ID: 1084689709

View in Genome Browser
Species Human (GRCh38)
Location 11:70718014-70718036
Sequence CTGGTACAGTGGGAAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 1, 2: 0, 3: 24, 4: 334}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084689709_1084689716 11 Left 1084689709 11:70718014-70718036 CCTTCCACTTCCCACTGTACCAG 0: 1
1: 1
2: 0
3: 24
4: 334
Right 1084689716 11:70718048-70718070 TCCCCTAGTGCCAGTTTCCATGG 0: 1
1: 0
2: 0
3: 15
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084689709 Original CRISPR CTGGTACAGTGGGAAGTGGA AGG (reversed) Intronic
901396907 1:8988397-8988419 CTGTTCCAGTGGGATGTGGGGGG + Intergenic
902125230 1:14203900-14203922 CTGTCACCGTGGGAAATGGATGG + Intergenic
902520609 1:17013508-17013530 ATGGTACAGTGGCAAGGGGCTGG + Intergenic
903757823 1:25674989-25675011 GTGGTACAAAGAGAAGTGGATGG + Intronic
904055859 1:27669413-27669435 CTGATTCAGTTGGAACTGGAAGG - Intronic
904259277 1:29279190-29279212 CTGCTACAGTAGGAGGTGCATGG + Intronic
904756816 1:32772439-32772461 CAGGTACAGTGGGCAGTGCTAGG + Exonic
904839258 1:33361193-33361215 CAGGTGCAGTGGGCAGTGGGGGG + Intronic
905029155 1:34869934-34869956 CTGGTGCAGTGGGAAGTGCTTGG - Intronic
905251439 1:36651320-36651342 TAGGTACAGTGGGAGGGGGAGGG + Intergenic
905312390 1:37058997-37059019 CTGGGACAGTGGGGAGTGGGAGG - Intergenic
907601572 1:55776373-55776395 CTGGTACACTGGAACATGGAAGG + Intergenic
907853531 1:58279631-58279653 TTGGTACAGTGGAAAGAGTATGG - Intronic
908037908 1:60075395-60075417 CTGACACAGTGAGAAATGGAAGG - Intergenic
909090052 1:71214560-71214582 GGGGAAAAGTGGGAAGTGGAGGG - Intergenic
909242722 1:73235672-73235694 GTGGTACAGTGGGAAGAACATGG + Intergenic
909622477 1:77683417-77683439 CTGGTGCTGCGGGAAGTGGCAGG - Intronic
910201579 1:84705763-84705785 CTGGAACAGTGGGAAGTGACAGG - Intergenic
910252083 1:85208490-85208512 CTGGTATAGCCGGTAGTGGAAGG - Intergenic
912490287 1:110059067-110059089 CTTGTATAGAGGGAAGGGGAAGG + Intronic
912801827 1:112724164-112724186 TTGGTAGAGAGGGAAGGGGAGGG - Intronic
912873639 1:113332611-113332633 CTGGTACGGTAGAAAGAGGAAGG + Intergenic
914517386 1:148385467-148385489 ATGGTGCAGTGGGAATTTGAAGG + Intergenic
916531009 1:165656525-165656547 CTGGTACAATGGAAAATGCATGG - Intronic
917685117 1:177407956-177407978 CTGAGACAGTGGCAAGTGAAAGG - Intergenic
918199395 1:182253233-182253255 CTGGTGCAGGGGGAAGTGAGGGG - Intergenic
918884981 1:190181052-190181074 TAGGTACAGTTGGAAGTGGAGGG - Intronic
921318922 1:213918538-213918560 CTGGTACATTGGGTGGAGGAGGG - Intergenic
921744993 1:218730040-218730062 TTGGTATAGTGGGAAGTGCCAGG - Intergenic
921963873 1:221066899-221066921 TTGTTACAGTGAGAAGTAGACGG - Intergenic
922381797 1:225036703-225036725 CAGGCACAGAGGGAAGTGAAGGG - Intronic
