760085 20:344627-344649 CTGTAGAAGGCGAAGGGGAAGGG - Intergenic
1169033155 20:2429066-2429088 CTTTGGGAGGTGAAGGCGGGTGG - Intronic
1169132955 20:3176495-3176517 CTTTGGAAGGTGGAGGAGGGTGG - Intergenic
1169217708 20:3803085-3803107 CTGTAGGAGGTCATGGGGGTTGG - Intronic
1169438486 20:5614088-5614110 CTTTGGGAGGTGAAGGAGGGCGG + Intergenic
1170314168 20:15025524-15025546 CTGAGGATGGTGAAAGGAGTAGG - Intronic
1170820097 20:19750232-19750254 CTGTGGGAGGTCAAGGGAGGCGG + Intergenic
1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG + Intergenic
1172049843 20:32109162-32109184 CTGTGAAATGGGAAGGGGGTTGG - Intergenic
1172132072 20:32662353-32662375 CTTTGGGAGGTCAAGGGGGCAGG + Intergenic
1172292549 20:33786723-33786745 CTTTGGAAGGTGAAGGTGGGTGG + Intronic
1172536253 20:35675631-35675653 CTGTGGGAGGTCAAGGCGGGCGG + Intronic
1172638211 20:36424160-36424182 CTGTGACAGGTGAAGGGGACAGG + Intronic
1173375228 20:42476985-42477007 TGGTGGAAGGAGAAGGGGGAAGG - Intronic
1173509669 20:43616775-43616797 CTTTGGGAGGTTAAGGAGGTAGG + Intronic
1173577617 20:44123271-44123293 CTGTGGATGTGGAAGGAGGTGGG - Intronic
1173734080 20:45347529-45347551 TTGAGTGAGGTGAAGGGGGTAGG - Intronic
1173738543 20:45378986-45379008 CTGTGGGAGGTGGAGGTGGGCGG - Intronic
1173984711 20:47252048-47252070 CTGTGGAAGGCCAAGGCGGGAGG + Intronic
1174454893 20:50642004-50642026 CTGCGGAAGCAGAAGGGGGTGGG - Intronic
1174471909 20:50767726-50767748 CTGCGGAAGCAGAAGGGGGTGGG + Intergenic
1174515088 20:51085860-51085882 CACTGGAAGCTGTAGGGGGTAGG - Intergenic
1174518809 20:51114025-51114047 CTTTGGAAGGTCAAGGTGGGAGG - Intergenic
1174883327 20:54304490-54304512 CTTTGGAAGGTGGAGGTGGGTGG - Intergenic
1175102686 20:56590945-56590967 CTTTGGGAGGCCAAGGGGGTTGG - Intergenic
1175297287 20:57917553-57917575 CTTTGGAAGGTGATTGGGGTTGG - Intergenic
1175989242 20:62779298-62779320 CTGTGGGGGCTGCAGGGGGTGGG - Intergenic
1176038854 20:63053718-63053740 CTGTGGAAGATGAAGAGGGCAGG - Intergenic
1176201150 20:63861149-63861171 CTGTGGGAGGTGGAGGCGGGAGG + Intergenic
1176389183 21:6154907-6154929 CTGGGGAGGGGGAAGGGGGCAGG - Intergenic
1176613796 21:9011034-9011056 CTGTGGAAGGGGAGGTGGGAAGG + Intergenic
1176843890 21:13861812-13861834 CGGTGGAAGGTAAAAGGGATGGG - Intergenic
1177207380 21:18025793-18025815 CCGTGGAAGATGAAGGGAGAAGG - Intronic
1177862699 21:26473563-26473585 CTGAGCACAGTGAAGGGGGTGGG - Intronic
1179300241 21:40101773-40101795 CTGTGGGAGGTGGTGGGGGGGGG + Intronic
1179409874 21:41154220-41154242 CTGTGGCAGGTGAGGGAGGATGG + Intergenic
1179524683 21:41967977-41967999 CTGTGGAGGGTCAGGGGGGCAGG - Intergenic
1179625811 21:42649155-42649177 CTGGGGGTGGTGCAGGGGGTTGG - Intergenic
1179734289 21:43383341-43383363 CTGGGGAGGGGGAAGGGGGCAGG + Intergenic
1179904944 21:44418021-44418043 CTGAGGAGGATGAAGGGGGGCGG - Exonic
1180038402 21:45263112-45263134 CTTTGGGAGGTCAAGGCGGTTGG - Intergenic
1180620794 22:17160267-17160289 CTTTGGAAGGTCAAGGTGGGAGG + Intronic
1180897636 22:19348736-19348758 CTTTGGGAGGCCAAGGGGGTCGG - Intronic
1181043501 22:20203960-20203982 CTGTGGAATGGGAAGTGGGGAGG + Intergenic
1181348792 22:22240602-22240624 CTGTGGGAGGTCAAGGCGGGAGG + Intergenic
1181502788 22:23327751-23327773 CTTTGGAAGGTGAAGAGGAGAGG + Intergenic
1181653582 22:24276131-24276153 CTTTGGAAGGTGAAGAGGAGAGG + Intronic
1181811020 22:25404168-25404190 GTGTGGATGGTGCAGGGGGGTGG - Intronic
1182733766 22:32516039-32516061 CTTTGGGAGGTGGAGGGGGGCGG - Intronic
1182772293 22:32804287-32804309 CTGTGCAAGGCGAGGGAGGTCGG - Intronic
1183107136 22:35622715-35622737 CTGGGGAGGGTGGAGGGGGGAGG - Intronic
1183166070 22:36148337-36148359 CAGTGGCAGGTAAAGGGGATGGG + Intronic
1183446206 22:37857116-37857138 CTTTGGGAGGTGAAGGTGGACGG + Intronic
1183783066 22:40011080-40011102 CTGTGGAAGGAGAAAGGAGTGGG - Intronic
1183804956 22:40200876-40200898 CAGTGGAATGTGATGGTGGTGGG + Intronic
1184321235 22:43743734-43743756 CTGTGGAGGGTGAGGGGTGAAGG - Intronic
1184376584 22:44117328-44117350 CTGTAGAGGGTGAAGGAGGAGGG + Intronic
1184412915 22:44336297-44336319 CAGTGGCAGGTGAAGGGCGGAGG - Intergenic
1184685948 22:46096419-46096441 CTGTGGGATGGGAAGAGGGTCGG + Intronic
1185149156 22:49154256-49154278 CTGGGGAGGGTGAAGAGGGTGGG + Intergenic
1185183550 22:49378554-49378576 CTGTGTCAGGTGTAGGGTGTGGG + Intergenic
