ID: 1084689272

View in Genome Browser
Species Human (GRCh38)
Location 11:70715783-70715805
Sequence GCATCCTTCTGGACAGATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 96}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084689272_1084689282 21 Left 1084689272 11:70715783-70715805 CCTCTATCTGTCCAGAAGGATGC 0: 1
1: 0
2: 0
3: 9
4: 96
Right 1084689282 11:70715827-70715849 CCCCTGGACCCGGCAGCCCAGGG 0: 1
1: 0
2: 0
3: 35
4: 325
1084689272_1084689276 5 Left 1084689272 11:70715783-70715805 CCTCTATCTGTCCAGAAGGATGC 0: 1
1: 0
2: 0
3: 9
4: 96
Right 1084689276 11:70715811-70715833 GAATGTGACCCACATGCCCCTGG 0: 1
1: 1
2: 0
3: 19
4: 172
1084689272_1084689285 25 Left 1084689272 11:70715783-70715805 CCTCTATCTGTCCAGAAGGATGC 0: 1
1: 0
2: 0
3: 9
4: 96
Right 1084689285 11:70715831-70715853 TGGACCCGGCAGCCCAGGGCTGG 0: 1
1: 0
2: 4
3: 46
4: 306
1084689272_1084689277 11 Left 1084689272 11:70715783-70715805 CCTCTATCTGTCCAGAAGGATGC 0: 1
1: 0
2: 0
3: 9
4: 96
Right 1084689277 11:70715817-70715839 GACCCACATGCCCCTGGACCCGG 0: 1
1: 0
2: 2
3: 24
4: 191
1084689272_1084689280 20 Left 1084689272 11:70715783-70715805 CCTCTATCTGTCCAGAAGGATGC 0: 1
1: 0
2: 0
3: 9
4: 96
Right 1084689280 11:70715826-70715848 GCCCCTGGACCCGGCAGCCCAGG 0: 1
1: 0
2: 3
3: 37
4: 486

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084689272 Original CRISPR GCATCCTTCTGGACAGATAG AGG (reversed) Intronic
900428467 1:2591237-2591259 GCATGTTTCTGGTCAGATGGGGG - Exonic
901412717 1:9095747-9095769 GCATGTTTCTGGTCAGAGAGGGG - Intergenic
903038945 1:20513988-20514010 GCATCCTCATGGATAGACAGTGG - Intergenic
903973706 1:27136054-27136076 GCATCCTTCTGGGCAGTCAGGGG - Intronic
904911918 1:33940913-33940935 GCAACCTGCTGGACAGACATAGG + Intronic
913059171 1:115188940-115188962 GCAGGCTGCAGGACAGATAGAGG - Intergenic
915359241 1:155276013-155276035 GCATAATTCTGGACACATAGTGG - Intronic
915924462 1:160005245-160005267 GCTTCCTTCTGGGAAGAGAGAGG - Intergenic
920102913 1:203529213-203529235 GCATCCTACTGCACAGAAAGAGG - Intergenic
920725611 1:208432143-208432165 AGATCCTTCTGGACAAATTGGGG - Intergenic
1063100205 10:2943858-2943880 GCATCCTTCCTGGCAGAGAGGGG + Intergenic
1063145982 10:3295593-3295615 GCTGCCTTCTAGACAGATGGCGG - Intergenic
1066977647 10:42384311-42384333 ACATCTTTCTGGCCAGAGAGGGG + Intergenic
1067721156 10:48728607-48728629 ACATCCTTCTGGACACTTGGTGG - Intronic
1074968319 10:118513648-118513670 TCATCCCTCTGTGCAGATAGTGG + Intergenic
1075041820 10:119114068-119114090 GCCTCCTTCTGGGCAGGAAGTGG - Intronic
1080101193 11:28461543-28461565 GCATATTTCTGAAAAGATAGAGG + Intergenic
1080262306 11:30362570-30362592 GAATTCTAGTGGACAGATAGCGG + Intergenic
1080330573 11:31132636-31132658 GCATCCATGTGGAAACATAGAGG + Intronic
1081247875 11:40791772-40791794 TCTTCCTTCTGGACAGAGAATGG + Intronic
1081440049 11:43070572-43070594 GCATCCTTGTGCTCAGTTAGTGG + Intergenic
1084689272 11:70715783-70715805 GCATCCTTCTGGACAGATAGAGG - Intronic
