ID: 1084683313

View in Genome Browser
Species Human (GRCh38)
Location 11:70679606-70679628
Sequence GGGTCCTGCCGAGGAACAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 194}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084683300_1084683313 14 Left 1084683300 11:70679569-70679591 CCCCTGTGCTGGGGAGAAGTGGG 0: 1
1: 1
2: 2
3: 35
4: 365
Right 1084683313 11:70679606-70679628 GGGTCCTGCCGAGGAACAGAGGG 0: 1
1: 0
2: 3
3: 17
4: 194
1084683297_1084683313 20 Left 1084683297 11:70679563-70679585 CCCATTCCCCTGTGCTGGGGAGA 0: 1
1: 0
2: 1
3: 19
4: 241
Right 1084683313 11:70679606-70679628 GGGTCCTGCCGAGGAACAGAGGG 0: 1
1: 0
2: 3
3: 17
4: 194
1084683303_1084683313 12 Left 1084683303 11:70679571-70679593 CCTGTGCTGGGGAGAAGTGGGTC 0: 1
1: 0
2: 1
3: 28
4: 251
Right 1084683313 11:70679606-70679628 GGGTCCTGCCGAGGAACAGAGGG 0: 1
1: 0
2: 3
3: 17
4: 194
1084683302_1084683313 13 Left 1084683302 11:70679570-70679592 CCCTGTGCTGGGGAGAAGTGGGT 0: 1
1: 0
2: 2
3: 43
4: 468
Right 1084683313 11:70679606-70679628 GGGTCCTGCCGAGGAACAGAGGG 0: 1
1: 0
2: 3
3: 17
4: 194
1084683298_1084683313 19 Left 1084683298 11:70679564-70679586 CCATTCCCCTGTGCTGGGGAGAA 0: 1
1: 0
2: 3
3: 30
4: 304
Right 1084683313 11:70679606-70679628 GGGTCCTGCCGAGGAACAGAGGG 0: 1
1: 0
2: 3
3: 17
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084683313 Original CRISPR GGGTCCTGCCGAGGAACAGA GGG Intronic
900435180 1:2627825-2627847 GGGTCTTGACGGGGAACAGAGGG + Intronic
901629573 1:10641592-10641614 GGGACCTGCCCAGGTTCAGAGGG - Intronic
902608924 1:17585753-17585775 TGGTCCAGCAGATGAACAGATGG - Intronic
903267892 1:22169231-22169253 GGATCCTGCCTAGGAAGGGACGG - Intergenic
904435201 1:30490476-30490498 GGGTGCTGGTGTGGAACAGATGG + Intergenic
907325592 1:53636918-53636940 TCGTCCTGCCCACGAACAGAAGG - Intronic
907819602 1:57954043-57954065 GGGTCCTGGCAAGGAACAGATGG - Intronic
910486529 1:87721072-87721094 GGGTCCTGGCAGGAAACAGATGG - Intergenic
911597532 1:99814035-99814057 AGGTCCTGGCGAGAAGCAGATGG - Intergenic
915556601 1:156664353-156664375 GGGTCCTGCAGCAGGACAGATGG - Intergenic
915604494 1:156941986-156942008 TGTTCCTGCCGAGCAACAGATGG - Exonic
915741496 1:158121962-158121984 GGGTCTTCCCCAGGTACAGATGG + Intergenic
916056525 1:161072495-161072517 GAGCCCTCCCGATGAACAGAAGG + Exonic
917238370 1:172919217-172919239 GGGACCTGCCTGGGAAGAGATGG - Intergenic
921240509 1:213176441-213176463 GAGCCCTGCCGAGGAGCTGAAGG + Exonic
922507193 1:226133428-226133450 GGTTCCTGTCGTGGAAGAGAGGG + Intergenic
923412642 1:233725381-233725403 AGGTTCTACCCAGGAACAGAAGG + Intergenic
1062848526 10:726147-726169 GCGTCATGCCTAGGAACTGAGGG + Intergenic
1064326428 10:14355589-14355611 GGGTCCTGGCAAGAGACAGATGG - Intronic