1185191376 22:49438623-49438645 CAGTGGAGGGAGGAGGGGGTTGG + Intronic
1185198878 22:49490253-49490275 CTGTGGAAAGGAAAGGGGATTGG + Intronic
1185320271 22:50197491-50197513 CTCTTGAAGGTGACGGGGATGGG - Exonic
1185323713 22:50215527-50215549 CTGTGCCAGGTGGAGGGTGTGGG + Intronic
1185336821 22:50274680-50274702 CTGGGGGAGGTGGAGGGGGCTGG - Intergenic
1185336881 22:50274806-50274828 CTGGGGGAGGTGGAGGGGGCTGG - Intergenic
949571113 3:5294111-5294133 CTTTGGGAGGTGAAGGTGGGTGG + Intergenic
949775693 3:7630189-7630211 CTGGGGATGGTGATGGTGGTGGG + Intronic
950186308 3:10947795-10947817 ATGGGGAAGGTGAAGGAGGGCGG + Intergenic
950652932 3:14418929-14418951 CGGGGGAAGGGGAAGGGGCTGGG - Intronic
950848819 3:16042770-16042792 CTTTGGAAGGTCAAGGTGGGTGG - Intergenic
951355947 3:21666832-21666854 CTTTGGAAGGTCAAGGCGGATGG + Intronic
951875921 3:27425431-27425453 CTTTGGAAGGTCAAGGCGGACGG + Intronic
952331238 3:32366230-32366252 ATGGGGAAGGGGAAGAGGGTTGG - Intronic
952385703 3:32840222-32840244 CTTTGGAAGGGAAGGGGGGTGGG - Intronic
952529079 3:34244545-34244567 CTGTGGAAGGCGAGGGTTGTGGG - Intergenic
952687350 3:36164901-36164923 CTTTGGAAGGTGAAGGTGGGTGG + Intergenic
952789230 3:37186086-37186108 CTTTGGAAGGTCGAGGGGGGAGG - Intergenic
953512062 3:43552309-43552331 CTTTGGAAGGCCAAGGTGGTAGG + Intronic
953837233 3:46357253-46357275 CTGGGGAAGATAAAGGGTGTCGG + Intronic
953974499 3:47371811-47371833 CTGTGGCAGGAGAAGTGGGGAGG - Intergenic
954524381 3:51256836-51256858 CTTTGGAAGGTGGAGGTGGGTGG - Intronic
954929227 3:54266462-54266484 CTGTGGAAAGAGAAAGGTGTTGG + Intronic
955119207 3:56038927-56038949 CTGTGGTAGGTGGTGGGGGTTGG + Intronic
955403870 3:58613056-58613078 CTCTGGAAGGTGATGATGGTCGG + Intronic
955741323 3:62094247-62094269 CTTTGGAAGAAAAAGGGGGTAGG - Intronic
956002233 3:64741696-64741718 CTTTGGAAGGTCAAGGTGGGAGG - Intergenic
956121978 3:65975510-65975532 CTTTGGAAGGTGGAGGTGGGCGG + Intronic
956758620 3:72416267-72416289 CTTTGGAAGGTCAAGGAGGGAGG + Intronic
956817819 3:72924445-72924467 CTGTGGGAGGTCAAGGTGGGAGG - Intronic
957333209 3:78792854-78792876 CTTTGGAAGGCGAAGGTGGGAGG + Intronic
957564280 3:81865073-81865095 GTGAGGAAGGGGAAGGGGGAGGG - Intergenic
957606671 3:82408075-82408097 CAGTAGAATGTGAAAGGGGTTGG + Intergenic
957834798 3:85573432-85573454 CTTTGGGAGGTCAAGGCGGTGGG - Intronic
957842463 3:85689242-85689264 CTGTGGATGGAGGTGGGGGTAGG + Intronic
958105496 3:89067220-89067242 CAGTGGAAGTTAAAGAGGGTGGG + Intergenic
958744204 3:98113465-98113487 CTTGGGAAGGTGGAGGGGGGTGG - Intergenic
958800114 3:98745275-98745297 CTTTGGGAGGTCAAGGGGGGTGG - Intronic
959216514 3:103456830-103456852 GTGTGGATGGTGGTGGGGGTGGG - Intergenic
960682432 3:120263210-120263232 GTGTGGAAGGTGAGCAGGGTGGG + Intronic
961448097 3:126990512-126990534 GGGTGGAAAGTGAAGGGGCTGGG + Intronic
961763543 3:129189874-129189896 CTTTGGAAGGTGGAGGAGGATGG - Intergenic
961915890 3:130374695-130374717 CTTTGGAAGGCCAAGGTGGTAGG - Intronic
962254507 3:133861113-133861135 CTGCAGAAGGGGAAGGGGGCTGG + Intronic
962771088 3:138610824-138610846 CTTTGGGAGGTCAAGGCGGTCGG - Exonic
962880658 3:139573528-139573550 CTGTGAGAACTGAAGGGGGTAGG - Intronic
962943840 3:140149698-140149720 CTTTGGAAGGTCAAGGTGGGTGG - Intronic
963498210 3:146095897-146095919 CTGTGGAGGGAGAGGGGGGAGGG - Intronic
963856137 3:150255760-150255782 TTGAGGCTGGTGAAGGGGGTGGG + Intergenic
964412048 3:156408031-156408053 TTGTGGAAGGTGACGGGGGAGGG + Intronic
964541331 3:157783018-157783040 CTGTGCAGAGTGGAGGGGGTGGG - Intergenic
964708483 3:159646551-159646573 CTGTGAAAGGTTAAGGGGAGAGG - Intronic
964790000 3:160445169-160445191 CTGTGGAAGGCCAAGGTGGGAGG + Intronic
965005755 3:163020074-163020096 CTTTGGAAGGTGGAGGCGGGTGG - Intergenic
965266662 3:166552296-166552318 CTTTGGAAGGTGGAGGTGGGCGG + Intergenic
965466944 3:169041403-169041425 CTGTGGAAGGCCAAGGCGGGTGG - Intergenic
966002018 3:174961225-174961247 CTTTGGAAGGTCAAGGTGGGAGG - Intronic
966413438 3:179666136-179666158 CTGTGGGATGTGAAAGAGGTTGG + Intronic
966892869 3:184419760-184419782 CTTTGGGAGGTGAAGGTGGGAGG + Intronic
966943574 3:184761921-184761943 CTGTGGAAGGAAAACGGGATGGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968460382 4:721756-721778 CTGTGGGAGGTGGATGGGTTGGG + Intronic