1097836068 12:64273904-64273926 GCCTCCTTCTGGGCACATGGTGG - Intronic
1103334949 12:120182406-120182428 GCAGCCTGCTGGTTAGATAGAGG - Intronic
1110289313 13:73785873-73785895 TGAGCCTTCTGGGCAGATAGCGG + Intronic
1114656311 14:24317786-24317808 GCATCCTTCTGCACAGATGCTGG - Exonic
1126099523 15:45111259-45111281 GCAGCCTTCGGGGCAGAGAGAGG - Exonic
1126104004 15:45135778-45135800 GCAGCCTTCGGGGCAGAGAGAGG + Exonic
1127821698 15:62663367-62663389 GCATCCTTCTGGACATTAAAGGG - Intronic
1133174983 16:4007705-4007727 GCATCTCTCTGGAGAGATCGTGG - Intronic
1141395216 16:83698547-83698569 GCTTCCTCCTGGGCAGACAGGGG + Intronic
1142099341 16:88263397-88263419 GCAGCCTTCTGGGCAGACACAGG - Intergenic
1142860690 17:2759248-2759270 GCATACTTGTGCAAAGATAGTGG + Intergenic
1143833578 17:9671795-9671817 GCATCCATCAGGCCACATAGGGG + Intronic
1155254439 18:23982408-23982430 GCAGCCATCAGGACAGAGAGTGG - Intergenic
1157558022 18:48625829-48625851 GCCTCCTTCTGCACAAATAATGG + Intronic
1157661182 18:49446617-49446639 GCATACTGCTGGCCACATAGTGG - Intronic
1157981973 18:52392285-52392307 CCACCCTTCGGCACAGATAGAGG - Intronic
1160616421 18:80133171-80133193 GGAACCTTCTGGAAAGAAAGTGG + Exonic
1163610075 19:18296030-18296052 ACATCCTTCTGGGCACATGGTGG + Intergenic
1163889101 19:19995017-19995039 CCATCCTTCTGGCCAAAAAGCGG + Intergenic
1166548317 19:43648084-43648106 GCATGTTTCTGGTCAGAGAGGGG + Intronic
1168189549 19:54727710-54727732 GCTTCCTTCTGCACAGAGAGGGG + Exonic
1168195896 19:54773432-54773454 ACTTCCTTCTGCACAGAGAGGGG + Exonic
1168197794 19:54788297-54788319 ACTTCCTTCTGCACAGAGAGGGG + Intronic
1168204261 19:54837675-54837697 ACTTCCTTCTGCACAGAGAGGGG + Intronic
930505400 2:52277161-52277183 GCATGCTTCAGGAGAGAGAGAGG + Intergenic
930648311 2:53936447-53936469 TCATGCTGCTGGACATATAGTGG - Intronic
937049935 2:118880177-118880199 TCATCCTTATGTAAAGATAGAGG - Intergenic
938692286 2:133802642-133802664 GCATCCTTCTGCATAGAAAAAGG + Intergenic
1170905230 20:20509382-20509404 GCAGGCTTCTGGACAGAGAATGG + Intronic
1171319809 20:24232741-24232763 GCATCCTATTGGCCAGAAAGTGG - Intergenic
1174141946 20:48421200-48421222 ACATCCCTTTGGACAGATCGTGG - Intergenic
1178756530 21:35355238-35355260 GCCTCCTTCAGGAAAGGTAGTGG - Intronic
1180840934 22:18958507-18958529 GCATTTTACTGGACAGAGAGAGG - Intergenic
950033806 3:9869807-9869829 GAGTCCATGTGGACAGATAGGGG + Intronic
952935801 3:38397459-38397481 GCATGAGTCTGGACAGCTAGAGG + Intronic
952983701 3:38758905-38758927 GCATCCTTCTGTCTAGATAATGG - Intronic
958680030 3:97317714-97317736 GAATCCTTCAGGACCTATAGTGG + Intronic
977504183 4:97880850-97880872 GCATCCTTCTGAACTGGTATTGG - Intronic
978564953 4:110071686-110071708 GCATCCTTCTGAGCAGGCAGTGG - Intronic
978671995 4:111260416-111260438 GCATCCTTCTGGAGTGATGGAGG + Intergenic
982933150 4:161434952-161434974 GAACCCTTCTAGACAGGTAGTGG + Intronic
983049816 4:163033078-163033100 ACATCTTTCTGGCCAGATGGGGG + Intergenic