1066422309 10:35274567-35274589 TGGACCTGCGGAGGAAGAGATGG - Intronic
1066544570 10:36485326-36485348 TAGTCCTGGGGAGGAACAGAGGG - Intergenic
1069881507 10:71596597-71596619 GGGTCCTGGCGTGGAAGGGAAGG - Intronic
1069914081 10:71776513-71776535 GGGTCCTGGCAGGAAACAGATGG + Intronic
1071526772 10:86363818-86363840 CGCGGCTGCCGAGGAACAGAGGG + Intronic
1073325821 10:102643666-102643688 GGGCTCTGCCGAGGAAAACAAGG - Intergenic
1073538087 10:104295877-104295899 GGGTTCTGGTGAGGGACAGAGGG - Intronic
1074386046 10:113017514-113017536 GGCTCCAGCCAAGGAACACAGGG - Intronic
1074607664 10:114989684-114989706 TGGTTCTGCAGAGAAACAGAAGG - Intergenic
1076021094 10:127074300-127074322 GGAACTTGCCCAGGAACAGAGGG + Intronic
1076506067 10:130973416-130973438 GGGTCCTTCTGAGGAGCAGTGGG + Intergenic
1076767866 10:132646451-132646473 GGGTCCTGCCTGGGAAGAGGGGG + Intronic
1077676946 11:4203683-4203705 GAGTCCAGCCGAACAACAGAAGG - Intergenic
1079989698 11:27233730-27233752 GGGTCCAGCCAGGGAACAGATGG + Intergenic
1084626689 11:70313059-70313081 AGGGCCAGCAGAGGAACAGACGG + Intronic
1084683313 11:70679606-70679628 GGGTCCTGCCGAGGAACAGAGGG + Intronic
1085633948 11:78143460-78143482 AGGTGCTGCAGAGAAACAGATGG + Intergenic
1087598373 11:100282992-100283014 TGGACCTGCCCAGGGACAGAAGG - Intronic
1088803546 11:113329774-113329796 TGGTCCTGCCAGGAAACAGATGG - Intronic
1090269137 11:125373760-125373782 GGGTCCTGTGCAGGGACAGAGGG + Intronic
1090285283 11:125495013-125495035 GGGTTCTGCGGAGGAGCAGTGGG - Intronic
1090497641 11:127229937-127229959 GGGTCCCCCCAAGAAACAGATGG - Intergenic
1091105175 11:132911943-132911965 GTGTCCTGAAGAGGAACAAAGGG - Intronic
1091746274 12:2995060-2995082 GGTTCCTGCCGGGCCACAGAAGG + Intronic
1092280906 12:7097024-7097046 GGGCCCTGCTGGGGGACAGATGG - Exonic
1093930449 12:24950230-24950252 GTGGCCTGCCGTGGAAGAGAGGG + Intergenic
1095741502 12:45611373-45611395 GGGTCCAGCCGACGAAAGGATGG - Intergenic
1098297152 12:69015477-69015499 AGCTCCAGCCGAGGAACAGATGG + Intergenic
1101135624 12:101740101-101740123 GGGTCCTGGTGAGGATCGGATGG - Intronic
1104326930 12:127808016-127808038 GGGACCTTGCGAGGAGCAGATGG - Intergenic
1104787695 12:131460211-131460233 GGTTCCTGCTGCGGCACAGAAGG + Intergenic
1107987921 13:45791864-45791886 GGGTCCTGCCAAGGTGCAGGAGG - Intronic
1110014743 13:70386710-70386732 GGTTCCTGGGGAGGAAGAGATGG - Intergenic
1110366239 13:74688949-74688971 GGGCCCAGCCTAGGATCAGAAGG + Intergenic
1110458731 13:75719614-75719636 GGGTCCTACCGTGGCAGAGAAGG - Intronic
1115884901 14:37960194-37960216 GGGTCTTGCCTAGGATCACATGG + Intronic
1117658462 14:57980408-57980430 GGGTCCTGCCGAGGAAGGCTGGG + Intronic
1120183543 14:81369222-81369244 GGGTCCTGGCGGGAAGCAGATGG - Intronic
1121250480 14:92496063-92496085 GGGTTCTGCTGAGGAAGAGGAGG - Exonic
