ID: 1084686690

View in Genome Browser
Species Human (GRCh38)
Location 11:70700320-70700342
Sequence CCATGACCACCCAGGGAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 1, 2: 2, 3: 22, 4: 237}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084686683_1084686690 1 Left 1084686683 11:70700296-70700318 CCCGAGTATTCAATAGTTTAACT 0: 1
1: 0
2: 0
3: 13
4: 159
Right 1084686690 11:70700320-70700342 CCATGACCACCCAGGGAGTGGGG 0: 1
1: 1
2: 2
3: 22
4: 237
1084686681_1084686690 19 Left 1084686681 11:70700278-70700300 CCCTGCTATAAAGTGTTGCCCGA 0: 1
1: 0
2: 0
3: 2
4: 59
Right 1084686690 11:70700320-70700342 CCATGACCACCCAGGGAGTGGGG 0: 1
1: 1
2: 2
3: 22
4: 237
1084686684_1084686690 0 Left 1084686684 11:70700297-70700319 CCGAGTATTCAATAGTTTAACTG 0: 1
1: 0
2: 2
3: 20
4: 198
Right 1084686690 11:70700320-70700342 CCATGACCACCCAGGGAGTGGGG 0: 1
1: 1
2: 2
3: 22
4: 237
1084686682_1084686690 18 Left 1084686682 11:70700279-70700301 CCTGCTATAAAGTGTTGCCCGAG 0: 1
1: 0
2: 0
3: 2
4: 41
Right 1084686690 11:70700320-70700342 CCATGACCACCCAGGGAGTGGGG 0: 1
1: 1
2: 2
3: 22
4: 237
1084686680_1084686690 24 Left 1084686680 11:70700273-70700295 CCAGGCCCTGCTATAAAGTGTTG 0: 1
1: 0
2: 0
3: 11
4: 133
Right 1084686690 11:70700320-70700342 CCATGACCACCCAGGGAGTGGGG 0: 1
1: 1
2: 2
3: 22
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084686690 Original CRISPR CCATGACCACCCAGGGAGTG GGG Intronic
900113209 1:1018317-1018339 CCATGACCACCCAAGGGCTGAGG - Intergenic
901499664 1:9644025-9644047 CTCTGAGCACCCAGGGAGTGGGG - Intergenic
901583444 1:10265484-10265506 CCTTGACCTCCCAAAGAGTGGGG + Intronic
902113992 1:14106289-14106311 CTATGACCACCTGGGGATTGTGG - Intergenic
902513078 1:16976631-16976653 CCCTGTCAACCCTGGGAGTGGGG - Intronic
902728858 1:18355461-18355483 CCATGGCCACCAAGGGAGGCAGG - Intronic
903289273 1:22297553-22297575 CCATCCCCACCCCGGGAGAGAGG + Intergenic
903368010 1:22816721-22816743 TCATGACCACCCTGGGAGTCAGG - Intronic
903377522 1:22876199-22876221 CCCTGAGCTCCAAGGGAGTGGGG - Intronic
903457816 1:23500222-23500244 CCTTGGCCACCCAGGGAAAGAGG + Intergenic
903833621 1:26189230-26189252 CCATGATCACCCAGGGAAGTGGG - Intronic
903878599 1:26493183-26493205 CCAGGAACAAGCAGGGAGTGTGG - Intergenic
904344669 1:29859969-29859991 CCATAACCACCCTGAGAGGGAGG - Intergenic
904465328 1:30704347-30704369 TCAGAGCCACCCAGGGAGTGGGG - Intergenic
905971384 1:42144959-42144981 CCATCTCCAGCCAGGAAGTGGGG - Intergenic
907420252 1:54342371-54342393 CCATCTCCTCCCAGGGAGGGAGG - Intronic
908064630 1:60389455-60389477 CAATGACCAGCCAGGCTGTGTGG - Intergenic
910440745 1:87248998-87249020 CCATCAGGCCCCAGGGAGTGAGG + Intergenic
910553471 1:88502860-88502882 CAAGGTCCACCCAGAGAGTGAGG + Intergenic
911786973 1:101963197-101963219 CCATTGCCACCCATGGTGTGTGG + Intronic
912797474 1:112701618-112701640 CCAAGACCAAGGAGGGAGTGCGG - Exonic