923092992 1:230753697-230753719 CTGGAAAAGTGGGAAGAGGTGGG + Intronic
923330098 1:232915751-232915773 CTGGCAGGGTGGGAAGGGGAGGG + Intergenic
924058191 1:240144108-240144130 CTGCTGCTGTGGGATGTGGATGG - Intronic
1065395259 10:25229333-25229355 AGGTTACAGTAGGAAGTGGATGG + Intronic
1066682516 10:37947844-37947866 CTGGTACATTCAGCAGTGGAGGG + Intergenic
1067745235 10:48930558-48930580 CTGGTACTCTGGGAAGAGGTGGG + Intronic
1068530673 10:58182338-58182360 CTGGTATAGTGGGAAAGAGAGGG + Intergenic
1069748389 10:70730409-70730431 TTGGGACCGTGGGAAGTAGAGGG + Intronic
1069785672 10:70986438-70986460 TTGATACAGTGGGAAGAGGGCGG + Intergenic
1070081786 10:73196123-73196145 CTGGTACAGTAGGATGTGCCAGG + Intronic
1070646182 10:78203906-78203928 CAGGAACAGAGAGAAGTGGAGGG - Intergenic
1072843947 10:98807335-98807357 CTGGATAGGTGGGAAGTGGATGG - Intronic
1073309858 10:102532604-102532626 CTTGCACAGTGGGGAATGGAAGG + Intronic
1074689953 10:115995275-115995297 CTGGTGGAGGGGTAAGTGGACGG + Intergenic
1075227140 10:120639913-120639935 CTGGGAGAATGGGAAGTAGAAGG + Intergenic
1075620354 10:123923056-123923078 CTGGTTCAGGGGGAAAAGGAGGG + Intronic
1075651682 10:124131629-124131651 CTGGAACAGATGTAAGTGGATGG - Intergenic
1075652021 10:124133561-124133583 CTGGTGTAGTGGGAAGGGGAGGG + Intergenic
1077341987 11:2030333-2030355 CTGGCACAGTGTGGAGTGGCAGG - Intergenic
1078423367 11:11230171-11230193 CTGGTACAGTGGGCATTGGTTGG + Intergenic
1079241743 11:18726736-18726758 CTGTTGAAGTGGGAAGAGGAAGG - Intergenic
1079763354 11:24357814-24357836 CTGGTAGAGTGGGAGGGGCATGG - Intergenic
1081086385 11:38806770-38806792 TTGGTTCAGTGGGAACAGGAAGG - Intergenic
1082750054 11:57005638-57005660 CTGGTACACAGAGAAATGGAGGG + Intergenic
1083697638 11:64453396-64453418 CTGGTCCTGTGGGAATTGGGTGG + Intergenic
1083874542 11:65514439-65514461 CTGGAACAGTGGTAAGATGAGGG - Intergenic
1083955061 11:65978463-65978485 GGGGTGCAGTGGGAAGGGGATGG - Intronic
1084031817 11:66485563-66485585 CAGGAACAGTGGGAAGTGCTGGG + Intronic
1084594233 11:70107518-70107540 CTGGGCCAGGGGGAACTGGAAGG + Intronic
1084689709 11:70718014-70718036 CTGGTACAGTGGGAAGTGGAAGG - Intronic
1084740253 11:71134825-71134847 CTGGGACCCTGGGAAGTGCAGGG - Intronic
1085577992 11:77624375-77624397 ATGGTAGATAGGGAAGTGGATGG - Intronic
1086166290 11:83782710-83782732 CTGATACTGTGGGTGGTGGAGGG + Intronic
1086234144 11:84607628-84607650 TTCCTACAGTGGGAAGTGCATGG + Intronic
1086262187 11:84953429-84953451 ATGGCACAGTGGGGAATGGATGG - Intronic
1086793440 11:91070112-91070134 GTGGTAGGGTGGGAAGTGTATGG - Intergenic
1088509895 11:110563738-110563760 CTGGAATAGTTGGGAGTGGAAGG + Intergenic
1090064486 11:123491462-123491484 CTGGTGCTGGGGGAAGGGGAGGG - Intergenic