1121456176 14:94040210-94040232 TGGTTCAGCCAAGGAACAGATGG - Intronic
1121469885 14:94144596-94144618 GGGTCTTGGCAAGAAACAGATGG + Intergenic
1123630584 15:22257697-22257719 GGCACCGGCCGAGGAGCAGAGGG - Intergenic
1125153930 15:36564737-36564759 GGGTCCTGGCCGGAAACAGATGG + Intergenic
1127012469 15:54644942-54644964 TGGACCTGCCCTGGAACAGAGGG + Intergenic
1127853564 15:62935950-62935972 AGGTCCTGCCAGGAAACAGATGG - Intergenic
1129237444 15:74232246-74232268 GGGTCCTGCCAGGAAAAAGAAGG + Intergenic
1130577340 15:85104322-85104344 GGGTCATGCAGAGGACAAGATGG + Intronic
1131157659 15:90084935-90084957 GGGTCCTGCCCTTGCACAGATGG - Intronic
1132836158 16:1954437-1954459 GGGCCCTGGAGATGAACAGATGG - Intronic
1132895365 16:2226571-2226593 TGATCCTGCCGAGGGACTGAAGG + Intronic
1133186895 16:4106394-4106416 CGGTGCTGCCGCGGAACAGAAGG - Intronic
1133400036 16:5479051-5479073 GGGTCCTGGAAGGGAACAGATGG - Intergenic
1134211851 16:12284259-12284281 GGGGCGTGCCCAGGAACATACGG - Intronic
1135522441 16:23187745-23187767 AGGTCCTGCCGAGGATGATAGGG - Intronic
1136616239 16:31400260-31400282 GGGTGCTGGGGAGAAACAGAAGG - Intronic
1137930722 16:52584733-52584755 GGGTCCTAGCAAGAAACAGATGG - Intergenic
1139011467 16:62639837-62639859 GGGTCCTGGCAGGAAACAGAAGG - Intergenic
1140879904 16:79188626-79188648 AGATCCTGCCTAGCAACAGATGG - Intronic
1141548212 16:84786517-84786539 GGATATTGCAGAGGAACAGAAGG + Intergenic
1144428942 17:15172824-15172846 GGGTCCTGCCAATGAATAGGGGG + Intergenic
1144460896 17:15457895-15457917 GGGTCCTGTGGGGGAACAGAGGG - Intronic
1144624413 17:16837540-16837562 GGGCCCTGCAGAGAAACAGAGGG + Intergenic
1144882014 17:18435180-18435202 GGGCCCTGCAGAGAAACAGAGGG - Intergenic
1145150219 17:20509206-20509228 GGGCCCTGCAGAGAAACAGAGGG + Intergenic
1145290944 17:21545302-21545324 GGGTCCTCACCAGAAACAGATGG + Intronic
1146162150 17:30565849-30565871 GGGTCCTGCAGAGAAACAGAGGG + Intergenic
1147866351 17:43555231-43555253 GGATCCTGCCTGGGAAAAGACGG - Intronic
1148017320 17:44531208-44531230 GGGTCCTTCAGAGAAACAGTAGG - Intergenic
1149486513 17:57046599-57046621 GGATCCTGCCCTGGAACAGGCGG - Intergenic
1151927707 17:77211050-77211072 GGGTCCTGTCTAAGAACAGCAGG - Intronic
1151983570 17:77528356-77528378 GGGTCCCAGAGAGGAACAGAGGG - Intergenic
1152137836 17:78515575-78515597 GGGTCCTGGCCAGCAACAGCAGG - Intronic
1152988120 18:337852-337874 GGGTCAGGGCGAGGAAAAGAGGG - Intronic
1155216482 18:23647849-23647871 GAGTTCTGGCAAGGAACAGATGG + Intronic
1157726691 18:49969858-49969880 GTGTTCTGCTGAGGAACAGCTGG - Intronic
1159382308 18:67676060-67676082 GGGTCCTGCTGAGGGTGAGAGGG + Intergenic
1160389785 18:78521469-78521491 GGGTGCTGCTGAGGCAGAGAAGG + Intergenic
1160732576 19:647984-648006 GGGTCCTGCCCTGGAACAGGCGG + Exonic