916470565 1:165118735-165118757 ACATGACAACCCAGGGTGGGAGG + Intergenic
918059070 1:181046184-181046206 CCATGACCACCCAAGGGCTGAGG + Intronic
918186021 1:182128572-182128594 CCATAGCCACCCAGGGAGGCAGG - Intergenic
920381379 1:205536445-205536467 GCATGGCCACACAGGGAGTAAGG + Intergenic
920914844 1:210251522-210251544 CCCTCGCCAGCCAGGGAGTGGGG - Intergenic
921096319 1:211889765-211889787 CCATGACCGCCCAAGGGCTGAGG + Intergenic
924117585 1:240762843-240762865 CCATCACCACCCAAGGGCTGAGG + Intergenic
924740213 1:246790474-246790496 CCAAGACCACACAGTGAGTCAGG + Intergenic
1063229475 10:4049988-4050010 CCATGCGCACCCAGGATGTGAGG - Intergenic
1064484933 10:15776617-15776639 ACATGACAACCCATAGAGTGGGG - Intergenic
1066388099 10:34957641-34957663 CCACCACCATCCAGGGAGTGAGG - Intergenic
1066484299 10:35828557-35828579 CCCTGACAGCCCAGGGAATGTGG - Intergenic
1068218331 10:54011111-54011133 GAATGTCCAGCCAGGGAGTGGGG - Intronic
1070778632 10:79124882-79124904 CCATGAACCTGCAGGGAGTGGGG + Intronic
1071771884 10:88738318-88738340 CCATGATGACCCAAGGAGTTGGG + Intronic
1074715888 10:116218302-116218324 CCCTTACCTACCAGGGAGTGTGG - Intronic
1075558835 10:123453437-123453459 CAGTGAACACCCAGGGAATGAGG - Intergenic
1076123041 10:127951479-127951501 CCATGGCCCCCCAGTTAGTGTGG + Intronic
1077220013 11:1411641-1411663 CCCTGGCCAGCCAGGGAGCGTGG - Intronic
1077433120 11:2525898-2525920 CCATGAGCACCCCAAGAGTGGGG - Intronic
1077815662 11:5683258-5683280 CCATCACCACCCAAGGGCTGAGG + Intronic
1078542574 11:12223609-12223631 CCATGACCACACAGGTAAAGGGG - Intronic
1079312502 11:19378977-19378999 CCAAAACCACACAGGGAGTGAGG - Intronic
1080024606 11:27600283-27600305 CCAAGGCCAGACAGGGAGTGTGG - Intergenic
1080320447 11:31003294-31003316 CTATTTCCACCGAGGGAGTGGGG + Intronic
1080506098 11:32915474-32915496 CCACGACTACCCAGGGCTTGGGG + Intronic
1083295020 11:61710546-61710568 CCACAACCACCCAGGGAGAGGGG - Intronic
1083609757 11:63999251-63999273 CCATCATCGCCCAGGGAGTCAGG - Intronic
1084009633 11:66340320-66340342 CCATCACCACCCTGGGCTTGGGG + Intronic
1084686690 11:70700320-70700342 CCATGACCACCCAGGGAGTGGGG + Intronic
1088120502 11:106363342-106363364 TCATGAGCACTCAGGGAGAGAGG - Intergenic
1089293109 11:117450277-117450299 CCATGCCCAACCAGGCAGGGTGG - Intronic
1089676840 11:120096039-120096061 CCCTGAGCAGCCAGGGAGGGAGG + Intergenic
1090646190 11:128768311-128768333 CCCTGCCCCCCCAGAGAGTGGGG - Intronic
1090733193 11:129589410-129589432 CCATTCCCTCCCAGGGAGGGAGG + Intergenic
1090808265 11:130216383-130216405 CCAGGCCCACCCAGGAAGGGTGG + Intergenic
1095786060 12:46110005-46110027 AAATGTCCACCCAGGGAGTGGGG - Intergenic
1097053500 12:56237277-56237299 CCCCAAACACCCAGGGAGTGAGG - Exonic
1097968390 12:65605927-65605949 CCATGTGAACCCAGGTAGTGTGG + Intergenic
1098482493 12:70982024-70982046 CCATGCCCACCCAGGGTGATTGG - Intergenic
