ID: 1084683641

View in Genome Browser
Species Human (GRCh38)
Location 11:70681218-70681240
Sequence GCGTGGGGTCCCTTTTCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 122}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084683636_1084683641 -1 Left 1084683636 11:70681196-70681218 CCCGTTCTCTCTCTGCTGCTCAG 0: 1
1: 0
2: 6
3: 94
4: 775
Right 1084683641 11:70681218-70681240 GCGTGGGGTCCCTTTTCTCTTGG 0: 1
1: 0
2: 1
3: 9
4: 122
1084683637_1084683641 -2 Left 1084683637 11:70681197-70681219 CCGTTCTCTCTCTGCTGCTCAGC 0: 1
1: 0
2: 12
3: 78
4: 751
Right 1084683641 11:70681218-70681240 GCGTGGGGTCCCTTTTCTCTTGG 0: 1
1: 0
2: 1
3: 9
4: 122
1084683633_1084683641 7 Left 1084683633 11:70681188-70681210 CCAAGTCCCCCGTTCTCTCTCTG 0: 1
1: 0
2: 4
3: 33
4: 324
Right 1084683641 11:70681218-70681240 GCGTGGGGTCCCTTTTCTCTTGG 0: 1
1: 0
2: 1
3: 9
4: 122
1084683634_1084683641 1 Left 1084683634 11:70681194-70681216 CCCCCGTTCTCTCTCTGCTGCTC 0: 1
1: 1
2: 6
3: 82
4: 838
Right 1084683641 11:70681218-70681240 GCGTGGGGTCCCTTTTCTCTTGG 0: 1
1: 0
2: 1
3: 9
4: 122
1084683635_1084683641 0 Left 1084683635 11:70681195-70681217 CCCCGTTCTCTCTCTGCTGCTCA 0: 1
1: 0
2: 2
3: 71
4: 720
Right 1084683641 11:70681218-70681240 GCGTGGGGTCCCTTTTCTCTTGG 0: 1
1: 0
2: 1
3: 9
4: 122
1084683632_1084683641 16 Left 1084683632 11:70681179-70681201 CCGGCTCTGCCAAGTCCCCCGTT 0: 1
1: 0
2: 0
3: 7
4: 139
Right 1084683641 11:70681218-70681240 GCGTGGGGTCCCTTTTCTCTTGG 0: 1
1: 0
2: 1
3: 9
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084683641 Original CRISPR GCGTGGGGTCCCTTTTCTCT TGG Intronic
900391113 1:2434361-2434383 CCGTGGGGCCCCTTCTCTCCCGG + Intronic
904138738 1:28334937-28334959 TCTTGGGGTCTATTTTCTCTAGG - Exonic
904306261 1:29592242-29592264 GCGTGGGGACCCGCTTGTCTCGG - Intergenic
906452329 1:45961157-45961179 CCCTGGGATCCCTGTTCTCTTGG - Intronic
919441516 1:197639394-197639416 GCTTGAGGTTCCTTTTCTTTAGG - Intronic
921130124 1:212212609-212212631 GAATGGGGTCACCTTTCTCTGGG + Intergenic
1064014536 10:11762307-11762329 GCCTGGGGTGACTTTTCCCTGGG - Intronic
1064456432 10:15491528-15491550 GGGTAAAGTCCCTTTTCTCTTGG - Intergenic
1065861474 10:29875924-29875946 GAGGGGGGTCCATTCTCTCTGGG + Intergenic
1067227195 10:44384056-44384078 CCGTGGTGTCCCGTTTCACTGGG - Intronic
1068727512 10:60319951-60319973 AACTGGGGTCCCTTTTCTCCAGG - Intronic
1069830685 10:71280623-71280645 GCCTGGGGTCCCTTCCTTCTCGG + Intronic
1070003233 10:72396950-72396972 TCTTGGGGTCCCTCTTCTCAAGG - Intronic
1071613520 10:87053790-87053812 GTGTGGTGTCCCTGTTCTCTGGG - Intronic
1071966926 10:90860756-90860778 GCCTGGGGTCCCTTTTATGAGGG + Intergenic
1075549578 10:123382295-123382317 GGGTGGGGTCTCCTGTCTCTTGG - Intergenic