1161509087 19:4660746-4660768 GGGGCCTGCAGAGGAAGAGGGGG + Exonic
1164527177 19:29021016-29021038 GGTTCCTGCCGCGGGAGAGAAGG - Intergenic
1167270162 19:48501908-48501930 GGGTCCAGGAGAGGAACGGAAGG - Intronic
1168584906 19:57584238-57584260 GGGTCCTCCCGCTGAACAGTGGG + Exonic
926226470 2:10970775-10970797 GGGTCCTGCAGGGGCACAAAAGG - Intergenic
926370263 2:12171859-12171881 GGTTTCTGCCGGGGAACACATGG - Intergenic
927512971 2:23656095-23656117 GGGTCCAGAAGAGGGACAGATGG - Intronic
929088784 2:38194444-38194466 GGGTCCTGCCCATAACCAGAAGG - Intergenic
929587486 2:43125616-43125638 GGGTCCTGCCCATCAGCAGAGGG + Intergenic
931312462 2:61095649-61095671 GGGTCCTGTCGGGGAGGAGAGGG - Intronic
932099314 2:68882492-68882514 GGGTCCTAGAGAGGAACAGATGG - Intergenic
932758746 2:74426119-74426141 AGGTCCAGCAGAGGAACAGGAGG + Exonic
933738441 2:85513862-85513884 GGGTCTTGGCAAGAAACAGAGGG - Intergenic
935992598 2:108734486-108734508 GGGTTCTTCTGAGGAAAAGAGGG + Intronic
936127916 2:109807128-109807150 GGGTTCTTCTGAGGAAAAGAGGG + Intronic
936216781 2:110564357-110564379 GGGTTCTTCTGAGGAAAAGAGGG - Intronic
936425920 2:112418938-112418960 GGGTTCTTCTGAGGAAAAGAGGG - Intronic
937255828 2:120554825-120554847 AGGTCCAGCCTAGGAACAAAAGG + Intergenic
938066095 2:128282785-128282807 GGGCACTGCGGAGGAGCAGAGGG + Intronic
938210823 2:129464658-129464680 GGGTCCTGGCTAGGAAGGGAAGG - Intergenic
940270117 2:151881395-151881417 TGGTCCTGCCGGGGAAAAGAAGG + Intronic
942495438 2:176534969-176534991 GTGCCCTGCCGAGCAATAGAAGG - Intergenic
943145447 2:184038590-184038612 GGGTCTTGGCAAGGATCAGATGG + Intergenic
944442939 2:199761104-199761126 GGGTCCTGGCAAGAAACTGATGG - Intronic
944534508 2:200695915-200695937 AGGTCCTGCCCTGGACCAGAGGG - Intergenic
948097374 2:235347127-235347149 GGGGCCTGGCGAGACACAGATGG - Intergenic
948540953 2:238691203-238691225 GGATTCTGCCCAGGAACACAGGG - Intergenic
948925874 2:241097268-241097290 AGGTCCTCTCGAAGAACAGAGGG + Exonic
1169231043 20:3889175-3889197 GGGTTCCGCGGAGGAAGAGAAGG - Exonic
1169759816 20:9079224-9079246 GGGCCCTGCTGGGGAACAGATGG + Intronic
1170685706 20:18567612-18567634 GGGGCCTGCCCCGGAACACACGG + Intronic
1174401460 20:50278159-50278181 AGGACCTGCCGAGGGAGAGAAGG - Intergenic
1175764498 20:61583142-61583164 GGGCTCTGCGGAGGGACAGAGGG + Intronic
1175764511 20:61583183-61583205 GGGCTCTGCGGAGGGACAGAGGG + Intronic
1176079975 20:63267619-63267641 AGGTCCTGCCCAGGACCAAAGGG + Intronic
1179803960 21:43825764-43825786 GGGTCCTGGCTAGGAAGAGGAGG - Intergenic
1183273325 22:36875635-36875657 GTGCCCTGCAGAGGAAGAGAAGG - Exonic
1183625694 22:38999990-39000012 GGGGCCCGCCAAGGTACAGAGGG - Intergenic
1184617055 22:45645516-45645538 GGGGCCGGCAGAGGAACAAACGG + Intergenic
949902130 3:8824350-8824372 GGGTACTGGCGAGAAACAGAAGG - Intronic