1101089116 12:101266640-101266662 CCAGGGCCACACAGTGAGTGAGG - Intergenic
1102029520 12:109731840-109731862 CCTGGACCATGCAGGGAGTGTGG + Intronic
1104039699 12:125121869-125121891 CCAGGACCCCCCAGGGAGCTTGG - Intronic
1105690928 13:22838394-22838416 CCATGACAACCAGGGGAGGGGGG + Intergenic
1105701478 13:22938633-22938655 CATTGACCACCCAAGGACTGAGG - Intergenic
1106120965 13:26859894-26859916 CCATGACCACACACAGAGGGTGG - Intergenic
1106479118 13:30123706-30123728 ACATGGCCACCCAGGGAGGCAGG - Intergenic
1107003333 13:35577267-35577289 CCATGCCCACCCAGGGAGTCAGG + Intronic
1108178469 13:47818560-47818582 CCATGGCTTCCCTGGGAGTGGGG - Intergenic
1113076216 13:106470311-106470333 CCTTGGCCACCCAGAGAGTGGGG + Intergenic
1113447384 13:110379758-110379780 GCATAGCCACCTAGGGAGTGGGG - Intronic
1114771228 14:25430252-25430274 CCATGACCAGCGTGGGAGTTTGG + Intergenic
1116944564 14:50824300-50824322 CAATGACCTCCCAAAGAGTGGGG - Intronic
1118790941 14:69092247-69092269 CCATGACTACCCAGTTAGAGTGG - Intronic
1118989116 14:70781997-70782019 CTATGACCTCCCAGGGAAGGCGG - Intronic
1119656632 14:76421827-76421849 CCCTCACTACCCAGGGAGGGAGG + Intronic
1122414318 14:101541566-101541588 CCCTGACCACCCAGGAGATGTGG - Intergenic
1122824309 14:104362240-104362262 CCCTGGCCATCCAGGGCGTGTGG + Intergenic
1122923229 14:104888478-104888500 CCATGACCAGGGAGGGAGGGAGG + Intronic
1122957238 14:105076491-105076513 CCATCACCACCCTGGGCATGCGG + Intergenic
1123946191 15:25240065-25240087 CCAAGCCCACACAGGGAGTGTGG - Intergenic
1123947849 15:25247570-25247592 CCATGCCCACACAGGGAGCCTGG - Intergenic
1124205007 15:27710370-27710392 CAATGACCAGCTAGGGAGGGAGG + Intergenic
1127819742 15:62644408-62644430 GAAAGACCACCTAGGGAGTGAGG - Intronic
1129394125 15:75235058-75235080 CCATAACCTCCCAGGCTGTGGGG - Intergenic
1129727176 15:77907305-77907327 CCATGGCCACCCTGGGAGAAAGG - Intergenic
1129775495 15:78233779-78233801 CCCTGTCCATCCAGGGAGTAGGG - Intronic
1130111914 15:80972454-80972476 CCATGACCATCCAGGGAGGGTGG + Intronic
1130132926 15:81158977-81158999 CATTGACCACCCAAGGACTGAGG + Intergenic
1133098237 16:3462353-3462375 CCATGAACACCAAAGGAATGAGG - Intronic
1134135796 16:11675618-11675640 TCATGACCACTCAGGGACTGAGG - Intronic
1135628441 16:24016285-24016307 CCATGACCACCCAGGCCGCTGGG - Intronic
1137580299 16:49629668-49629690 CCATGAGCACCCAGAGAGCCAGG + Intronic
1137701350 16:50500293-50500315 CAGTGACAACCCAGGGAGGGAGG + Intergenic
1138567799 16:57846202-57846224 CCAGCCCCACCCAGGGAGAGGGG - Intronic
1140018828 16:71216864-71216886 CCTTAACCACCCATGGAGTCTGG - Intronic
1141564441 16:84891815-84891837 CCACTATCACCCAGGGTGTGGGG + Intronic
1141881412 16:86862391-86862413 TCATAATTACCCAGGGAGTGAGG + Intergenic
1142525249 17:535711-535733 TAATGAGCACCCAGAGAGTGAGG + Intronic
1143263267 17:5616212-5616234 CCAGGTCCACCCAAGGACTGTGG + Intronic
