ID: 1084685756

View in Genome Browser
Species Human (GRCh38)
Location 11:70694195-70694217
Sequence GTCAAACAGCAGAGGCCCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084685756_1084685761 24 Left 1084685756 11:70694195-70694217 CCTTAGGGCCTCTGCTGTTTGAC 0: 1
1: 0
2: 0
3: 6
4: 148
Right 1084685761 11:70694242-70694264 ATCCTTCTCTCACTGTTTTCCGG 0: 1
1: 0
2: 2
3: 50
4: 633
1084685756_1084685758 -9 Left 1084685756 11:70694195-70694217 CCTTAGGGCCTCTGCTGTTTGAC 0: 1
1: 0
2: 0
3: 6
4: 148
Right 1084685758 11:70694209-70694231 CTGTTTGACCTTAATTAATGTGG 0: 1
1: 0
2: 1
3: 17
4: 133
1084685756_1084685762 25 Left 1084685756 11:70694195-70694217 CCTTAGGGCCTCTGCTGTTTGAC 0: 1
1: 0
2: 0
3: 6
4: 148
Right 1084685762 11:70694243-70694265 TCCTTCTCTCACTGTTTTCCGGG 0: 1
1: 0
2: 4
3: 45
4: 523

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084685756 Original CRISPR GTCAAACAGCAGAGGCCCTA AGG (reversed) Intronic
901648069 1:10727261-10727283 CTCAAACAGCAGGTGCCTTATGG - Intronic
902039884 1:13484937-13484959 GTCTAACTGCATAGGCACTAGGG - Intronic
902040096 1:13486227-13486249 GACACAGAGCAGAGGCCGTATGG - Intronic
902138547 1:14332446-14332468 GTCAAACATCAGAGCCTCTGAGG - Intergenic
902641983 1:17772723-17772745 GTCAAATGGCAGAGGCTCCAGGG - Intronic
902957589 1:19936360-19936382 GTCAGTCAGCAAAGGACCTAAGG - Intergenic
902984679 1:20148396-20148418 CTCAAACCTCAGAGGCTCTAGGG - Exonic
904886206 1:33740457-33740479 CAGAAACAGCAGTGGCCCTAGGG + Intronic
905121904 1:35688845-35688867 GTCAGGCAGCAGAGGGCCAAGGG + Intergenic
905144695 1:35879021-35879043 CCCACACAGCAGAGGCCCTTAGG + Intronic
907954473 1:59215069-59215091 GCCCAACGGCAGAGGCCCAAGGG - Intergenic
910206867 1:84756867-84756889 GTCAAATACCAAAGGCCCCAGGG + Intergenic
912551096 1:110485837-110485859 GCCAGACAGCAGAGGCCTCAGGG + Intergenic
913990524 1:143607680-143607702 GTCACACAGCAGAAGCCACATGG - Intergenic
914951913 1:152123300-152123322 GTCAAAGGGCAGAGGCCACAGGG + Intergenic
917628145 1:176866385-176866407 GCCAAACTGCAGAGGCTCTTAGG - Intronic
920138421 1:203789587-203789609 GTCAGACAGCTGAGACCCAAAGG + Intergenic
922271414 1:224038949-224038971 GTCAAACAGAAGAGACTTTAGGG + Intergenic
1065714963 10:28557567-28557589 CTCAAACAGCTGAGACCATAGGG - Intronic
1067568296 10:47353611-47353633 GTGACACAGCAGAGGACCTGAGG + Intronic
1067665925 10:48279206-48279228 GTCAAAGAGCAGAAGACCAATGG + Intergenic
1069222989 10:65906930-65906952 GACCCACAGCAGAGGCCCTGAGG + Intergenic
1069667623 10:70174075-70174097 GGCTGACAGCAGAGGCCCTAAGG + Intergenic
1069745341 10:70711507-70711529 ATGAAAAAGCAGAGGCTCTAAGG - Intronic
1071287059 10:84158737-84158759 GTCACACAGCAGAGTCCTGAAGG - Intergenic
1072459400 10:95605495-95605517 GTCAGGCACCAGGGGCCCTAAGG + Intergenic
1073435690 10:103514451-103514473 GTCAGAGAGCAGAGGCCTCAAGG - Intronic
1073748838 10:106500827-106500849 GTCAAACTTCAGGGGGCCTAAGG + Intergenic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1076608342 10:131703880-131703902 GTCAAAGAGCAGAGGCACCTGGG - Intergenic
