ID: 1084685804

View in Genome Browser
Species Human (GRCh38)
Location 11:70694529-70694551
Sequence AATTATCCACAGTAGGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084685804_1084685813 5 Left 1084685804 11:70694529-70694551 CCCACAGCCTACTGTGGATAATT 0: 1
1: 0
2: 0
3: 10
4: 122
Right 1084685813 11:70694557-70694579 ACAGGGCTGGCACTGCACCCAGG 0: 1
1: 0
2: 3
3: 34
4: 334
1084685804_1084685810 -8 Left 1084685804 11:70694529-70694551 CCCACAGCCTACTGTGGATAATT 0: 1
1: 0
2: 0
3: 10
4: 122
Right 1084685810 11:70694544-70694566 GGATAATTGGCCCACAGGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084685804 Original CRISPR AATTATCCACAGTAGGCTGT GGG (reversed) Intronic
900119631 1:1042968-1042990 GATTGTCCACAGCAGGCTATGGG - Intronic
902376242 1:16031323-16031345 AATTATCCAGGGAAGGCTGCTGG + Intronic
902948429 1:19861107-19861129 AAATATGCAAAGTAGACTGTGGG - Intergenic
903259203 1:22122214-22122236 AATTAGCCACAGTAGGGGTTGGG - Intronic
906560751 1:46755154-46755176 AATGATCAAGAGAAGGCTGTGGG + Intergenic
910388230 1:86707435-86707457 AATTATCCAGTATTGGCTGTTGG + Intronic
913138409 1:115915272-115915294 GAGTTTCCACAGTGGGCTGTTGG - Intergenic
917631965 1:176899186-176899208 ACTCATCCACTGTATGCTGTAGG - Intronic
917700738 1:177578327-177578349 AATGATCCACTGTAGTCTGGAGG - Intergenic
919501923 1:198347992-198348014 AGTTATCCACAACAGACTGTGGG - Intergenic
919515499 1:198517176-198517198 AAGTTCCCACAATAGGCTGTCGG + Intergenic
920119058 1:203642055-203642077 AACAAAACACAGTAGGCTGTGGG - Intronic
922536958 1:226388443-226388465 GAGAATCCACATTAGGCTGTAGG - Intronic
924729510 1:246698571-246698593 AATGAAACACAGAAGGCTGTGGG - Intergenic
924848465 1:247798046-247798068 AATTATGCCCAGTGGGGTGTGGG + Intergenic
1063259918 10:4376388-4376410 AATTAGACACAGTTGGTTGTTGG + Intergenic
1067983613 10:51116211-51116233 CATTATCCACGGTAGACTGGCGG + Intronic
1068392569 10:56417144-56417166 AGTTATACAGAGGAGGCTGTGGG + Intergenic
1068590978 10:58852792-58852814 CATTTTCCACAGCAGGCTGGAGG - Intergenic
1068943119 10:62701043-62701065 AACTGTCCATAGTAAGCTGTGGG - Intergenic
1069018504 10:63459862-63459884 AAAAATCCACAGTAGTATGTAGG + Intronic
1072181543 10:92986437-92986459 AATTAACCCTAGTAGGCAGTGGG - Intronic
1073852465 10:107636794-107636816 AGGAATCCAGAGTAGGCTGTGGG + Intergenic
1076883500 10:133251081-133251103 AAGGAGCCACAGAAGGCTGTGGG + Intergenic
1078040223 11:7854599-7854621 ATTTATCAAAAGAAGGCTGTCGG + Intergenic
1079201809 11:18383251-18383273 GATTCTTCACGGTAGGCTGTGGG - Intergenic
1080220597 11:29898844-29898866 TATTAGCCACAGTGGGCTGCTGG - Intergenic
1080408680 11:32002870-32002892 AATTTTCCACAGTGGACTTTTGG + Intronic
1081561953 11:44225927-44225949 TATTATCCACAGAAGGCTCATGG + Intronic
1084573209 11:69972251-69972273 CATTTTCAACAGTAGCCTGTTGG - Intergenic
1084685804 11:70694529-70694551 AATTATCCACAGTAGGCTGTGGG - Intronic
1092620405 12:10259177-10259199 AATTTTACACTGAAGGCTGTGGG - Intergenic
1099882821 12:88489300-88489322 AATTTTCCACAATGGGCTGCCGG + Intergenic
1101321252 12:103674980-103675002 AATCATCCACAGAGGACTGTCGG + Intronic
1104442265 12:128803426-128803448 TATTATTCACAGTAAGCTGGGGG + Intronic
1105778232 13:23682372-23682394 ACTTATCCAAAGTTAGCTGTTGG - Intergenic
1107048903 13:36026375-36026397 AATTGTTGACAGTTGGCTGTGGG - Intronic
1111026559 13:82535805-82535827 AATTATCCAATGGAGGCTGTTGG - Intergenic