1144948017 17:18979713-18979735 CCCTGACCACACAGGGCGAGGGG + Intronic
1146278615 17:31530922-31530944 CCAGGACCACCCAGCTAGGGAGG + Intronic
1147200850 17:38799983-38800005 CCATGCCCACCCCGGGGGAGAGG + Intronic
1148067929 17:44886687-44886709 CGATGACCACCCTGGGATGGAGG - Exonic
1150902025 17:69290387-69290409 CCATGACCACACAGCTAGTTAGG - Intronic
1151464175 17:74273945-74273967 CCATCACCACCCAGGGATCAGGG + Intergenic
1151983090 17:77526046-77526068 CCATGACCGCCCAAGGGTTGAGG - Intergenic
1152383601 17:79955271-79955293 CCATGACCACACAGGGCCTGGGG - Intronic
1152860998 17:82697257-82697279 GCGTGAGCACCAAGGGAGTGTGG - Intronic
1153689071 18:7573503-7573525 CCCTGACCACCCAGGGATGCTGG - Intronic
1156315021 18:35961568-35961590 CTATGACCACCCAGGCATGGTGG - Intergenic
1156504281 18:37579307-37579329 CCATTACCAGACAGTGAGTGTGG - Intergenic
1157221741 18:45833046-45833068 CAAAGCCCACCCAGGGAGGGAGG + Intronic
1158251067 18:55488172-55488194 CAATGAAAACCCAGGGAGTAAGG - Intronic
1159390582 18:67787864-67787886 CCATGACCACCCTGGCAGGCAGG + Intergenic
1160200016 18:76788580-76788602 CCATGACCCCCCAAGGGCTGAGG - Intergenic
1160213580 18:76906291-76906313 TTGAGACCACCCAGGGAGTGTGG + Intronic
1160868006 19:1264575-1264597 CCCTGACCCTCCAGGGACTGTGG + Intronic
1161062316 19:2221473-2221495 CCATGACCACCCGGGGACAAAGG - Intronic
1161470240 19:4453592-4453614 CCAGGCCCACCCCGGGAATGAGG - Intronic
1161733072 19:5974075-5974097 TCATGACGACCCCGCGAGTGAGG + Intronic
1162103086 19:8352464-8352486 CCATGAACACCCAGGGTATTAGG - Intronic
1162301677 19:9848310-9848332 CCAGGGCCACACAGGGAGGGGGG + Intronic
1162386829 19:10365047-10365069 CCCTGAACACCCAGCAAGTGGGG + Exonic
1163181664 19:15608651-15608673 CCATGACCACCCAAGGGCTGAGG - Intergenic
1164552414 19:29222492-29222514 CCCTGCCCACCCGGGGAGTGAGG + Intergenic
1165141228 19:33701095-33701117 TCAGGGCCTCCCAGGGAGTGTGG - Intronic
1165667916 19:37649706-37649728 CCTTGACCTCCCAGGGAGCTGGG - Intronic
1166324095 19:42038506-42038528 TCATGGCCACCCAGTGAGAGAGG - Intronic
1166546281 19:43636280-43636302 TCAGGCCCAGCCAGGGAGTGGGG + Intronic
1166943773 19:46384663-46384685 TCAGCACCTCCCAGGGAGTGAGG - Intronic
925832624 2:7910891-7910913 CCCTGACCTCCCAGGCATTGTGG - Intergenic
925910948 2:8573422-8573444 CCAGGGCCACCCAGGTAATGAGG + Intergenic
926153101 2:10435456-10435478 CCTTGAGAAGCCAGGGAGTGGGG + Intergenic
927197563 2:20558825-20558847 CCATGACCACAGAGGGGGTAGGG + Intergenic
927501178 2:23584313-23584335 CCTTAACCGCCCAGGGACTGGGG + Intronic
929743429 2:44629552-44629574 CCTTGACCTCCCAGGTAGCGGGG + Intronic
929819351 2:45260944-45260966 CCTTGACCACCCAAGTAGTTGGG - Intergenic
930071611 2:47370100-47370122 CCCGGACCACACAGGGCGTGTGG + Intronic
930163810 2:48184018-48184040 CCATTCCCACCCTGGGTGTGAGG + Intergenic