1076451786 10:130561387-130561409 TCCTGGGGTCCCTATTCTCAGGG + Intergenic
1076451913 10:130561896-130561918 TCCTGGGGTCCCTGTTCTCAGGG + Intergenic
1077164198 11:1127764-1127786 GGGTGGGGTCCCTTTTGTTTGGG + Intergenic
1077508663 11:2943860-2943882 CCGTGGGCTGCCTTCTCTCTGGG - Intergenic
1084683641 11:70681218-70681240 GCGTGGGGTCCCTTTTCTCTTGG + Intronic
1087139806 11:94754205-94754227 GAGTCGGGTTCCTCTTCTCTGGG - Intronic
1089866737 11:121639294-121639316 GCGTCAGATCCCTTTGCTCTAGG - Intergenic
1091875130 12:3927480-3927502 GCTTGGTGTCCCTTTGCTCAGGG + Intergenic
1094401010 12:30060529-30060551 GCGTGAGATCCCATTGCTCTAGG + Intergenic
1095545645 12:43365012-43365034 GGATGTGGTCCTTTTTCTCTTGG - Intronic
1095981147 12:47975499-47975521 GGGTCGGGGCCCTTCTCTCTCGG + Exonic
1096843977 12:54395428-54395450 CAGTGGGCTCCCCTTTCTCTGGG + Exonic
1096844377 12:54397578-54397600 CAGTGGGCTCCCCTTTCTCTGGG + Intronic
1097232772 12:57522571-57522593 GCGTGGGGTGTTTGTTCTCTTGG + Intronic
1100138052 12:91579278-91579300 GCCTGTTGTCCCTTTTCTGTTGG - Intergenic
1100431954 12:94538922-94538944 GAGAGGGGCTCCTTTTCTCTGGG - Intergenic
1102477238 12:113196567-113196589 GCGGGGGCTCTCATTTCTCTGGG - Intronic
1102908874 12:116697438-116697460 GCTTGGAGTCCCTTTTGTCAAGG - Intergenic
1103392951 12:120587437-120587459 GCCTGGGGTCCCTTTTATAAGGG - Intergenic
1103941329 12:124502893-124502915 GGGTGGAGGCCCGTTTCTCTAGG - Intronic
1104628034 12:130375870-130375892 GCATGGTGTCCCCTTTCTCCTGG + Intergenic
1108043168 13:46358094-46358116 GCCTGGGGTATCTTTTCTTTAGG - Intronic
1114702569 14:24693820-24693842 GCGTGGGGTCCCTTAACACAAGG - Intergenic
1115001571 14:28427152-28427174 TCCTGGGTTTCCTTTTCTCTTGG + Intergenic
1118556918 14:67033635-67033657 GTTTGGTGTCCCTTTTCTCCTGG - Intronic
1118845700 14:69546440-69546462 GCGATGGCTCCCATTTCTCTTGG - Intergenic
1119427327 14:74544212-74544234 GGGTGGGGCTCCTGTTCTCTGGG - Intronic
1121255410 14:92526949-92526971 GCCTGGGGTCCCTTGGCTCGTGG + Intronic
1122127786 14:99588434-99588456 CCGTGGGCTCTCTTTTCTCTGGG - Intronic
1122471867 14:101973677-101973699 GCGTGGGGTCCCAGCTCTTTGGG + Intronic
1122865561 14:104602463-104602485 GCTTGAGGTCCCTTTAGTCTGGG - Intronic
1123060733 14:105593091-105593113 CTCTGGGGTCCCTTTTCTTTTGG + Intergenic
1123085206 14:105714068-105714090 CTCTGGGGTCCCTTTTCTTTAGG + Intergenic
1124247903 15:28086176-28086198 GAGAGGGGTCCCTTTTCTGCAGG - Intronic
1124699996 15:31904394-31904416 GCCTGGGTCCCCCTTTCTCTGGG - Intergenic
1129242906 15:74262073-74262095 GCATGGCCTCCCTCTTCTCTAGG - Intronic
1130219818 15:82009984-82010006 GCCTTGGGTCCCTGTCCTCTGGG + Intergenic
1133399038 16:5471410-5471432 GAGTGGTGTCCTTTTTCTCTCGG + Intergenic