1076689347 10:132213353-132213375 GTCACACTGCGGAGGCCCTGTGG - Intronic
1082664121 11:55952179-55952201 GTCAGGCAGGAGAGGTCCTAAGG - Intergenic
1083683731 11:64363422-64363444 GTCATACAGGAGAGGCCCCAAGG + Intronic
1084685756 11:70694195-70694217 GTCAAACAGCAGAGGCCCTAAGG - Intronic
1091206251 11:133823298-133823320 CTCACAAAGCAGAGGCCCCAGGG + Intergenic
1092645536 12:10567453-10567475 GTCCAACAGTAGTGGCACTAGGG + Intergenic
1093091638 12:14928107-14928129 GTCCAAGAGCAGATGGCCTAAGG - Intronic
1095320288 12:40818939-40818961 GGCAAACTGCAGCAGCCCTATGG - Intronic
1096583387 12:52602713-52602735 GTGAAACAGCAGAGTGCTTAGGG + Intergenic
1096824111 12:54261247-54261269 GTCAAACAGAAGAAACCATAGGG + Intronic
1100115201 12:91295110-91295132 AGCAAACTGCAGTGGCCCTACGG + Intergenic
1102964973 12:117118867-117118889 GACAAAGAGCAGAGGCCCACAGG - Intergenic
1110089836 13:71431753-71431775 GTGAAACAGCACAGCCCCTCTGG + Intergenic
1110472667 13:75877364-75877386 GGCAAACAGTAGAGGCCGGATGG - Intronic
1113483021 13:110635461-110635483 GTCATAGCTCAGAGGCCCTATGG + Exonic
1116860742 14:49993774-49993796 GTCAATCTGCAGAGCCCCAAGGG + Intronic
1119613161 14:76080676-76080698 GTAAGACTGCACAGGCCCTATGG - Intronic
1119760252 14:77145894-77145916 GACAAACAGCAGAGTGCCTGAGG - Intronic
1125363581 15:38889950-38889972 GTCAAACAGAGGTGGACCTACGG - Intergenic
1127377359 15:58397509-58397531 GACACACTGCAGAGGCCCTCGGG - Intronic
1128792584 15:70444122-70444144 TTCAAACTGCAGAAGCCCTGAGG - Intergenic
1128944965 15:71813785-71813807 GTCAACCAGGAGTGGCCCCAAGG - Intronic
1130231959 15:82103983-82104005 GACAAACAGAGGAGGCCCTAAGG - Intergenic
1130555983 15:84922808-84922830 AGCGAATAGCAGAGGCCCTAAGG - Intronic
1135118947 16:19748629-19748651 GTCAACCAGAAGAGGCCATGGGG - Intronic
1141888585 16:86910686-86910708 GACAAACAGCAGTGGCCCGCAGG + Intergenic
1143261047 17:5598423-5598445 GTCAAACCGCATTGGCCCTGCGG - Intronic
1144916321 17:18726388-18726410 GTCAAACAGCAGATATCCTTGGG - Intronic
1147376825 17:40027431-40027453 GTCAAACAGCAGGGCCCGGACGG + Exonic
1148789696 17:50166321-50166343 GTCTGACAGCACAGGCCCAAAGG + Intronic
1152133617 17:78491682-78491704 GAGGAACAGCAGAGGCCCTCGGG + Intronic
1152261559 17:79269972-79269994 GAGAAGCAGCAGAGGCCCTGAGG - Intronic
1154385884 18:13891508-13891530 GTCAACCAGGATAGCCCCTATGG - Intronic
1155487792 18:26365522-26365544 GTCAACCACCAGAGTTCCTACGG - Intronic
1155847904 18:30731812-30731834 AGCAAACAGCAGCAGCCCTACGG + Intergenic
1155978013 18:32152816-32152838 GTTACAGAGCAGAGGTCCTAGGG + Intronic
1156016332 18:32551139-32551161 GTCAACCAGCAGGGGCGCAAAGG - Intergenic
1156295042 18:35781843-35781865 GTCAATCAGCAGGGCCCCTGTGG + Intergenic
1158519394 18:58158627-58158649 GTCAACAAGCAGACACCCTAAGG - Intronic
1165748419 19:38245034-38245056 GTCAGACAGCAGAGGGCTGAAGG + Intronic
1166636700 19:44457406-44457428 GGCACACAGGAGAGTCCCTAAGG + Intergenic