931633977 2:64325775-64325797 CCATGCCCACCAAGGCAGTGTGG - Intergenic
933838378 2:86264404-86264426 CCATGCCATCCCAGAGAGTGTGG - Intronic
935422896 2:102888001-102888023 CCATCACCACGCACAGAGTGTGG + Intergenic
935656092 2:105424858-105424880 CCAGGACCTGTCAGGGAGTGGGG + Intronic
937296476 2:120812622-120812644 CCATGACACGCCAGGGTGTGAGG - Intronic
938403951 2:131016875-131016897 CTCTGCCCACCCAGGGAGAGAGG - Intronic
938787001 2:134638996-134639018 ACAAGGCCACCCAGGGAGAGAGG + Intronic
939935889 2:148293203-148293225 CCATAGCCTCCCAGGGAGTTGGG - Intronic
942388196 2:175464011-175464033 CCATTACCACCCAGAGTTTGGGG + Intergenic
945080719 2:206085100-206085122 CCGGGACCCCCCAGGGCGTGGGG - Intronic
946776982 2:223153144-223153166 CCATGACCACACAGCAAGTATGG - Intronic
948639154 2:239362732-239362754 CCTTCACCAAACAGGGAGTGAGG + Intronic
1169316409 20:4594138-4594160 TCAGGAAAACCCAGGGAGTGAGG - Intergenic
1171301557 20:24065433-24065455 CCAAAACCACCAAGGTAGTGAGG - Intergenic
1172623289 20:36333495-36333517 CCATGACCACCCAGGGAGTCAGG - Intronic
1172889564 20:38254387-38254409 CCAGGATCACCCAGAGAGTCAGG - Intronic
1173931427 20:46823383-46823405 ACATCACTACCCTGGGAGTGAGG - Intergenic
1174273865 20:49389305-49389327 ACATGACAACCCAGTGAGGGAGG - Intronic
1175826446 20:61938889-61938911 CCATGGCTGCCCAGGGAGGGCGG + Exonic
1175954192 20:62599896-62599918 CCCTGAACATCCAGGGAATGAGG - Intergenic
1176108196 20:63399291-63399313 CCAGGGCCAGCCAGAGAGTGCGG - Intergenic
1176332421 21:5560629-5560651 CCATCACCACCCAGGCATGGAGG - Intergenic
1176395336 21:6260322-6260344 CCATCACCACCCAGGCATGGAGG + Intergenic
1176441821 21:6728782-6728804 CCATCACCACCCAGGCATGGAGG - Intergenic
1176466083 21:7055851-7055873 CCATCACCACCCAGGCATGGAGG - Intronic
1176489644 21:7437629-7437651 CCATCACCACCCAGGCATGGAGG - Intergenic
1177989644 21:28021707-28021729 CCTTGGCCACCCAGAGTGTGGGG - Intergenic
1178037820 21:28604249-28604271 CCAGGGCCTCTCAGGGAGTGAGG + Intergenic
1178232684 21:30804845-30804867 CCAGGACCTGTCAGGGAGTGGGG + Intergenic
1179801222 21:43812314-43812336 ACGTGACCATCAAGGGAGTGTGG - Intergenic
1179892783 21:44345361-44345383 ACATGGCCTCCCAAGGAGTGAGG + Intergenic
1179912331 21:44456761-44456783 CCCTGACCACGCAGGGGCTGTGG + Exonic
1181459146 22:23076031-23076053 CTATGACCAACCAGGGTGAGAGG - Intronic
1181968210 22:26671335-26671357 CCCCCACCAGCCAGGGAGTGGGG - Intergenic
1183304380 22:37074480-37074502 TTATGAGCACCCAGGAAGTGGGG - Intronic
1183354340 22:37350432-37350454 CTCTGGCCACCCAGGGGGTGAGG + Intergenic
1184383659 22:44162001-44162023 CCATGTCCACCCAGGGGCGGGGG - Intronic
1185282843 22:49983110-49983132 CCCTGGCCACCCAGGTGGTGAGG + Intergenic
950207941 3:11094354-11094376 CCATCACCACCCAAGGGCTGAGG + Intergenic
951703567 3:25521684-25521706 CCATGGCCACCCAGCTAGTTGGG - Intronic
953096333 3:39780093-39780115 CATTGACCACCCAAGGACTGAGG + Intergenic