1133471579 16:6081088-6081110 GCATGGTGTCCCTTTGCCCTGGG + Intronic
1133828236 16:9298106-9298128 AAGTGGGGTCCCTTCCCTCTAGG + Intergenic
1134654511 16:15938012-15938034 GCCTGGGGTCCCTTTTATAAGGG - Intergenic
1136355589 16:29743367-29743389 ACTTGGGGTCCCATTTCTGTAGG + Exonic
1140688314 16:77454932-77454954 GTGTTGTGTTCCTTTTCTCTAGG + Intergenic
1140858319 16:78997455-78997477 GCCTGACCTCCCTTTTCTCTGGG + Intronic
1143269725 17:5666605-5666627 GCGTGGGCTTTCTTTGCTCTTGG - Intergenic
1147443641 17:40462135-40462157 GTGTGGGGTCCCTCTTCGCAGGG + Intergenic
1148493492 17:48037867-48037889 GCGTGGCCTCCCTTTCCTCGGGG + Intronic
1151674526 17:75590719-75590741 GCGGGGATCCCCTTTTCTCTGGG + Intergenic
1152134815 17:78497628-78497650 GTTTGGGGTCCCCATTCTCTTGG + Intronic
1152610155 17:81311452-81311474 GTGTGGACTCCCTTCTCTCTGGG - Exonic
1153953051 18:10073089-10073111 GCGTCAGTTCCCTTTTCACTGGG + Intergenic
1154384004 18:13877217-13877239 GCCTATGGTCCCTTGTCTCTTGG - Intergenic
1160029613 18:75247354-75247376 GAGTGGAGTCCCTTTGCCCTTGG + Intronic
1160751449 19:736300-736322 GCGTGGGGCCCGTCTTCTCGGGG - Intronic
1163823980 19:19512629-19512651 GCTGTGGGTCCCTTTCCTCTCGG - Intronic
1166799703 19:45449057-45449079 GCGAGGGGTCCCCTCTCACTGGG - Intronic
1166922590 19:46240384-46240406 ACGTGGTTTCCCCTTTCTCTCGG + Intergenic
1167303783 19:48695697-48695719 GAGTGGGGGCCCCTTTCTGTTGG + Intergenic
926441162 2:12890232-12890254 GTGTGGGGTCCTTTTTCACCAGG - Intergenic
926716846 2:15931169-15931191 GGGTGGAGTCTCTTTCCTCTGGG + Intergenic
928875704 2:36036561-36036583 GGAAGGGGTCCCTTTTATCTGGG + Intergenic
929653242 2:43703254-43703276 ACCTGTGGTCCCTTTTCTCAAGG + Intronic
931184138 2:59933298-59933320 GAATGGGCTCCCATTTCTCTGGG + Intergenic
940266873 2:151848124-151848146 GCATGGGATACCTTTTCTGTAGG - Intronic
942142308 2:172989583-172989605 GCATGCGGTCCCTTGTCCCTGGG + Intronic
942235867 2:173904289-173904311 GGTTGGGGACCCTTTTCTATAGG + Intergenic
943536937 2:189164169-189164191 GCATGGTATCCCTTTTCTCTGGG - Intronic
946342061 2:219076455-219076477 ACTTGGGTTCCCTTTTTTCTAGG - Exonic
948239035 2:236413289-236413311 CCATGGGGTCCCTGTTCCCTAGG + Intronic
948350407 2:237335619-237335641 GCTTAGGGCCCCTTTTCTGTGGG + Intronic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1172170071 20:32924906-32924928 GAGCAGGGTCCCTTCTCTCTGGG + Intronic
1173215438 20:41077654-41077676 GCGTGGGCTTCCCTTTCTCTGGG + Intronic
1175831209 20:61966231-61966253 GTGTGGGGACCCTTCCCTCTGGG + Intronic
1185137422 22:49080703-49080725 CCGTGGGTTCCCTTGGCTCTTGG - Intergenic
949203076 3:1404321-1404343 GTGTGGGTTGACTTTTCTCTAGG + Intergenic
949320963 3:2809962-2809984 GCTTGGCTGCCCTTTTCTCTGGG - Intronic
950708688 3:14800111-14800133 GCGTGGGGTGACTTTTCCCTTGG - Intergenic