968460438 4:721961-721983 CTGTGGGAGGTGGATGGGTTGGG + Intronic
968472729 4:789495-789517 CTGTGGGAGCTGCGGGGGGTAGG + Intronic
968562972 4:1294783-1294805 CAGTGGCAGGGGACGGGGGTGGG + Intronic
968878294 4:3285748-3285770 CTCTGGAAGGGGACTGGGGTGGG - Intergenic
968884275 4:3318882-3318904 TTGTGACAGGTGATGGGGGTGGG + Intronic
968967290 4:3775580-3775602 CTGTGGGAGGTCAGGGGGGTGGG - Intergenic
969148092 4:5141811-5141833 CTGAGGAAGGTGGAGGGGGTGGG - Intronic
969232224 4:5839757-5839779 CTGTGGAGGGAGAACGGGGCTGG + Intronic
969482996 4:7456765-7456787 CTGTGGCAGGGGTAGGGGGGTGG + Intronic
969707442 4:8819594-8819616 CAGGGGAAGGGGAAGGGAGTAGG + Intergenic
970043447 4:11822728-11822750 GTGTGCAAGGTGGAGGTGGTTGG + Intergenic
970647793 4:18142658-18142680 CTGGGGAAGTTGAAGTGGGTGGG - Intergenic
971572578 4:28231947-28231969 CTTTGGAAGGTCAAGGCGGGTGG + Intergenic
971643296 4:29163016-29163038 CTGTGGAAAGTGGGGGGGGGGGG + Intergenic
971662114 4:29432286-29432308 TGGTGGAAGGTGAAGCAGGTGGG - Intergenic
971767575 4:30853070-30853092 CTTTGGAATGTGAGGGGGATGGG + Intronic
972422838 4:38905792-38905814 CTGATGAAGGGGAAGTGGGTGGG - Exonic
972476126 4:39451555-39451577 CTGTTGAATGTGAATGGGTTTGG + Intergenic
972492187 4:39598363-39598385 CTCTGGAGGGAGAAGTGGGTAGG - Intronic
972667789 4:41183822-41183844 CTGGGGGAGTTGCAGGGGGTGGG + Intronic
972731769 4:41801791-41801813 CTTTGGAAGGTCAAGGAGGTTGG - Intergenic
972741277 4:41889006-41889028 GTGTGGAAAGGGAAAGGGGTTGG - Intergenic
972836747 4:42880292-42880314 CTGTGGAACGTGAGGGGGCATGG - Intergenic
972896267 4:43624806-43624828 TGGGGGAAGGGGAAGGGGGTTGG - Intergenic
972908935 4:43789089-43789111 CTTTGGGAGGTCAAGGGGGGCGG - Intergenic
974096909 4:57373865-57373887 CAGGGCAAGGTGTAGGGGGTAGG + Intergenic
974531087 4:63108764-63108786 CTTTGGAAGGTCAAGGCGGGTGG + Intergenic
975149495 4:71005226-71005248 ACCTGGAAGGTGAAAGGGGTGGG - Intronic
975194825 4:71511764-71511786 CTGGGAAGGGTGATGGGGGTAGG - Intronic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
976302405 4:83527797-83527819 CTTTGGAAGGTCAAGGTGGGCGG - Intergenic
976401832 4:84615578-84615600 CTGTGGCAGGGGGAGGGGGTGGG - Intronic
976579766 4:86721988-86722010 CTTTGGGAGGTGAAGGCGGTTGG - Intronic
978441231 4:108736167-108736189 CTTTGGAAGGCGAAGGGGAGAGG - Intergenic
978847545 4:113292111-113292133 CTTAAGAAGGTGAAGGGGGTGGG - Intronic
978990444 4:115075541-115075563 CTTTGGAAGGTCAAGGCGGGTGG + Intronic
979563314 4:122124596-122124618 GTATGGAGGGTGGAGGGGGTTGG - Intergenic
980186223 4:129464293-129464315 CTTTGGGAGGTGAAGGTGGGAGG - Intergenic
981089897 4:140721628-140721650 CTGTGGAATCTGAAGTAGGTAGG - Intronic
981099335 4:140813086-140813108 CTTTGGGAGGCCAAGGGGGTAGG - Intergenic
981295430 4:143125856-143125878 CTCTGGAAGGTGGAGGAGGAAGG - Intergenic
982102460 4:151981316-151981338 CTTTGGAAGGTGGAGGCGGGCGG - Intergenic
982244283 4:153334469-153334491 CTTTGGTAGGTGAAGGTGGGAGG - Intronic
982329542 4:154165739-154165761 CTTTGGAAGGTGGAGGTGGGTGG + Intergenic
982516648 4:156359601-156359623 CTTTGGAAGGCGAAGGTGGGTGG - Intergenic
982537740 4:156627714-156627736 CTTTGGAAGGTCAAGGTGGGAGG + Intergenic
983112731 4:163772916-163772938 ATATGGAAGGAGAAGGAGGTGGG + Intronic
983363096 4:166752121-166752143 CTGAGGCAGGAGAAGGAGGTTGG - Intronic
983552153 4:169028589-169028611 CTTTGGGAGGTGGAGGGGGGCGG + Intergenic
983864894 4:172754325-172754347 CTTTGGAAGGCCAAGGTGGTTGG + Intronic
984447233 4:179852130-179852152 CTGTGGGAGATGAAAGTGGTGGG - Intergenic
985116250 4:186594302-186594324 CTTTGGGAGGTGAAGGCGGGCGG - Intronic
985126080 4:186696032-186696054 CTTTGGGAGGTGAAGGCGGGCGG - Intronic
985218518 4:187678009-187678031 CTGGGGAAGGTCAAGGCCGTAGG - Intergenic
985282734 4:188303008-188303030 CTTTGGAAGGCCAAGGTGGTTGG - Intergenic
985511848 5:317941-317963 AGGTGGAGGGTGAAGGGGGGAGG - Intronic
986108970 5:4692416-4692438 TGGTGGAAGGTGAATGGGGTTGG + Intergenic
986291997 5:6407589-6407611 CTCTGGAAGGAGAAGAGGGAAGG - Intergenic
986504396 5:8433630-8433652 CTATGGAAGGGGAAGGATGTGGG - Intergenic
986521861 5:8627816-8627838 CTGTGGGAGGTCAAGGTGGGTGG + Intergenic
987068140 5:14309365-14309387 CTGTGCCAGGTTAAGGGAGTGGG - Intronic
987113355 5:14707647-14707669 CCTTGGGAGGTGCAGGGGGTGGG - Exonic
987427273 5:17787402-17787424 CTGTGAAGGGTGAAGGGTGAGGG - Intergenic