954213103 3:49109205-49109227 CCATCAGCACCCCGGGGGTGGGG + Intronic
954332314 3:49897613-49897635 CCTTGGGCACCCAGGCAGTGGGG - Exonic
954689203 3:52386870-52386892 CCCTGGCCAGCCAGCGAGTGAGG + Intronic
962319029 3:134375777-134375799 CCCTGTCCACCCAGAGAGTCAGG + Intergenic
963583399 3:147154424-147154446 CAATGACCACCCAAGGGCTGAGG + Intergenic
964974235 3:162600056-162600078 CCATGACCACCCAAGGGCTGAGG + Intergenic
965288104 3:166843167-166843189 CCATAACCACCCAAGGGCTGAGG + Intergenic
969189862 4:5508661-5508683 CCAGGATCACCCAGGCACTGGGG + Intergenic
969362416 4:6673079-6673101 CCATCACCACCCAAGGGCTGAGG + Intergenic
969537608 4:7766349-7766371 CCATTTCCTCCCAGGCAGTGGGG + Intronic
969849028 4:9942341-9942363 CCATGGTTCCCCAGGGAGTGGGG - Intronic
972943416 4:44224857-44224879 CCATGTCCACCCAGCCAATGGGG + Intronic
977033926 4:91925047-91925069 CCATGGGCAGCCATGGAGTGGGG - Intergenic
978758313 4:112327856-112327878 ACATTACCACTCAGGGATTGAGG - Intronic
979822610 4:125192258-125192280 CCATGACCACCCAAGGGCTGAGG + Intergenic
982256032 4:153452492-153452514 CCACGGCCAGCCAGGGTGTGAGG + Intergenic
982868741 4:160550112-160550134 CCATCACCACCCAAGGGCTGAGG - Intergenic
984825610 4:183921548-183921570 CCATGGCAACCCAGTGAATGTGG + Intronic
985828812 5:2213066-2213088 CCATGTCCACCCAGGGCTCGAGG - Intergenic
987129848 5:14850227-14850249 CCTTCCCCACCCAGGCAGTGGGG - Intronic
990667910 5:58094518-58094540 CCATGGCCTCCAAGGGAGAGTGG - Intergenic
992388411 5:76308297-76308319 CCATGATCAGGAAGGGAGTGTGG - Intronic
994121497 5:96118936-96118958 CCAGTACCACAAAGGGAGTGTGG - Intergenic
997578911 5:135005047-135005069 CCAGGACCACACAGGGAGGAGGG + Intronic
997817035 5:137028923-137028945 ACATGACCATCCATGGACTGAGG - Intronic
997891076 5:137677492-137677514 CCATGACCACCTGACGAGTGAGG + Intronic
1000246009 5:159449071-159449093 CCATTACCACCCAAGGAGAGAGG - Intergenic
1000380111 5:160621333-160621355 CCATGATCACCCAGTGTGTAGGG + Intronic
1002297435 5:178239330-178239352 CTCTGTCCACCCAGGTAGTGGGG + Intronic
1006148396 6:31972516-31972538 CCATGGCAACCCCGGGGGTGGGG + Intronic
1006303657 6:33207064-33207086 CCATAAGAACCCAGGGAGTTGGG - Intergenic
1006456251 6:34133558-34133580 CCATGCCCACCCAGGCCGTGGGG - Exonic
1007277149 6:40682882-40682904 CCATGACCACCATGGAAGTGTGG - Intergenic
1010940540 6:81911796-81911818 CCAAGACCAGACAGGGAGTAAGG + Intergenic
1010980171 6:82363253-82363275 CCATCACTACCCAAGAAGTGAGG + Intronic
1015163161 6:130175276-130175298 CCATGACCTCCCAGGTGCTGAGG + Intronic
1016102600 6:140120724-140120746 CCATGGCCTCTCAGGGAGTGGGG + Intergenic
1016747801 6:147599766-147599788 CAATGACCAGCCTGGTAGTGAGG - Intronic
1019314229 7:377179-377201 CGCTGACCACCCAGGGCTTGAGG + Intergenic
1019424646 7:968549-968571 CCATGTCCACCCAGTGCGTCAGG - Exonic
1021396332 7:20153108-20153130 CCAGGAGCAACCAGGGACTGAGG - Intronic