1167526853 19:49989527-49989549 GCCAGACAGGAGAGGCACTAAGG - Intronic
931754632 2:65361887-65361909 GTCAAACAGCAGAGCCCCACAGG + Intronic
932449896 2:71802693-71802715 GTCAGACAGGGAAGGCCCTAGGG - Intergenic
935429489 2:102959736-102959758 GTCAAACATTAGAGGCAATATGG - Intergenic
941391178 2:164916818-164916840 GATGAACAGCAGAGGCTCTAAGG + Intronic
943574021 2:189609650-189609672 GTCAAATATCAGAGCCCGTATGG - Intergenic
948822013 2:240554812-240554834 GCCAGCCACCAGAGGCCCTAGGG + Intronic
1175865594 20:62174612-62174634 GCCCAGCAGCAGCGGCCCTACGG + Exonic
1177414800 21:20779996-20780018 TGCACACATCAGAGGCCCTATGG - Intergenic
1178550700 21:33536358-33536380 GTGAAGCAGGAGAGCCCCTATGG - Intronic
1180160745 21:45997769-45997791 GTCCAACAGCTCGGGCCCTAGGG + Intronic
1181557983 22:23683114-23683136 GTCAAACAGCAGTTTCCCTGGGG - Intergenic
1183281958 22:36936918-36936940 GTCACACTGCAGAGGCCTCATGG + Intronic
1185134706 22:49063070-49063092 GGCACACAGGAGAGGCCCTTCGG + Intergenic
952719988 3:36522650-36522672 TTCAGAAAGCAAAGGCCCTAGGG + Intronic
952838951 3:37628177-37628199 CTCAAACAGCCGAGTCCCTGGGG - Intronic
956203924 3:66736675-66736697 GTCACATAGCAGAGGCAGTAGGG - Intergenic
956556045 3:70524226-70524248 TACAATCAGCAGAAGCCCTATGG - Intergenic
961518104 3:127451004-127451026 GTCAGACAGCACAGTCCCTCAGG + Intergenic
963731123 3:148973648-148973670 GACAAACAGCAAAGGCTCCAAGG + Intergenic
965943050 3:174208742-174208764 TTCAATCAGCAAAGGCCCAAAGG + Intronic
967299710 3:188000767-188000789 GTCAAAGTGCAGAGGCAGTAGGG + Intergenic
968504265 4:964683-964705 GGCAGAGAGCAGAGGCCCTAAGG + Intronic
970437720 4:16051665-16051687 GCCCAACAGCAGAGCCACTAAGG + Intronic
971574353 4:28254384-28254406 AGCAAACTGCAGAAGCCCTATGG + Intergenic
984321399 4:178201633-178201655 GTGAAAAAGCAGAGGTCATAAGG - Intergenic
992171358 5:74105236-74105258 GACAGGCAGCAGAGGCCCTTTGG - Intergenic
992858245 5:80886227-80886249 GTCGTACAGCAGAGACCATATGG + Intergenic
993837553 5:92834592-92834614 AGCAAACAGCAGCAGCCCTAGGG - Intergenic
994029649 5:95127426-95127448 GTCCAACAGCAGAAGGACTAAGG - Intronic
995574928 5:113519631-113519653 GTCCAACAACAGAGGTCCCATGG + Intronic
995878337 5:116816293-116816315 GTCAATCAGCTGAGGCTGTATGG + Intergenic
1000409338 5:160921778-160921800 GGCACACAGCAGAGGGCCAAGGG - Intergenic
1001850230 5:174957405-174957427 GGCAAAAAGCAGAGGGCCTTGGG - Intergenic
1002103910 5:176870550-176870572 GGCAAACAGAAGAGGACCTCAGG - Intronic
1002895241 6:1375461-1375483 GTCAAACTGCATTGGCCTTAGGG + Intergenic
1003902465 6:10667958-10667980 AGCAAACCGCAGAAGCCCTATGG - Intergenic
1004015118 6:11725154-11725176 GTGAAGCAAGAGAGGCCCTAGGG + Intronic
1004322122 6:14640090-14640112 GTCAAAAAGCTGAGGCCACAGGG + Intergenic
1006810473 6:36817351-36817373 GTGAAACAGCATGTGCCCTAGGG + Intronic
1007515087 6:42404585-42404607 GTGAATCACCAGAGGCCCTCAGG - Intronic
1007841057 6:44715988-44716010 GACAAGCAGCAGAGGCCTTGGGG - Intergenic