988027670 5:25719686-25719708 CTTTGGGAGGCCAAGGGGGTTGG + Intergenic
988037230 5:25842856-25842878 CTTTGGAAGGTAAAGGTGGGAGG - Intergenic
988394261 5:30677614-30677636 CTGAGGAGGCTGAAGGGGGGAGG - Intergenic
988773417 5:34453854-34453876 CTTTGGAAGGCCAAGGTGGTTGG + Intergenic
988980654 5:36564779-36564801 CTTTGGAAGGTGGAGGTGGGTGG + Intergenic
989163325 5:38412041-38412063 CTTTGGAAGGCGAAGGCGGGCGG - Intronic
989180911 5:38575992-38576014 CAGAGGAAGGTGATGGGGGAAGG + Intronic
990424986 5:55678378-55678400 CTTTGGGAGGTGAAGGCGGGTGG - Intronic
990429425 5:55719608-55719630 CTGGGGAAGCTGAAGTGGGGGGG - Intronic
990469819 5:56105035-56105057 TTGTGGAAAGTGAAGTGTGTAGG + Intronic
990601076 5:57359199-57359221 CTTTGGGAGGTCAAGGTGGTAGG + Intergenic
990884882 5:60580033-60580055 CTTTGGGAGGAGAAGAGGGTAGG - Intergenic
991024919 5:62019098-62019120 CTGTGGAAGGTGCCTGGGCTTGG + Intergenic
991212406 5:64120870-64120892 CTGAGTAAGGTGAAGAGGGAAGG + Intergenic
991423593 5:66466781-66466803 CTTTGGAAGGTCAAGGTGGGCGG - Intergenic
991439160 5:66628275-66628297 CTTTGGAAGGTCAAGGCGGGAGG - Intronic
991773827 5:70064818-70064840 CTTTGGAAGGTCAAGGCGGAGGG - Intronic
991853121 5:70940242-70940264 CTTTGGAAGGTCAAGGCGGAGGG - Intronic
992117775 5:73558220-73558242 CTGTGGGAGGTCAAGGTGGGAGG - Intronic
992157688 5:73971096-73971118 CTCTGCAAGGGGCAGGGGGTGGG + Intergenic
992233242 5:74684060-74684082 CTTTGGAAGGCGAAGGAGGGCGG - Intronic
992389026 5:76313420-76313442 AAGTAGAGGGTGAAGGGGGTGGG + Intronic
992485863 5:77194600-77194622 CTGGGGAATGTAAAGGGGCTGGG - Intergenic
992968339 5:82027153-82027175 CTGTGGGAGGTCAAGGTGGGAGG + Intronic
993061753 5:83047054-83047076 CTTTGGAAGGCCAAGGGGGATGG - Intergenic
993114169 5:83699950-83699972 CTGTGGGAGGCCAAGGTGGTTGG + Intronic
993234123 5:85280685-85280707 CTTTGGGAGGCCAAGGGGGTTGG + Intergenic
994843472 5:104954918-104954940 CTTTGGAAGGCCAAGGCGGTAGG - Intergenic
995819469 5:116212520-116212542 GTGTAGAATGTGAGGGGGGTTGG + Intronic
996238136 5:121159390-121159412 CTGTTTAATGTGAAGAGGGTGGG - Intergenic
996371010 5:122752381-122752403 CTTTGGGAGGTCAAGGGGGTGGG + Intergenic
996416326 5:123214566-123214588 CTGTGGGAGGTGAAGGAGAGGGG - Intergenic
996464478 5:123783416-123783438 CTTGGGAAGGTGAAAGGGGAGGG + Intergenic
997264115 5:132485153-132485175 CTTTGGAAGGCGAAGGTGGGTGG - Intronic
997539585 5:134650645-134650667 CTTTGGAAGGTTAAGGAGGCAGG - Intronic
998188394 5:140000751-140000773 CTCTGGAAGCTGAAGGCAGTGGG + Intronic
998210749 5:140195672-140195694 CTTTGGAAGGCCAAGGGGGGCGG - Intronic
998278365 5:140780793-140780815 CTTTGGGAGGTGAAGGTGGGAGG - Intergenic
998458552 5:142292562-142292584 CTTTGGAAGGTCAAGGTGGGCGG + Intergenic
999277304 5:150339721-150339743 CTTTGGAAGGCCAAGGGGGGTGG + Intergenic
999290686 5:150423754-150423776 CTTTGGGAGGTCAAGGTGGTAGG - Intergenic
999321534 5:150618419-150618441 ATCTGGAAGGCGCAGGGGGTAGG - Exonic
999655086 5:153803455-153803477 TTGTGGAAGGTGAAAGGTGCTGG - Intronic
999759239 5:154687724-154687746 CTTTGGAAGGCGAAGGTGGCAGG + Intergenic
999764209 5:154726081-154726103 CTGTGGAAGGCCAAGGTGGGCGG - Intronic
999776050 5:154814006-154814028 CGGTGGGTGGTGTAGGGGGTTGG - Exonic
1000260824 5:159586970-159586992 CTGGGGCAGGTGACTGGGGTTGG - Intergenic
1000379302 5:160614669-160614691 CTGAGGAGGGAGAATGGGGTTGG - Intronic
1000440912 5:161261947-161261969 CTGTGGAAGGTGCAGGAGTGTGG + Intergenic
1001070860 5:168583741-168583763 CTTTGGGAGGTGAAGGTGGGAGG - Intergenic
1001084697 5:168692115-168692137 CTGTTGCAGGGGAAGGGGGCAGG - Intronic
1001294990 5:170492989-170493011 CTTTGGGAGGTCAAGGTGGTTGG - Intronic
1001543977 5:172558703-172558725 GTGTGGAAGGGGAACTGGGTGGG - Intergenic
1002703559 5:181144571-181144593 CTGCAGAAGGCAAAGGGGGTAGG - Intergenic
1003202330 6:3973328-3973350 CTGTGGGAGGTGGAGGCGGGTGG + Intergenic
1003353151 6:5339676-5339698 CTGTGGCAGGTCAAGGTGGGTGG - Intronic
1003382119 6:5634565-5634587 CTTTGGGAGGTGAAGGTGGGAGG - Intronic
1003596056 6:7475246-7475268 CTTTGGGAGGTGGAGGGGGATGG - Intergenic
1003602008 6:7526293-7526315 CTTTGGAAGGTCAAGGTGGGCGG + Intergenic
1003801078 6:9668152-9668174 CTCTGGAAGGTGAAGCTGGCTGG + Intronic
1003882514 6:10491320-10491342 TTGTGGAAGGTCAAGGTGGCTGG + Intergenic