1022853657 7:34293876-34293898 CCATTACCACCCCAGGAGTGGGG + Intergenic
1023128440 7:36978212-36978234 CCATGAGCCAACAGGGAGTGAGG - Intronic
1023319172 7:38975213-38975235 CCCTGACCTCTCAGAGAGTGTGG - Intergenic
1024563021 7:50660361-50660383 CCATGTCCATGCAGGAAGTGGGG + Intronic
1026498460 7:70923041-70923063 CCAGGAGACCCCAGGGAGTGGGG - Intergenic
1027731934 7:81885424-81885446 CCAGGACCTGTCAGGGAGTGGGG - Intergenic
1027779010 7:82499927-82499949 CAATGACCACCCAAGGGCTGAGG + Intergenic
1027799083 7:82729642-82729664 CCATGATCCCCAAGGGAGTCAGG - Intergenic
1034479284 7:151307446-151307468 CCATGAGGACAAAGGGAGTGAGG - Intergenic
1037600026 8:20385995-20386017 CCAAGGCCTCCAAGGGAGTGAGG - Intergenic
1039401130 8:37270308-37270330 CCATGAGCACCAAAGGAGTATGG - Intergenic
1042650304 8:71033225-71033247 CCATGATCACACTGGTAGTGGGG - Intergenic
1045657356 8:104400577-104400599 GCCTGACCATCTAGGGAGTGAGG + Intronic
1049181058 8:141222432-141222454 TCCTGACCACCCAGGGAGGTAGG + Intronic
1049416847 8:142499239-142499261 CCATAACCACCCTGCCAGTGAGG - Intronic
1051145666 9:14024836-14024858 CCATGACTTCCCAGAGAATGTGG + Intergenic
1052210621 9:25898675-25898697 TCAAGACCACCCAGGCAGAGGGG + Intergenic
1053105557 9:35405079-35405101 CTCTGACCTCCCAGGAAGTGTGG - Exonic
1053307417 9:36994385-36994407 ACATGACCTGCCAAGGAGTGTGG + Intronic
1054452404 9:65410206-65410228 CCATGAGGACCCAGGAACTGTGG + Intergenic
1055155624 9:73059476-73059498 CCAAGAACCCCCAGGGACTGTGG - Intronic
1055478507 9:76687096-76687118 CCATGGCCAGCCCGGGAATGAGG + Intronic
1056225276 9:84489168-84489190 CCATGACCACCACTGGAGAGTGG + Intergenic
1057514844 9:95712403-95712425 CCTGGACCACCCATGGGGTGTGG + Intergenic
1057995599 9:99819912-99819934 CCCTGACCCCGCCGGGAGTGCGG - Intergenic
1059374467 9:113871554-113871576 CCAGGATCACCCGGGTAGTGAGG + Intergenic
1059422879 9:114203718-114203740 CCATCAGCCCCCAGGAAGTGGGG - Intronic
1061622085 9:131817300-131817322 CCATGCCCCTCCAGGGAGAGAGG - Intergenic
1061954603 9:133955279-133955301 ACAAGCCCAGCCAGGGAGTGTGG + Intronic
1062343997 9:136106495-136106517 CCGTGCCCAGCCTGGGAGTGGGG + Intergenic
1062426964 9:136510546-136510568 CCATAAGCACCCAGGGAGGCCGG - Intronic
1062459732 9:136657877-136657899 CCAGCAGCACCCAGGGAGTCTGG - Intergenic
1203429672 Un_GL000195v1:79703-79725 CCATCACCACCCAGGCATGGAGG + Intergenic
1186309327 X:8300929-8300951 CCATGAACACCCAAGGGGTAAGG - Intergenic
1186426760 X:9468558-9468580 CCATGACCAGGCAGGGCTTGGGG - Intronic
1187344374 X:18449510-18449532 CCATCACCACCCAGTGATTCTGG - Intronic
1189209888 X:39275936-39275958 CATTGACCACCCAGGGGCTGAGG + Intergenic
1189534808 X:41924496-41924518 ACAGGAGCAGCCAGGGAGTGAGG + Intergenic
1191618583 X:63192577-63192599 CCATCACCACCCAAGGGCTGAGG - Intergenic
1196763217 X:119218959-119218981 CCCTGACCACTCAGGGCTTGTGG + Intergenic