954411093 3:50371487-50371509 GGGAGGGGTCCCTCTGCTCTTGG + Intronic
964632384 3:158825754-158825776 GGGTCGGCTCCCTTTTTTCTAGG + Intronic
969244228 4:5922160-5922182 GCATGTGGTCCCTGTGCTCTGGG - Intronic
972313034 4:37899120-37899142 GGATGGGGCACCTTTTCTCTAGG + Intronic
976386615 4:84466855-84466877 TTGTGGAGTCCCTTATCTCTAGG + Intergenic
987315723 5:16721539-16721561 GCGGGGGTTGCCTCTTCTCTAGG - Intronic
988599351 5:32625309-32625331 TCGTGTGGTCCCTTCCCTCTTGG + Intergenic
988659224 5:33246541-33246563 GCCAGGGGTCCCTTTTTACTTGG - Intergenic
996779815 5:127172843-127172865 GGGTGGAGTCGCTTTCCTCTGGG - Intergenic
999872511 5:155766981-155767003 AAGTGGGGTCCCTTTGGTCTGGG - Intergenic
1000020057 5:157310931-157310953 GGGAGTGGTCCTTTTTCTCTTGG + Intronic
1002004867 5:176224088-176224110 GAATTGGGGCCCTTTTCTCTAGG - Intergenic
1002221505 5:177686537-177686559 GAATTGGGGCCCTTTTCTCTAGG + Intergenic
1002345202 5:178543976-178543998 CCCTGGGGTCCCTTTTCTAAGGG + Intronic
1007823562 6:44580150-44580172 GTGTGGGCTCCACTTTCTCTAGG + Intergenic
1018835763 6:167482524-167482546 GACTGGGGTCCCTTTCCTCCTGG + Intergenic
1022399066 7:30018486-30018508 GGCTGGGGTCTCTTTTCTCTGGG + Intronic
1023873963 7:44276893-44276915 GCGTGGGCTCCCCTTTCACATGG - Intronic
1024477477 7:49829069-49829091 GGGTGGTGTCCCTCTTCTATTGG + Intronic
1025736275 7:64149849-64149871 TCTTGGTGGCCCTTTTCTCTGGG + Intronic
1025765565 7:64443990-64444012 TCTTGGTGGCCCTTTTCTCTGGG + Intergenic
1026398960 7:69989715-69989737 GCGGGGGGTCCCTGTTCTCTAGG - Intronic
1029736963 7:102470344-102470366 GCAAGGGGTCCCTGTCCTCTTGG + Intronic
1031661977 7:124436659-124436681 ACGTGGGGCCTCTTTTTTCTAGG + Intergenic
1037669756 8:21004243-21004265 TCATGGGGTCCCTTTTAGCTGGG - Intergenic
1041265519 8:56060588-56060610 GCCAGGGATCCATTTTCTCTGGG - Intergenic
1043310082 8:78847954-78847976 GGGGGGGGTCTTTTTTCTCTTGG + Intergenic
1045999803 8:108406034-108406056 GCGTGGGTCCCCTTTTATGTGGG - Intronic
1049250189 8:141584071-141584093 CCCTGGGGTCCCTTTTATCAGGG - Intergenic
1051359702 9:16270979-16271001 TCGTGGGCTCCCTTTTCTGAGGG - Intronic
1057697355 9:97334187-97334209 TTGTGGAGTCCCTTATCTCTAGG - Intronic
1060556980 9:124513006-124513028 GCCTGGGGTAGCTTATCTCTCGG + Intergenic
1185636199 X:1553946-1553968 GCCTGGGGTCCCTTTTATAAGGG - Intergenic
1185642914 X:1598324-1598346 GCGTGGGATGCCTTTTCTCCCGG + Intronic
1185671040 X:1810368-1810390 CTCTGGGGTCCCTTTTCTCAGGG - Intergenic
1186573301 X:10738472-10738494 GTCTGGGGTCTTTTTTCTCTAGG + Intronic
1191078583 X:56484524-56484546 GCTTGGGGTTTGTTTTCTCTTGG + Intergenic
1191610840 X:63111247-63111269 GCTTGGGGTTAGTTTTCTCTTGG - Intergenic
1194689945 X:96972045-96972067 GCCTGGGTTTTCTTTTCTCTAGG + Intronic