1004455531 6:15788315-15788337 CTGTGGACAGTGACGGGGGCTGG - Intergenic
1005098274 6:22142242-22142264 CTGTGGAAGGCCAAGGTGGGTGG - Intergenic
1005195358 6:23276881-23276903 CTTTGGGAGGTGAAGGTGGGTGG + Intergenic
1005399240 6:25414760-25414782 ATGTGGAAGGGGATGGGGGTTGG - Intronic
1005429151 6:25736096-25736118 CTGTTGAAAGAGAAGGTGGTGGG + Intergenic
1005934476 6:30509764-30509786 CTGGGGAGGCTGAAGTGGGTGGG - Intergenic
1005960422 6:30689453-30689475 CTGTGGAAGGATAAGGGGCTGGG + Intronic
1006333927 6:33410879-33410901 CTGTTGGAGGTGAGGGAGGTGGG + Intronic
1006356303 6:33560461-33560483 CTTTGGAAGGCCAAGGGGGGTGG + Intergenic
1006648612 6:35532924-35532946 CTTTGGAAGGTGGAGGTGGGAGG - Intergenic
1006706165 6:36023303-36023325 CTTTGGAAGGCCAAGGCGGTTGG + Intronic
1006713100 6:36092855-36092877 CTGTGGAAGGTGCTGGGGACAGG + Intronic
1007071506 6:39041556-39041578 TTGAGTAAGGTGAAGGGAGTAGG + Intergenic
1007241741 6:40431651-40431673 CTGGGGAAGGAGGAGGGGATGGG - Intronic
1007359363 6:41344030-41344052 CAGTGTGAGGTGAAGGGGCTTGG - Intronic
1007627358 6:43253992-43254014 CCTAGGAAGGTGAAGGGGCTGGG + Intronic
1007778755 6:44238958-44238980 CAGTGGAAAGTGCAGGGGGCAGG - Intergenic
1007940517 6:45776416-45776438 GTGGGGAAGGTGAGGAGGGTTGG - Intergenic
1007966537 6:46008549-46008571 CTGTGAAAGCTGAAGGGGGCTGG - Intronic
1008025085 6:46627070-46627092 CGGTGGCAGAAGAAGGGGGTGGG + Intronic
1008052371 6:46913252-46913274 CTTTGGAAGGCCAAGGGGGGCGG + Intronic
1008121130 6:47618073-47618095 CTTTGGAAGGTCAAGGTGGGTGG + Intronic
1008292612 6:49736329-49736351 CTGTGGAAGGAGTAGGCGGCTGG - Intronic
1009375539 6:62963966-62963988 CTTTGGGAGGTGAAGGCGGGTGG + Intergenic
1009437649 6:63636195-63636217 GTGTGGAAGGGGATGGGGGAGGG - Intronic
1009583800 6:65569977-65569999 ATGTGGAAGGACAAGGGAGTTGG + Intronic
1009644293 6:66377814-66377836 CTGTGGCAGGTGGGGAGGGTGGG + Intergenic
1009960088 6:70509188-70509210 CTGTGGAAGGTGGAGGTGGGAGG + Intronic
1010167151 6:72929354-72929376 CTGTGGGAGGTTTAGGGAGTGGG - Intronic
1010221808 6:73454469-73454491 CTTTGGAAGGCGAAGGTGGGTGG + Intergenic
1010586499 6:77662775-77662797 TTGTAGAAGGTGATGGGGTTTGG + Intergenic
1011385382 6:86791862-86791884 CTGGTGATGGTGATGGGGGTAGG - Intergenic
1011677666 6:89750844-89750866 CTGTGGGAGGCCAAGGCGGTCGG - Intronic
1011688268 6:89841763-89841785 CTCTGGGAGGTCAAGGTGGTAGG - Intronic
1012896537 6:104955939-104955961 GTTTGAAAGGTAAAGGGGGTAGG + Intergenic
1012916248 6:105174280-105174302 CTTTGGAAGGTCAAGGCGGGCGG - Intronic
1012974681 6:105767790-105767812 CTGTGAAAGAGGAAGGTGGTTGG - Intergenic
1013067122 6:106694683-106694705 CTGAGGTAGGTGAAGGGGTAAGG - Intergenic
1013104367 6:107014167-107014189 CTGTGAGGGGTGAAGTGGGTTGG - Intergenic
1013182881 6:107732749-107732771 CTGGGGGAGGCGAAGTGGGTGGG + Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013428516 6:110035758-110035780 CTGTGGGAGGTCAAGGTGGAAGG + Intergenic
1013521444 6:110937446-110937468 CTTTGGAAGGTCAAGGGAGGAGG + Intergenic
1014427718 6:121329403-121329425 CTTTGGAAGGCCAAGGTGGTGGG + Intronic
1014894767 6:126888589-126888611 AAGTGGAAGGTCAAGTGGGTAGG - Intergenic
1015019901 6:128460298-128460320 CTTTGGAAGGTCAAGGTGGGAGG + Intronic
1015502500 6:133948855-133948877 ATGTTAAAGGTGTAGGGGGTGGG + Intergenic
1015923744 6:138290030-138290052 CTGTGGCAGGTGGAGAGGGGTGG + Intronic
1016287697 6:142491434-142491456 CTTTGGTAGGTGAAGGCGGGCGG - Intergenic
1017098538 6:150826880-150826902 CTTTGGGAGGTGAAGGTGGGAGG - Intronic
1018362806 6:163088518-163088540 CAGTGGGAAGTGCAGGGGGTCGG - Intronic
1018905778 6:168075175-168075197 CTGCTGGAGGTCAAGGGGGTGGG - Intronic
1019175867 6:170159287-170159309 CAGTGGCAGGTGAAGGGGCTGGG - Intergenic
1019576381 7:1739631-1739653 GTGGGGAAGGTGAAGGAGGCTGG + Intronic
1019843088 7:3468900-3468922 CTTCAGAGGGTGAAGGGGGTAGG + Intronic
1020283556 7:6663819-6663841 AGGTGGGAGGTGAAGGGGGAGGG + Intergenic
1020363994 7:7360385-7360407 CTGTGGATGGGGCAGAGGGTAGG - Exonic
1020378439 7:7514760-7514782 CTGTGGAAGGAGTTGGAGGTGGG - Intronic
1020669093 7:11083701-11083723 CTTTGGGAGGCCAAGGGGGTGGG - Intronic
1020765626 7:12316556-12316578 CTGGGGAAGGTAATGGGGGTGGG + Intergenic
1020807382 7:12807511-12807533 CTGTGGGAGGTGGAGGTGGGAGG - Intergenic
1021522650 7:21552854-21552876 CTGAGGAGGGTGTAGGGGTTAGG + Intronic