950408752 3:12820705-12820727 TGGTCCTGCCGAGCCCCAGAGGG - Intronic
952161784 3:30701083-30701105 GGGTCCTGCCATGGAACAGTAGG + Intergenic
953981357 3:47414721-47414743 GAGTCCTGATGAAGAACAGAGGG - Intronic
954317756 3:49810528-49810550 GGGACCTGAAGAGGAACTGACGG + Exonic
955341522 3:58129027-58129049 GGGTACTGCCGGGAAACAGTCGG + Intronic
956199975 3:66695775-66695797 GGGTCTTGCCAAGAAAGAGATGG - Intergenic
957474061 3:80701804-80701826 GGGACCTGGCGGGAAACAGATGG + Intergenic
961166511 3:124767181-124767203 GGGTCCTGGGGAGGAACAGAAGG + Intronic
963892430 3:150650598-150650620 GAGCCCTGGTGAGGAACAGAGGG + Intergenic
968549700 4:1215888-1215910 GGGTCTTGCCCAGGTGCAGATGG + Intronic
970416059 4:15858087-15858109 GGCTACTGCCGTGGAGCAGATGG + Intergenic
972954710 4:44375204-44375226 GCGGCCTGCTGAGGAACAAAAGG + Intronic
973198815 4:47476801-47476823 GGGTTCTCCAGAGAAACAGAAGG - Intergenic
979070029 4:116190901-116190923 GGGTCCTGTCGAGGGACGGCAGG + Intergenic
980188869 4:129497090-129497112 GGCTCCTGCAAAGGAAAAGATGG - Intergenic
982125415 4:152179969-152179991 GGGTCCTGCAAAGGTACAGTTGG + Intergenic
982622845 4:157728277-157728299 GGGACCTGCCGTGGGCCAGAGGG + Intergenic
991509327 5:67359580-67359602 GTGTCCTCCCAAGGCACAGAGGG + Intergenic
994784341 5:104136870-104136892 GGTTCCTGGCAAGAAACAGATGG - Intergenic
998517442 5:142769424-142769446 GAGTCCTGCGGTCGAACAGAGGG + Intergenic
998747607 5:145278708-145278730 GGGTCCATCCAAGGAACACAAGG + Intergenic
1002575811 5:180173020-180173042 AGGTCCTGCCAGGGGACAGAAGG - Intronic
1006027848 6:31158631-31158653 GGCTCCTGCCGAGGAGCCCAAGG + Exonic
1006067822 6:31475044-31475066 GGGTCCTGCCAAGGCACTGGTGG - Intergenic
1006201355 6:32294947-32294969 GGTTCTTGCCGTGGAGCAGAGGG + Intronic
1006381095 6:33697658-33697680 GGGTCCTGAGGAGGATCATAAGG - Exonic
1006907782 6:37544734-37544756 GGGTCCTGGCAGGAAACAGATGG - Intergenic
1007907070 6:45472548-45472570 AAGTCCTGCCAAGAAACAGACGG - Intronic
1008734011 6:54520153-54520175 GGGTCCTGGTAAGAAACAGATGG + Intergenic
1010934511 6:81845507-81845529 GGATCCTGGCAAGAAACAGATGG + Intergenic
1013753224 6:113431289-113431311 TGGTGCTGCCTAGGAACAGTAGG - Intergenic
1014284149 6:119477512-119477534 GGGTCTTGCCGCTGAACTGATGG - Intergenic
1016101168 6:140102324-140102346 GTGACCTACAGAGGAACAGAGGG + Intergenic
1016827967 6:148405524-148405546 GGGCTGTGCAGAGGAACAGATGG - Intronic
1019325801 7:437686-437708 GGGTCCTGCTGAGAAAGAAAAGG - Intergenic
1019599596 7:1874701-1874723 GGGTCCTGCTGAGCCACACAAGG - Intronic
1019806887 7:3134180-3134202 GGGTCCTGGCAGGAAACAGATGG - Intergenic
1023705848 7:42941201-42941223 GGGGCCAGCAGAGGAACACAGGG - Intronic
1026610528 7:71855603-71855625 GGGTGCTGCCTAGGGTCAGACGG - Intronic