1202824973 11_KI270721v1_random:85522-85544 CTGGCACAGTGTGGAGTGGCAGG - Intergenic
1094309937 12:29069241-29069263 TGGGGACAATGGGAAGTGGATGG - Intergenic
1096121301 12:49091108-49091130 CTGGTACAGTAGGAGGAGGGTGG - Exonic
1096134060 12:49185126-49185148 CTGGTACGTTGGGGAGGGGATGG - Exonic
1096196471 12:49651933-49651955 CTGGTAATGGGGGAGGTGGAGGG + Exonic
1096207675 12:49737043-49737065 TTTGTACAGTGGAAAGGGGATGG + Intronic
1098112053 12:67133281-67133303 GGGGTAAAGTGGGGAGTGGAGGG + Intergenic
1098789265 12:74800249-74800271 TTGGTACAGTGGGGGGTGGGGGG - Intergenic
1099560095 12:84162228-84162250 TTGGTGCAGTGGGACGAGGATGG + Intergenic
1100690288 12:97032264-97032286 ATGGTAAAGTGGGAAGAGAAAGG + Intergenic
1101316934 12:103637870-103637892 CTGGTTCAGGGGGAAATGAAAGG + Intronic
1101839517 12:108317842-108317864 TGGGTACAGTGGAAACTGGATGG - Intronic
1102035469 12:109768522-109768544 CTGGTACAGGAGGCTGTGGATGG - Exonic
1103870820 12:124090312-124090334 CTGGTAAGCTGGGAAGTAGATGG + Intronic
1103910601 12:124349976-124349998 CGGGCACAGGCGGAAGTGGATGG + Intronic
1105213641 13:18272282-18272304 CTGGGACAGGGTGGAGTGGAGGG - Intergenic
1105913407 13:24891801-24891823 CTGGGACAGTGGGTGGTGGATGG - Intronic
1106301268 13:28468507-28468529 CTGGGACTGTGAGAAATGGAAGG - Intronic
1109386000 13:61629531-61629553 CTGGCACAGTGGGAAATCCAGGG - Intergenic
1109624625 13:64958676-64958698 CTGGTACAGCGTCAACTGGATGG - Intergenic
1110307245 13:74003182-74003204 GGAGTATAGTGGGAAGTGGAAGG + Intronic
1110757651 13:79194891-79194913 CTAGGACAGTGGAAAGTGCAGGG - Intergenic
1111743505 13:92234780-92234802 CTGGTGCAGGTGGAAGAGGAGGG + Intronic
1117225591 14:53655057-53655079 CTTGGGCAGTTGGAAGTGGAAGG + Intergenic
1118900207 14:69980048-69980070 CTGGTCCAGCTGGAAGTGGGGGG + Intronic
1120393485 14:83938442-83938464 ATGGTACTGTAGGAAGTGGAGGG + Intergenic
1120861228 14:89256592-89256614 CTTGCTCAGTGGGAAGAGGAAGG - Intronic
1121282867 14:92711851-92711873 CTGGTACAGCGTCAACTGGATGG - Exonic
1121567371 14:94920184-94920206 CTGGTACAGAAGGAAGTCTAAGG + Intergenic
1121831664 14:97057416-97057438 CTGGAAAAGTGGGAAGTGTGTGG + Intergenic
1122844163 14:104481625-104481647 GTGGTACGGTGGGGACTGGACGG - Intronic
1124065989 15:26344349-26344371 CTTGCACAGTGCGAAGTTGATGG + Intergenic
1125299937 15:38244678-38244700 ATGTTGCAGTGGGAAGAGGAGGG + Intergenic
1125665821 15:41429314-41429336 CAGGGACAGAGAGAAGTGGAAGG - Intronic
1126492328 15:49251660-49251682 CTGGTGCAGGGTGAGGTGGATGG - Intronic
1126859237 15:52868383-52868405 CTTGTATTGTGGGAAATGGAAGG + Intergenic
1127177107 15:56371095-56371117 CCAGCACAGTGGGAGGTGGAGGG - Intronic
1127382291 15:58440569-58440591 CTGGCACAGTGGGAAGTCCTTGG - Intronic
1127665364 15:61140762-61140784 CTGGTACTCTGGGCAGTGGCGGG + Intronic