1022098354 7:27154733-27154755 CTGGAGTAGGTGATGGGGGTGGG + Exonic
1023758729 7:43444467-43444489 CTGTGGGACCTGAAGGGGCTGGG + Exonic
1024324277 7:48096515-48096537 CTGGGGAAGGGGAAGTGGGAGGG - Intronic
1024376668 7:48646760-48646782 CTTTGGGAGGTGGAGGGGGGCGG - Exonic
1025173170 7:56779963-56779985 CTTTGGGAGGTGAAGGTGGGAGG + Intergenic
1025298470 7:57796259-57796281 CTTTGGAAGGTCAAGGCGGTTGG + Intergenic
1026466812 7:70661425-70661447 CTGTGGCAGGTGACCAGGGTGGG + Intronic
1026501759 7:70948684-70948706 TGGTGGAAGGTGAAGGGGGCCGG - Intergenic
1026729014 7:72895069-72895091 CTTTGGAAGGTGGAGGTGGGAGG - Intronic
1027129252 7:75579533-75579555 CTTTGGAAGGCCAAGGGGGGCGG - Intronic
1027131805 7:75596627-75596649 CTTTGGAAGGTGGAGGCGGATGG - Intronic
1027195243 7:76025544-76025566 CTTTGGAAGGTCAAGGCGGGTGG + Intronic
1027332219 7:77109425-77109447 CTTTGGGAGGCCAAGGGGGTGGG + Intergenic
1027335981 7:77151207-77151229 CTGTGGAAGGCCATGTGGGTGGG - Intronic
1027505846 7:79016514-79016536 CTGTGGTAGGAGAAGGGCATAGG - Intronic
1027941789 7:84691518-84691540 TGGTGGAAGGTGAAGGGGAGCGG - Intergenic
1028492035 7:91423368-91423390 CTGTGGAAGATGAAGAGAGGGGG - Intergenic
1029225623 7:99026212-99026234 CTGTGGAAGGTGGAGGTGGGTGG + Intergenic
1029240338 7:99156766-99156788 CTGTGGGAGGCCAAGGGGGGTGG - Intergenic
1029293739 7:99522728-99522750 CTTTGGAAGGTCGAGGTGGTTGG - Intronic
1029714373 7:102317935-102317957 CTGTGCAGGGTCTAGGGGGTGGG + Intronic
1029779807 7:102719889-102719911 CTGTGGAAGGCCATGTGGGTGGG + Intergenic
1029783559 7:102761904-102761926 CTTTGGGAGGCCAAGGGGGTGGG - Intronic
1029851805 7:103469381-103469403 CTGGGGATGGGGATGGGGGTGGG - Intergenic
1030076511 7:105741542-105741564 GTGTGGAAGGTGAGTGGGATGGG + Intronic
1030640715 7:112003135-112003157 CTCTGGAAGGTCAAGGTGGAAGG + Intronic
1030644778 7:112047932-112047954 CTTTGGGAGGTGAAGGTGGGAGG - Intronic
1030755677 7:113285208-113285230 CTTTGGAAGGTCAAGGTGGGAGG + Intergenic
1031217517 7:118914633-118914655 CTGGGAAGGGTGAGGGGGGTGGG + Intergenic
1031894652 7:127335294-127335316 CTGGGGAAGGAATAGGGGGTGGG + Intergenic
1031999929 7:128258195-128258217 CTTTGGAAGGTCAAGGTGGGTGG + Intergenic
1032059548 7:128713059-128713081 CTTTGGGAGGTCAAGGCGGTTGG + Intronic
1032400169 7:131619270-131619292 CTGAGGGAGGTGAAGGAGGATGG - Intergenic
1032676279 7:134132743-134132765 CTGAGGAAAGAGAAGGGTGTGGG + Intronic
1032805617 7:135351086-135351108 CTTTGGGAGGCCAAGGGGGTTGG + Intergenic
1032938419 7:136760858-136760880 CAGTGGAAGGTGAAGGGGAGTGG - Intergenic
1033184184 7:139210862-139210884 TGGTGGAAGGTGAAGGAGGAAGG + Intergenic
1033543237 7:142376295-142376317 CAGTGGAGGGTGAAGAGGCTGGG + Intergenic
1033544974 7:142391602-142391624 CAGTGGAGGGTGAAGGGGCTGGG + Intergenic
1033550752 7:142445431-142445453 CAGTGGATGGTGAAGGGGCTGGG + Intergenic
1033589515 7:142797630-142797652 CTGGGGAAGAGGGAGGGGGTGGG + Intergenic
1033601351 7:142891276-142891298 GGGTGGGAGGTGTAGGGGGTAGG - Intergenic
1033975228 7:147092920-147092942 CTGTGGAAGGAAAAGGGGTATGG + Intronic
1034173996 7:149086329-149086351 TGATGGAAGGTGAAGGGGGCTGG + Intronic
1035046845 7:155973471-155973493 CTGTGGAAGGTGGAGCTGGGAGG + Intergenic
1035473721 7:159128136-159128158 CTGAGGGATGTGACGGGGGTGGG + Intronic
1035567739 8:652539-652561 CTTTGGAAAGTGAATGAGGTGGG - Intronic
1035634484 8:1133993-1134015 CTGTGGGAGGTGGAGGGGGGAGG - Intergenic
1035761455 8:2071934-2071956 CTTTGGGAGGTGATGAGGGTGGG - Intronic
1036463493 8:8974735-8974757 TTGGGGAGGGTGAAGGGGGAGGG - Intergenic
1036760108 8:11502858-11502880 CGGTGGCAGGGGAAGGGGGGTGG + Intronic
1036854651 8:12231461-12231483 CTGTGGAGGTTGAAGTGGGAGGG + Intergenic
1037334300 8:17777191-17777213 CTTTGGGAGGTCAAGGTGGTTGG + Intronic
1037446440 8:18970709-18970731 CTTTGGGAGGTGAAGGTGGGAGG + Intronic
1037512188 8:19594793-19594815 CTGTGGAAGGCCAAGGTGGGTGG - Intronic
1037884769 8:22590134-22590156 CTGTGGAAGGTGGAGGCTGGCGG + Intronic
1037973580 8:23192426-23192448 CTGTGGAAAGTGCAGGGTCTGGG + Intronic
1038163101 8:25059246-25059268 CTGTGGCAGGTGATGGGTGGTGG - Intergenic
1038320730 8:26524552-26524574 CTTTGGAAGGTCAAGGTGGGCGG + Intronic
1038425262 8:27460517-27460539 CTGTGCTAGGTGCTGGGGGTGGG + Exonic
1039022549 8:33223639-33223661 CTGAGGCAGGCGGAGGGGGTGGG + Intergenic