986779011 5:11047242-11047264 TCATCCTCCTGGACAGGCAGAGG - Intronic
992099978 5:73397688-73397710 ACATCCTTCATGACAGATATGGG - Intergenic
993163620 5:84321392-84321414 GCAGCATTCTGGGGAGATAGTGG + Intronic
993485596 5:88480390-88480412 GCATTTTCCTGGAAAGATAGAGG - Intergenic
1000652908 5:163838924-163838946 GCATTCTTCTGGGCATGTAGTGG + Intergenic
1000663452 5:163964952-163964974 GCATCCTTCTGAACAAAGAATGG - Intergenic
1001113179 5:168915776-168915798 GCATCGTTTTGGACAAAAAGAGG + Intronic
1001142639 5:169157525-169157547 GCATTGTTATGGCCAGATAGGGG - Intronic
1001651680 5:173320342-173320364 GCTTCCTCCTGGAGAGAGAGAGG - Intronic
1002934287 6:1658474-1658496 GCATCCTCCTGGACAGGCAGAGG + Intronic
1003666891 6:8119581-8119603 TCATCCAGTTGGACAGATAGTGG + Intergenic
1006419811 6:33925852-33925874 GCCTCCTCCGGGACAGACAGGGG - Intergenic
1011509853 6:88088462-88088484 GCAGCCTTATGGAAAAATAGAGG + Intergenic
1016688068 6:146903679-146903701 GCTTCCTTCTGGAGAGGAAGAGG - Intergenic
1017908260 6:158771551-158771573 GCATTCTCCAGGACAGATGGAGG + Intronic
1018741346 6:166731567-166731589 GCATCTTTCTGGAGAGCTAGAGG - Intronic
1020491928 7:8797045-8797067 GCCTCCTTCTGGGAACATAGTGG - Intergenic
1021417055 7:20398924-20398946 GGACCCATCTGGACAGATGGCGG - Exonic
1022815121 7:33905731-33905753 TCCTCCTTCTTGACAGGTAGGGG + Exonic
1024966489 7:55026637-55026659 GCATCTTTCCGGCCAGAGAGAGG - Intronic
1026625058 7:71984661-71984683 GTACCCTTCTGGAGAGATATGGG + Intronic
1033910076 7:146252376-146252398 GTTTCCTACTGGACAGAGAGAGG + Intronic
1034633673 7:152550511-152550533 GCAGCTTTCTGGACAGCTTGAGG + Intergenic
1036201722 8:6775981-6776003 GCAGGCTTCTGGACAGTGAGTGG + Intergenic
1037233764 8:16691682-16691704 ACATCCTTATGGACAGTGAGAGG + Intergenic
1039859404 8:41443917-41443939 CAATTCTTCTGGCCAGATAGAGG + Intergenic
1041237469 8:55818972-55818994 GCAGCCTTGTGGACAGAGCGAGG - Intronic
1041822179 8:62049488-62049510 GCATAATGCTGGACAGATGGTGG - Intergenic
1042469067 8:69162350-69162372 GCACACTTCCTGACAGATAGTGG + Intergenic
1049225404 8:141448357-141448379 GCATCCAGGTGGACAGCTAGGGG - Intergenic
1049267024 8:141673498-141673520 TCATCCTCCTGGACAGCTCGGGG - Intergenic
1049564917 8:143333045-143333067 GCATCCTTCAGGGCACTTAGTGG - Intronic
1050920059 9:11188933-11188955 TCATCTTTCTGGACAGGTGGAGG - Intergenic
1051357308 9:16251560-16251582 GAACCCTTCTGCACAGTTAGTGG + Intronic
1054846635 9:69805645-69805667 ACATCATTCAGGACAGATAGAGG + Intergenic
1062335150 9:136061670-136061692 ACATCCTCCTGGTCAGAAAGAGG + Intronic
1062399547 9:136366410-136366432 GCTTCCTCCTGGACAGAGGGAGG - Intronic
1186084892 X:5976742-5976764 ACATCTTTCTGAACAGATAACGG - Intronic
1192572798 X:72220576-72220598 GCATCCTCCTGGCCAGAGGGGGG - Intronic
1192765861 X:74138922-74138944 ACATCTTTCTGGCCAGAGAGTGG - Intergenic
1198981578 X:142403581-142403603 GCTGCCTTCAGGACTGATAGAGG + Intergenic
1201510990 Y:14762616-14762638 ACATCTTTCTGAACAGATAATGG + Intronic