1111745278 13:92260262-92260284 ATTTATCCACATTAGGTTTTTGG - Intronic
1112670837 13:101636234-101636256 AAGTGTCTGCAGTAGGCTGTTGG - Intronic
1113050418 13:106205408-106205430 AATGATCCACAGTAGAGTGCAGG - Intergenic
1113266873 13:108629127-108629149 AATTATCCACAAAAAGCTTTTGG - Intronic
1116138423 14:40957577-40957599 AATTATCCACTGTGTGTTGTTGG - Intergenic
1123810086 15:23916072-23916094 AATTATCCCCAGTTGACTGATGG + Intergenic
1124991055 15:34674197-34674219 AAATATGCACAGGTGGCTGTGGG - Intergenic
1128846497 15:70901873-70901895 AACTATCCACAGTAGCATGGTGG + Intronic
1129944256 15:79525150-79525172 AATTAGCCACATGAGGCTGGTGG - Intergenic
1137618571 16:49860741-49860763 AATTCTCCACAGTAGGGACTGGG - Intergenic
1142518080 17:446334-446356 CATTGCCCACAGAAGGCTGTGGG + Intergenic
1142693843 17:1622576-1622598 AACTATCCACACTTGCCTGTGGG + Intronic
1145224731 17:21118597-21118619 ATTTTTCCACAGGAAGCTGTTGG - Intergenic
1146215311 17:30974431-30974453 ATTTCTACAAAGTAGGCTGTTGG + Intronic
1148244252 17:46020225-46020247 AAGTATCCACATGAGGCTGCTGG + Intronic
1148851395 17:50557201-50557223 ATTTATCCATAGGAGGCTGAAGG - Intergenic
1149406470 17:56356957-56356979 AATTATGCACAGGGGGCTTTGGG - Intronic
1150496270 17:65610212-65610234 AATACTCCACAGTAAGCTGTGGG + Intronic
1153363407 18:4224867-4224889 AAGTATTTACAGTAGGCTTTTGG + Intronic
1153936823 18:9934162-9934184 AATTAACCAGAGAAGGTTGTTGG - Intronic
1154428181 18:14288266-14288288 AATTATGGACAGGAGGTTGTTGG + Intergenic
1156414262 18:36871159-36871181 AGTTATCCACAGTGCACTGTAGG - Intronic
1156538159 18:37883796-37883818 AATTATTCACAGTAGGGTAAAGG + Intergenic
1163383241 19:16982507-16982529 AATTTTCCAAATTTGGCTGTGGG - Intronic
1164785807 19:30929704-30929726 AGTAATTCACAGTAGGATGTTGG - Intergenic
1165335376 19:35166175-35166197 AGTTATCCACAGGAAGATGTGGG + Intronic
925984408 2:9204455-9204477 AATTACCCCCAGTAGGGTCTGGG + Intergenic
928369628 2:30731675-30731697 ATCCATCCACACTAGGCTGTGGG + Intronic
928648870 2:33384169-33384191 AATTATCCCCTGGAGCCTGTGGG - Intronic
928687753 2:33766792-33766814 GATTATCTACAGTAGGATGAAGG - Intergenic
929769334 2:44878876-44878898 AATTATCCAAAGAAGGCCGCAGG + Intergenic
930301661 2:49623286-49623308 AAATATACCCAGTAGACTGTAGG - Intergenic
944344368 2:198643388-198643410 AATTCTCCAGAGTAGGCAGAAGG - Intergenic
947131814 2:226934824-226934846 AATTATGCACAGAGGGATGTGGG - Intronic
948345528 2:237294186-237294208 CATTGGCCTCAGTAGGCTGTTGG - Intergenic
1173556531 20:43969993-43970015 AATTATCCACAGAGAGCAGTGGG - Intronic
1173682576 20:44895967-44895989 AATTATGTACAGGATGCTGTGGG + Intronic
1174221106 20:48956307-48956329 AATTATCCTAGGAAGGCTGTGGG - Intronic
1175497064 20:59422642-59422664 AATAATCCACAGTACTTTGTTGG + Intergenic
1177344299 21:19849715-19849737 AATAATCCACAGTATGCTGAGGG - Intergenic
1179031573 21:37724791-37724813 CATTATTCACTGCAGGCTGTGGG + Intronic
1179406903 21:41133731-41133753 AAATATCCACAATATGCTGTGGG + Intergenic
1181686503 22:24532812-24532834 AAATCTCCACAGTTGTCTGTGGG + Intergenic
949409537 3:3748899-3748921 AATTATGCACAGAGGGCTATGGG + Intronic
949490886 3:4587684-4587706 AATTACCTCCAGTAGGTTGTTGG - Intronic
951600693 3:24371573-24371595 ACTCATCCACACTAGGATGTGGG - Intronic
951937489 3:28037864-28037886 GAGTATCAACAGTAGGCTGCTGG + Intergenic