1039282553 8:36002281-36002303 CTTTGGGAGGTGAAGGTGGGAGG + Intergenic
1039467767 8:37796621-37796643 TTGTGGAAGGTGGTGGTGGTCGG + Intronic
1039855073 8:41404806-41404828 CTTTGGGAGGTCAAGGTGGTAGG + Intergenic
1039894305 8:41705401-41705423 CTGTGGAAGCTGCAGGCAGTTGG + Intronic
1040629319 8:49191327-49191349 CTTTGGAAGGTTGAGGTGGTTGG - Intergenic
1041073273 8:54145845-54145867 CTGTTGTAGGTGAAGTAGGTAGG + Intronic
1041112247 8:54494172-54494194 CTTTGGAAGGTCAAGGTGGGTGG + Intergenic
1041170405 8:55136133-55136155 CTTTGGGAGGCGAAGGGGGGCGG - Intronic
1041232726 8:55769874-55769896 CTTTGGAAGGTGGAGGCGGGCGG - Intronic
1041380190 8:57246674-57246696 CAGTTGAAGGTGAAGGAGGTGGG + Intergenic
1042128779 8:65565737-65565759 CTGTGGTAAGAGAAGGGTGTTGG + Intergenic
1042160108 8:65884450-65884472 CTTTGGAAGGTCGAGGGGGGAGG - Intergenic
1042236553 8:66618981-66619003 CTTTGGAAGGCCAAGGTGGTAGG - Intergenic
1042281477 8:67061344-67061366 CTTTGGAAGGCGAAGGCGGGAGG + Intronic
1042314543 8:67411603-67411625 CTGGGGATGGTGATGGAGGTGGG + Intergenic
1042870999 8:73399425-73399447 TTGAGGAGGCTGAAGGGGGTGGG - Intergenic
1043056166 8:75442463-75442485 CTGTGGAAGGCCAAGGTGGGAGG + Intronic
1043109900 8:76167974-76167996 CTTTGGAAGGTCAAGGGAGAAGG + Intergenic
1043219694 8:77645022-77645044 CTATGGAAGGAGAAGGGGAAGGG - Intergenic
1043850135 8:85206448-85206470 GTGTGGAAGGGGAAGGGGACAGG + Intronic
1044998711 8:97861492-97861514 CTTTGGGAGGCCAAGGGGGTTGG - Intergenic
1045252890 8:100496128-100496150 GAGTGGAAGGAGAAGGGGCTGGG + Intergenic
1045555854 8:103213782-103213804 CAGTGGATTTTGAAGGGGGTGGG - Intronic
1046885192 8:119359059-119359081 ATGTGGAAGGAGAAGGGGAGGGG + Intergenic
1046983760 8:120364637-120364659 CTTTGGAAGGTTAAGGTGGGCGG + Intronic
1047283723 8:123467989-123468011 CTTTGGGAGGTGAAGGCGGGTGG - Intergenic
1047293870 8:123553859-123553881 CTTTGGAAGGCCAAGGGGGGAGG - Intergenic
1047749423 8:127868646-127868668 CTGTGGGAGGTGTAGGAGGGTGG - Intergenic
1047849068 8:128836708-128836730 CTTTGGAAGGTTAAGGCGGGTGG + Intergenic
1048354588 8:133642794-133642816 CTGTGGAAGGCGGAAGGGGCTGG + Intergenic
1048628166 8:136210019-136210041 TGGTGCAAGGAGAAGGGGGTTGG - Intergenic
1048828816 8:138456394-138456416 CTGAAGAGGGTGAAGGGAGTGGG + Intronic
1049346940 8:142144136-142144158 CTGTGGCCAGGGAAGGGGGTGGG + Intergenic
1049644129 8:143728490-143728512 TTAGGGAAGGAGAAGGGGGTTGG + Exonic
1049711963 8:144068849-144068871 CTGTGGCAGGTGTTGGGGGACGG - Intergenic
1050059853 9:1695865-1695887 TTTTGGAAGATGAAGAGGGTTGG - Intergenic
1050325881 9:4496649-4496671 CTTTGGGAGGTGAAGGTGGGAGG + Intronic
1050554679 9:6778963-6778985 CTTTGGAAGGTCAAGGTGGGTGG - Intronic
1050605047 9:7292208-7292230 CTTTGGAAGGCCAAGGTGGTTGG - Intergenic
1050910502 9:11063447-11063469 CTCTGGCAGGAGAAGGTGGTGGG + Intergenic
1050938931 9:11434526-11434548 CTTTGGAAGGTCAAGGTGGGAGG + Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051491566 9:17672634-17672656 CTGTATTGGGTGAAGGGGGTGGG - Intronic
1051791460 9:20807804-20807826 CTTTGGGAGGTGAAGGTGGGCGG + Intronic
1052054622 9:23890370-23890392 CTGTTGAAGGTGTAGGGAGAGGG - Intergenic
1052981001 9:34449258-34449280 CTGGGGAAGGTCAAGGCTGTAGG + Intronic
1055289653 9:74769513-74769535 CTGTGGGAGGTCGAGGGGGGCGG + Intronic
1055631286 9:78226489-78226511 CTTTGGAAGGTGGAGGCGGGAGG + Intergenic
1055779139 9:79800354-79800376 CTGTGGAAGCTGATGGTGGTGGG + Intergenic
1055910010 9:81339185-81339207 CTTTGGAAGGTTGAGGTGGTAGG + Intergenic
1056198258 9:84249590-84249612 CTGGGGAAGGCCAGGGGGGTGGG + Intergenic
1056216016 9:84406808-84406830 CTTTGGGAGGCGAAGGTGGTTGG - Intergenic
1057040505 9:91844353-91844375 CTGTGGAAGGTGCAGGAGCGTGG - Intronic
1057220134 9:93253101-93253123 ATGGGGATGGGGAAGGGGGTGGG - Intronic
1057882258 9:98801376-98801398 CTTTGGGAGGTTAAGGGGGGTGG + Intergenic
1058018044 9:100058317-100058339 CTTTGGAAGGTTAAGGTGGGAGG - Intronic
1058479361 9:105375281-105375303 CTTTGGGAGGCGAAGGCGGTTGG - Intronic
1059152985 9:111965957-111965979 CTTTGGGAGGTGGAGGGGGGCGG + Intergenic
1059379564 9:113912639-113912661 CAGTGGAACGTGATGAGGGTTGG + Intronic
1059492761 9:114682623-114682645 CTTTGGGAGGTCAAGGTGGTGGG - Intergenic
1059616585 9:115958152-115958174 CTGTGGGAGGCCAAGGGGGGTGG + Intergenic