1128030879 15:64479118-64479140 CTGACACAGTGGGAAGTTCAAGG + Intronic
1128634581 15:69294829-69294851 CTGACACAGTGAGAAGTTGAGGG + Intergenic
1128730885 15:70020269-70020291 CTGGCACACTGGTAAGTGTAGGG - Intergenic
1128939533 15:71777160-71777182 CTGGACCAGTGGGAAGAGAAAGG - Intronic
1129453561 15:75664103-75664125 CTGGTGCGGTGGGAAGGGCACGG - Intergenic
1129891011 15:79071908-79071930 CTAGGACAGTGGGAAGGAGATGG - Intronic
1129987291 15:79929330-79929352 GTGATACAGTGAGAAGGGGAAGG - Intergenic
1130983003 15:88825786-88825808 TGGGCACAGTAGGAAGTGGAAGG - Intronic
1131388107 15:92024384-92024406 TGGGTCCAGTGGGAAGTGTATGG + Intronic
1133561032 16:6950383-6950405 CTGGTGTAGTGGGTAGTGGGTGG - Intronic
1134327407 16:13219647-13219669 CTGGGGCATGGGGAAGTGGAGGG + Intronic
1134331231 16:13252785-13252807 CAGGTACCGTGGTAGGTGGAGGG - Intergenic
1134411016 16:14003363-14003385 CAGGAGCAGAGGGAAGTGGAAGG - Intergenic
1136254592 16:29029591-29029613 GTGGTGCAGTGGGTTGTGGAGGG + Intergenic
1138223299 16:55271343-55271365 CTCGTATAATGGGAAGTGCAGGG + Intergenic
1138717451 16:59040198-59040220 CTGGTATAGTGGAAAGAAGACGG - Intergenic
1138967551 16:62103339-62103361 CAGGCACAGAGGGAGGTGGAGGG - Intergenic
1139439488 16:66958663-66958685 CTGGCACTTTGGGAGGTGGAGGG + Intergenic
1140973500 16:80036574-80036596 CTGTTACAGTCAGAAGTTGAAGG + Intergenic
1141131673 16:81441692-81441714 CTGGGATAGTGGAAGGTGGAGGG + Intergenic
1141730562 16:85820230-85820252 CTGGCACAGGGGTAAGTGCAGGG + Intergenic
1143890684 17:10099901-10099923 CAGGGACAGTGGACAGTGGAAGG + Intronic
1144468706 17:15517828-15517850 ATGGTGCAGTGGGAAGAGAATGG - Intronic
1144708437 17:17384987-17385009 GTGCTAAAGTGGGAAATGGACGG - Intergenic
1145067350 17:19770747-19770769 TTGTTTCAGTGGGAAGTGGGAGG - Intergenic
1145108185 17:20137912-20137934 CTAGTACTTTGGGAGGTGGAAGG - Intronic
1146140195 17:30360745-30360767 CTGCTACAGTGGGAAGTCCTGGG - Intergenic
1146253589 17:31374042-31374064 CTGTTACAGTGGCCAGTGGTAGG - Exonic
1146263127 17:31434383-31434405 CAGGGAAAGTGGCAAGTGGAGGG + Intronic
1146313608 17:31790013-31790035 CTGGTAAGGTGGGCAGAGGAGGG - Intergenic
1147302751 17:39542873-39542895 CTGGTTCATTGGGAAGCAGATGG + Intronic
1148148053 17:45378524-45378546 GGGGTGAAGTGGGAAGTGGAAGG - Intergenic
1148428832 17:47625262-47625284 TTGGAACAGTGGGCAGTGGTGGG + Intergenic
1149445356 17:56708921-56708943 CTGATAAAGAGGGAGGTGGAAGG + Intergenic
1149866787 17:60155437-60155459 CCGGAAGAGTGGGAAGGGGAGGG + Intronic
1150152331 17:62820316-62820338 CTGCTACAGTGTGAAGTCAAAGG - Intergenic
1150233386 17:63572391-63572413 CAGGTATAGAGGGAAGTGTAAGG + Intronic
1152618429 17:81348559-81348581 CTGGGACAGTGGGAGGGGGATGG + Intergenic
1153692311 18:7606052-7606074 CAGGCAGAGTGGGAAGTGGGAGG + Intronic