955071408 3:55575380-55575402 ATTTATCCACTGTATTCTGTTGG - Intronic
955887285 3:63614043-63614065 GATGATCCACAGTGGCCTGTGGG - Intronic
958705435 3:97648375-97648397 AATTATCTCCAGTTGGGTGTAGG - Intronic
960181093 3:114579910-114579932 AATTTTCATCAGTAGGTTGTAGG - Intronic
961039364 3:123666414-123666436 CATTGTCCACAGTGGTCTGTTGG + Intronic
965737651 3:171838570-171838592 CAATATCCACAGTAGCCTGTGGG + Intergenic
966865856 3:184258946-184258968 ATTTATCCACAGGAGACTGCAGG + Intronic
971194964 4:24464129-24464151 AATTGTTCACAGTTGGCTGTAGG - Intergenic
973801018 4:54478616-54478638 AATTATCCCCAAAATGCTGTAGG + Intergenic
978583907 4:110257999-110258021 AATTATTCAAAGTAGCCAGTTGG - Intergenic
981390492 4:144184353-144184375 CATTATCCACAATAAGCTGCAGG - Intergenic
981778043 4:148393257-148393279 AATGATTCACACTAGTCTGTGGG + Intronic
982223639 4:153145847-153145869 AATTATCTTCTGGAGGCTGTAGG - Intergenic
983397218 4:167214869-167214891 AAATGTCAACAGTAGGCTGCTGG - Intronic
983453865 4:167938499-167938521 AATTATATACAATAGTCTGTAGG + Intergenic
986785868 5:11113334-11113356 AATTATGCACAACCGGCTGTGGG - Intronic
990374766 5:55158496-55158518 AGTTTTACACAGTAGGCTATGGG + Intronic
990441759 5:55853431-55853453 ATTTATCCACACTAAGATGTGGG - Intronic
992386550 5:76290240-76290262 AATTATACCAAGTAGGCAGTAGG - Intronic
995156552 5:108921047-108921069 AATTATCAAAAGAAGGCAGTTGG - Intronic
1000815317 5:165914435-165914457 AATTATGCTGAGAAGGCTGTAGG - Intergenic
1003747057 6:9014147-9014169 AATTACCCACAGAAGTCTGTAGG - Intergenic
1007071712 6:39042988-39043010 AATTCTCCACAGCTGACTGTTGG + Intergenic
1007492170 6:42231699-42231721 AATTCTCTACTGGAGGCTGTGGG + Intronic
1010078092 6:71824838-71824860 ACCTATCCCCCGTAGGCTGTAGG + Intergenic
1012517137 6:100075377-100075399 AGTCATCCACAGTGGACTGTAGG - Intergenic
1012918875 6:105200303-105200325 ATTTATGGACAGTAAGCTGTGGG + Intergenic
1014080823 6:117284003-117284025 AATTATTCACAGTAGTGTTTGGG + Intergenic
1028424362 7:90670022-90670044 ATTTTTCCACAGTAGCCTGTGGG + Intronic
1034460062 7:151193189-151193211 AATCATACCCAGTAGGCTGATGG + Intronic
1037067533 8:14600570-14600592 AATTCTCCACAGGAGGATGCAGG + Intronic
1037438616 8:18891057-18891079 CATTATCCATAGTAAGCTCTGGG - Intronic
1041664136 8:60426093-60426115 AATAACCCACAGTAGGCTGGTGG + Intergenic
1044294340 8:90510309-90510331 AATTTTACACAGAAGGCAGTCGG - Intergenic
1046084860 8:109420194-109420216 AACTAACCACAGAAGGCTGCAGG + Intronic
1047868524 8:129056491-129056513 AAATATCCACATTTGGCTTTTGG - Intergenic
1051834130 9:21315866-21315888 AATCAACCACAGTAGGCAGCTGG - Intergenic
1051954407 9:22673334-22673356 ATTTTTCCACAGGAGGCTGCAGG - Intergenic
1055566978 9:77579302-77579324 ATTTATTCCCAGTAGCCTGTGGG - Intronic
1057329463 9:94099400-94099422 AATAATTCACAGTAGGTTATGGG - Intronic
1188386407 X:29564882-29564904 AGGTATCCACAGGAGGCTGCAGG + Intronic
1188536711 X:31204595-31204617 AACTATGCACAGTATCCTGTGGG - Intronic
1189065326 X:37802104-37802126 AATAACCCACAGTAGGGTTTTGG - Intronic
1189179476 X:38989650-38989672 ATTTATCCACAGTCTCCTGTTGG + Intergenic
1189357565 X:40322948-40322970 AATTACCCACAGATGGCTGTGGG + Intergenic
1192221139 X:69198022-69198044 AATTATCCCCAGTAGCCAGATGG + Intergenic
1193629959 X:83872557-83872579 AAATACCAACAGTAGGCTTTTGG - Intronic
1198160831 X:134006380-134006402 CATTATCCACAGTAGCCAGGAGG + Intergenic