1059889588 9:118786548-118786570 TGGTGGCAGGAGAAGGGGGTTGG + Intergenic
1060269069 9:122128438-122128460 CTGTGGAGGGGGCAGGGGTTGGG - Intergenic
1060272820 9:122159387-122159409 CTGTGGAGGGCGAAAGGGGGAGG + Intronic
1060634409 9:125189153-125189175 CTGAGGAAGGGGAAGGCGGTGGG - Intronic
1060844642 9:126826388-126826410 CTTTGGAAGGTCAAGGTGGGTGG - Intronic
1060861445 9:126957893-126957915 CTTTGGGAGGTGAAGGTGGGAGG + Intronic
1061284865 9:129616457-129616479 CTTAGGAAGGCGAAGGGGGGTGG - Intronic
1061397726 9:130352711-130352733 GTGTGGAAGGTGCAGGAGGTGGG - Intronic
1061493809 9:130960518-130960540 GGGTGGAAACTGAAGGGGGTTGG + Intergenic
1061679546 9:132236177-132236199 CTGTGGTGGGTGAAGGGAGAAGG + Intronic
1061759446 9:132840059-132840081 CTGTGGAAGGCCAAGGCGGGTGG - Intronic
1061853473 9:133429194-133429216 CGGGGGGAGGTGCAGGGGGTGGG - Intronic
1062016492 9:134293727-134293749 CTGTGGAGGGGGCAGGGCGTGGG - Intergenic
1062334944 9:136060933-136060955 CGGGGGAAGGTGAAAGGGGGAGG + Intronic
1062408259 9:136408333-136408355 CTGTGGGAGGTCAAGGCGGGCGG + Intronic
1062436299 9:136547973-136547995 CTGTGGGTGGTGCAGGGGTTGGG - Intergenic
1203734228 Un_GL000216v2:120493-120515 CTGGGGAGGCTGAAGTGGGTTGG + Intergenic
1185685399 X:1924461-1924483 CTTTGGAAGGTCAAGGTGGGTGG - Intergenic
1185745743 X:2572120-2572142 CTGTGAAAGGTGGAGGGACTGGG - Intergenic
1187251557 X:17603087-17603109 CTTTGGAAGGTGAAAGTGGGAGG - Intronic
1187335754 X:18379936-18379958 CTTTGGGAGGTGAAGGTGGGTGG + Intergenic
1187411661 X:19055975-19055997 CTTTGGAAGGTCAAGGAGGGTGG - Intronic
1187807434 X:23136425-23136447 CTTTGGGAGGTGAAGGCGGGCGG - Intergenic
1188312700 X:28637166-28637188 CTGTGGCACATGAAGGAGGTGGG - Intronic
1188490345 X:30732615-30732637 CTTTGGAAGGACAAGGGGGGGGG - Intergenic
1188515630 X:30982397-30982419 ATGTGGAAGTTGAATGGGATGGG - Intergenic
1188635455 X:32425219-32425241 CTCTGCACGGTAAAGGGGGTTGG - Intronic
1189128972 X:38478967-38478989 CTGAGAAAGGTGAAGGGACTGGG + Intronic
1189385229 X:40531553-40531575 TGGAGGAAGGGGAAGGGGGTTGG + Intergenic
1189693434 X:43639688-43639710 CTTTGGGAGGTCAAGGCGGTCGG - Intergenic
1190330402 X:49231830-49231852 CTGTGGAAGGTGAAAGCAGTGGG - Exonic
1190361031 X:49648436-49648458 CTTTGGGAGGTCAAGGGGGGTGG - Intergenic
1190922543 X:54869439-54869461 CTTTGGGAGGTGAAGGAGGGAGG - Intergenic
1191982402 X:66940812-66940834 CTCTGGAAGATGGAGTGGGTAGG + Intergenic
1192164049 X:68813738-68813760 CTTTGGAAGGTCAAGGTGGGAGG + Intergenic
1192239528 X:69318424-69318446 CTGTGGAAGGAGTGGGAGGTTGG + Intergenic
1192423190 X:71052314-71052336 CTTTGGAAGGCCAAGGCGGTTGG + Intergenic
1192497334 X:71624663-71624685 CTGTGTAAGGTGAGAGGGGCTGG + Intergenic
1192529022 X:71870571-71870593 GTGTGGAAGGTGGAGGCGGGGGG + Intergenic
1192656899 X:73002716-73002738 CGGTGGGAGATGACGGGGGTGGG - Intergenic
1192665221 X:73080285-73080307 CGGTGGGAGATGACGGGGGTGGG + Intergenic
1193136653 X:77979073-77979095 CTTTGGAAGGTGAAGGGGGGCGG - Intronic
1193301138 X:79890758-79890780 CTTTGGAAGGCCAAGGGGGGTGG + Intergenic
1193750825 X:85341306-85341328 CTCTGGGTGGTGAAGAGGGTAGG + Intronic
1194464698 X:94219144-94219166 CAGTGAAAGGTGAGGGGGATAGG - Intergenic
1194985772 X:100488198-100488220 ATCTGGAAGGTCAAGGAGGTGGG - Intergenic
1195318714 X:103703685-103703707 CTTTGGAAGGCCAAGGGGGAAGG + Intergenic
1195422816 X:104694572-104694594 CTTTAGAAGGTGAAGGGGAATGG + Intronic
1196178326 X:112664569-112664591 CTGGGGAAGATGGCGGGGGTGGG - Intronic
1196544672 X:116947770-116947792 CTGAAGATGGTGAAGGGGGAAGG + Intergenic
1197328944 X:125129590-125129612 CTGGGAAAGGTAATGGGGGTGGG - Intergenic
1197512323 X:127385573-127385595 CTTTGGAAGGCCAAGGCGGTTGG - Intergenic
1197766119 X:130060433-130060455 CCCTGGAAAGTGAAGGGGGCTGG + Intergenic
1198278145 X:135116949-135116971 CTCGGGACGGGGAAGGGGGTGGG - Intergenic
1198292817 X:135255567-135255589 CTCGGGACGGGGAAGGGGGTGGG + Intronic
1199543704 X:148985227-148985249 CTTTGGGAGGCCAAGGGGGTCGG - Intronic
1200259837 X:154608251-154608273 CTGAGGAAGGCGAGGGGGGTTGG - Intergenic
1200266791 X:154650489-154650511 CTGAGGAAGGCGAGGGGGGTTGG - Intergenic
1201286021 Y:12379401-12379423 TGGTGGAAGGTGAAGGGAGCAGG + Intergenic
1201355980 Y:13097421-13097443 CAGTGGAAGGAGATAGGGGTGGG - Intergenic