1028507094 7:91582659-91582681 GGGTCCTGGCAGGAAACAGATGG + Intergenic
1032848717 7:135774041-135774063 GGGTCCTTGCGAGGAAGAGGAGG - Intergenic
1033242979 7:139696057-139696079 GTGTGCTGCAGATGAACAGAAGG + Intronic
1033262803 7:139858181-139858203 GGCTGCTGCCTTGGAACAGATGG - Intronic
1033435324 7:141328531-141328553 GGGTCTAACCCAGGAACAGAAGG + Intronic
1034298634 7:149995858-149995880 GGGTCTTGACGAGGAAGGGAAGG + Intergenic
1035271500 7:157722627-157722649 GTGCCCTGCCGAGGAATGGAGGG - Intronic
1035761768 8:2073672-2073694 GCTTCCTGCCGATGAGCAGACGG + Intronic
1037150048 8:15626154-15626176 GGGTCCTGCCTAGGCTCAGGAGG - Intronic
1037973660 8:23193090-23193112 GGGTGCTGCAGTGGAAGAGATGG - Intronic
1038228908 8:25682696-25682718 GGGGCCTGAAGAGGCACAGAAGG + Intergenic
1038493774 8:27987765-27987787 GGGTCCTGGTGATGAGCAGAGGG - Intronic
1038846106 8:31230928-31230950 GGGTCCTGTCAAGAAACAAATGG + Intergenic
1040894270 8:52349730-52349752 GGGTCCTGGTGGGAAACAGATGG + Intronic
1041401296 8:57448200-57448222 GGTTCCCACCCAGGAACAGAAGG + Intergenic
1045036305 8:98178932-98178954 GGGGCCTGCAGAGGAGAAGAGGG - Intergenic
1045469538 8:102499587-102499609 GTGTCCTGCAGAGGAATAAAGGG - Intergenic
1045695530 8:104805425-104805447 GGGTCCTGGCAAGAAGCAGATGG + Intronic
1046806569 8:118485912-118485934 GGGTCCTGGCAGGAAACAGATGG + Intronic
1047180348 8:122581934-122581956 GGGTCCTGATGAGGATTAGATGG - Intergenic
1047584373 8:126253903-126253925 GGGTCCTTATGAGGAAAAGAGGG - Intergenic
1049198244 8:141327045-141327067 GGGTTCTTCCGAGGGCCAGAGGG - Intergenic
1049291797 8:141807171-141807193 GGGTCCTTCTGAGGGCCAGAGGG + Intergenic
1056391554 9:86145969-86145991 GGGAGCTGCTGAAGAACAGAAGG + Intergenic
1056546281 9:87616570-87616592 GGGTCCTACCAGGAAACAGACGG + Intronic
1057144529 9:92749161-92749183 GGGTCCAGGCCAGGAAAAGAGGG + Intronic
1057845332 9:98518286-98518308 GCGTCCTGGCAAGAAACAGACGG - Intronic
1061363636 9:130158927-130158949 GGCTCCTTGCGAGGACCAGATGG - Intergenic
1061925530 9:133804423-133804445 GGTTCCCGCTGAGGAACAGCGGG - Intronic
1186776015 X:12865407-12865429 GGGTCCTGCCAGGAAACAGACGG + Intergenic
1187073834 X:15914668-15914690 GGGTCCTGCCAGGAAACAGATGG - Intergenic
1187550561 X:20300821-20300843 GGGTCTTGCCTGGAAACAGATGG + Intergenic
1189233105 X:39467373-39467395 GGGTCCGGCACAGGCACAGATGG + Intergenic
1190281588 X:48934608-48934630 GGGTTCTGCAGAGAAAGAGAAGG + Exonic
1192804739 X:74498837-74498859 GGGTCATGTCGGGGATCAGAGGG - Intronic
1193738201 X:85185732-85185754 TGGTCCTGCCCTGGACCAGAAGG - Intergenic
1194522068 X:94931476-94931498 TGGACCTGCCGTGGGACAGAGGG - Intergenic
1196174823 X:112628858-112628880 GAATCCTGCTGAGAAACAGATGG - Intergenic
1199239161 X:145526479-145526501 TGGACCTGCCCAGGACCAGATGG + Intergenic