1009866671 6:69406595-69406617 GTGAAGCAGCACTGGCCCTATGG - Intergenic
1019355487 7:576703-576725 GAGAAACAGCAGAGGCCAGAGGG - Intronic
1019514248 7:1432803-1432825 CTAACACAGCAGAGGCCCTGGGG + Intronic
1020017910 7:4842253-4842275 CTCTCACAGCAGAGGCCGTAAGG + Intronic
1023053334 7:36272356-36272378 GTGAAAGTGCAGAGTCCCTAAGG + Intronic
1024042545 7:45566561-45566583 GAGAAACAGCAGCTGCCCTAGGG - Intergenic
1024345716 7:48310910-48310932 TTCAAACAGTAGAGGCCAGAAGG - Intronic
1024345723 7:48310963-48310985 TTCAAACAGTAGAGGCCAGAAGG - Intronic
1026231901 7:68491138-68491160 GCCACACAGCAGAGGCCCTTTGG + Intergenic
1027339375 7:77189685-77189707 GTGAAACAGCAGAGGGTCTGGGG - Intronic
1027712533 7:81623627-81623649 GGAAGACAGCAGAGGCCCTTGGG - Intergenic
1032496850 7:132369133-132369155 GTCAAATGGCAGAGGCGTTAGGG - Intronic
1035324219 7:158054612-158054634 GGCAACCAGGAGAGGCCCTTTGG + Intronic
1035658473 8:1329715-1329737 TTCTAACAGCAGAGACCCTGGGG + Intergenic
1035878127 8:3213476-3213498 GTCAGACAGCAGCTGCCCTGTGG - Intronic
1041239340 8:55835909-55835931 GACAAACATGAGAGGCCCCAGGG + Intergenic
1041746487 8:61213268-61213290 GTCAAAGAGCAGAGGCTCCCTGG - Intronic
1044018265 8:87073557-87073579 AGCAAACAGCAGCAGCCCTATGG - Intronic
1048343805 8:133561211-133561233 GTCAAGCAACAGAGGCCAGAGGG - Intronic
1048737738 8:137520261-137520283 GAAAAACAGCAGAGGGCATAGGG - Intergenic
1052977718 9:34423801-34423823 GTCAAACCGCTGGGGCACTAAGG + Intronic
1053530794 9:38879043-38879065 GTCCACCAGCACAGGACCTATGG - Intergenic
1053721286 9:40949610-40949632 GTCAAAGAGCTGAGATCCTAAGG - Intergenic
1054203017 9:62103476-62103498 GTCCACCAGCACAGGACCTATGG - Intergenic
1054344706 9:63902558-63902580 GTCAAAGAGCTGAGATCCTAAGG + Intergenic
1054635346 9:67484889-67484911 GTCCACCAGCACAGGACCTATGG + Intergenic
1055311352 9:74984994-74985016 GTGGTACAGCAGAGGACCTATGG + Exonic
1057810499 9:98253518-98253540 GTTGAAGAGCAGAGGCCCGAGGG - Intronic
1060772329 9:126341591-126341613 GTCCAGCAGAAGAAGCCCTAAGG + Intronic
1060806760 9:126582572-126582594 GGCAAATCGCATAGGCCCTAGGG - Intergenic
1061707552 9:132464428-132464450 GTGGAACAGCACAGGCCCAAAGG + Intronic
1061729295 9:132601127-132601149 GTCAAACAGGACAGGCCCAGAGG - Intronic
1062292289 9:135801655-135801677 GCCAAACAGCAGAGGAAGTATGG + Intergenic
1185854774 X:3523953-3523975 GGAAAACAGCAGAGGGACTAAGG - Intergenic
1187408213 X:19023415-19023437 GTGCTACAGCAGAGGCCCAAAGG - Exonic
1190823171 X:53993482-53993504 GCCAAACAGCAGGGGGTCTAAGG + Intronic
1191845608 X:65545420-65545442 GTCAACTAGCAAAGGCCCAAGGG - Intergenic
1192639015 X:72845879-72845901 GCCAAGCAGCAGAGCCCCTTGGG - Exonic
1192642697 X:72874929-72874951 GCCAAGCAGCAGAGCCCCTTGGG + Exonic
1194263899 X:91733052-91733074 AGCAAACTGCAGAAGCCCTATGG - Intergenic
1199182403 X:144873602-144873624 GGCAAGCTGCAGATGCCCTAAGG - Intergenic
1199420643 X:147640256-147640278 GTAAAATAGTAGAGCCCCTATGG + Intergenic