1155269619 18:24127385-24127407 CTGGTACAGGGAGCTGTGGATGG - Intronic
1156468318 18:37361976-37361998 CTGCTGGAGTGGGAAGCGGACGG + Intronic
1156994096 18:43446204-43446226 GTGGTACAGTGGAAAGAGGTTGG - Intergenic
1157190832 18:45580200-45580222 CTGGGACAGTGGGGACAGGAAGG + Intronic
1157278439 18:46329323-46329345 CTGGAAAAGGTGGAAGTGGAGGG - Intronic
1157423129 18:47562753-47562775 CTGGTACCATGGCAAATGGAGGG - Intergenic
1157477269 18:48031384-48031406 CAGGAGCAGTGGGATGTGGAGGG - Intronic
1157535654 18:48455632-48455654 TTGGCAGAGTGGGAAGGGGAAGG - Intergenic
1159324238 18:66894126-66894148 GTGGGACAATTGGAAGTGGAGGG + Intergenic
1159627579 18:70712772-70712794 CTTGTACTCTAGGAAGTGGATGG - Intergenic
1159643550 18:70890959-70890981 CTGGGAAGGTGGGAAGTGAAAGG + Intergenic
1160364066 18:78309285-78309307 CTGGTGCAGCGGGAAGAGGGGGG + Intergenic
1160857453 19:1223934-1223956 CTGTTTCAGCGGGAAGTGGTGGG + Intronic
1161273328 19:3402373-3402395 ATGGTACATGGGGGAGTGGAAGG - Intronic
1162006599 19:7784469-7784491 ATGGTACAGAGGGAGGAGGAAGG - Intergenic
1162424168 19:10583982-10584004 CTGGTACAGCGGGAGGAGGAAGG - Exonic
1163529245 19:17840198-17840220 CTGCTAGGGTGGGTAGTGGAGGG - Intronic
1165904867 19:39187625-39187647 CTGGTAGAGGGGGAAGGGCAGGG - Intergenic
1166123555 19:40700275-40700297 GTGGCACAGTGGGAAGGGCATGG - Intronic
1167886179 19:52501702-52501724 CTGGTGCAGTGGGCAGTGGGGGG + Intronic
1167902866 19:52635257-52635279 CTGGTGCAGTGGGCAGCAGAGGG - Exonic
1167988907 19:53341110-53341132 CTGGTACAGTGGGCAGCAGAGGG + Intronic
1168001163 19:53447071-53447093 CTGGTGCAGTGGGCAGCAGACGG + Intronic
927878647 2:26675323-26675345 CTGGTTCAGTGGAAACAGGATGG - Intergenic
928209397 2:29312432-29312454 GTGGTACAGTGGGAAGGACAGGG - Intronic
928370641 2:30737719-30737741 CTCCTCCAGTGGGAAGTGAATGG + Intronic
929118160 2:38462246-38462268 CTGGAACAGTGGGAAGTGCGGGG + Intergenic
931906982 2:66853191-66853213 CTGTGACAATGGGAAGCGGAAGG - Intergenic
932216506 2:69969640-69969662 CTGGGGCAGTGGGGAGAGGATGG - Intergenic
932583070 2:73005120-73005142 CTGGTACCAAGGAAAGTGGAAGG + Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934300687 2:91774464-91774486 CTGGGACAGGGTGGAGTGGAGGG + Intergenic
934674104 2:96237415-96237437 CTGGGACAGAGGCATGTGGATGG + Intergenic
934949588 2:98567256-98567278 CTGTTAAAGTGGTCAGTGGAAGG + Intronic
935026407 2:99281555-99281577 CTGGTATATTGGGAAGGGGCTGG - Intronic
935312816 2:101802301-101802323 CTGCTACAGTGAGAAGTGACTGG - Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
937442509 2:121928988-121929010 CTGGTAGGGTGGGATGCGGAGGG + Intergenic
937631113 2:124102111-124102133 CTGGTTCAGGGGGTGGTGGAGGG - Intronic
937635579 2:124152052-124152074 CTGAAACTATGGGAAGTGGATGG + Intronic
937985411 2:127636100-127636122 CTAGTACGGTGGGGAGGGGAGGG - Intronic
938794935 2:134710027-134710049 CTGGGACAACTGGAAGTGGATGG - Intronic
940215578 2:151300167-151300189 CTAATTCAGTGGGATGTGGAAGG - Intergenic
940474061 2:154137973-154137995 CTAATACAGTGGGAAGGGGTGGG - Intronic
941777199 2:169406057-169406079 CTGGCACAGTGGAAAGAGCAAGG + Intergenic
941836998 2:170034079-170034101 CTGTTACAGTGGGGAGTATATGG - Intronic
942738372 2:179142553-179142575 TAGGCACAGTGGGAAGTGGATGG - Intronic
945689088 2:213010293-213010315 CAGGTAGAGTGTGAAGGGGATGG + Intronic
945862843 2:215143296-215143318 AAGGTACAGGGGGAAGTGAAAGG + Intergenic
946278561 2:218649233-218649255 GTGGCACAGTGGGCAGTGGTGGG + Exonic
946714196 2:222535842-222535864 GTGGTCCATTGGGAAGTGGCTGG + Intronic
946838133 2:223793544-223793566 GGGGAACAGTGGGGAGTGGAGGG + Intronic
947577135 2:231284715-231284737 CTGGTACAGTGTGGAGGGGATGG + Intronic
948855303 2:240727520-240727542 TTGGTCCATTGGGAAGAGGAAGG + Intronic
1169001260 20:2169465-2169487 TGGGTTCAGTGGGAATTGGAAGG + Intronic
1173397050 20:42689485-42689507 CTGGTACAGTGGGCAACTGAAGG + Intronic
1173716283 20:45209501-45209523 CTGGTACAGTTGGAGCTGAAGGG + Intronic
1174708076 20:52677134-52677156 CATGTACACTGGGTAGTGGAAGG - Intergenic
1175465872 20:59191189-59191211 GTGGTACAGTGGGATGGGCAGGG - Exonic
1176072722 20:63235367-63235389 CTGGTATGGAGGGAGGTGGAGGG + Intergenic
1176201926 20:63864992-63865014 CTGGGAAGGTGGGAAGTGGGAGG - Intergenic
1179257061 21:39726371-39726393 CTGGGATAGTGGCATGTGGATGG + Intergenic
1180011423 21:45053943-45053965 CAGGTACACTGGGCAGTGCATGG + Intergenic
1180816474 22:18792673-18792695 CTGGGACAGCGTGGAGTGGAGGG - Intergenic
1181202661 22:21227005-21227027 CTGGGACAGCGTGGAGTGGAGGG - Intronic
1181699042 22:24609600-24609622 CTGGGACAGGGTGGAGTGGAGGG + Intronic
1181905652 22:26193596-26193618 TTGGTGCAGTGGGATGAGGATGG - Intronic
1183387330 22:37522434-37522456 GTGGGGCAGTGGGAAGTGGGAGG - Intergenic
1184088535 22:42280412-42280434 CAAGAACAGAGGGAAGTGGATGG - Intronic
1184172055 22:42765657-42765679 CTGGTACAGTGGGAACTCAGGGG - Intergenic
1184955923 22:47885826-47885848 CCGGGACAATGGGAAGTGGATGG + Intergenic
1185011822 22:48318841-48318863 CTGGTGCAGTGGGAGGAGGGAGG - Intergenic
1203224252 22_KI270731v1_random:68408-68430 CTGGGACAGCGTGGAGTGGAGGG + Intergenic
1203266574 22_KI270734v1_random:18384-18406 CTGGGACAGCGTGGAGTGGAGGG - Intergenic
949515442 3:4803117-4803139 CTGGAACAGGAGGAAGCGGATGG + Intronic
951017619 3:17747194-17747216 ATTGTCCAGTGGGAAGTGAAAGG + Intronic
952252169 3:31665647-31665669 AGGGTACAGTGGAAAGAGGAGGG - Intronic
952546322 3:34423656-34423678 GTTGTACAGTGAGAAGTGTAAGG + Intergenic
952711347 3:36435241-36435263 CAGAGACAGTGGGAGGTGGAGGG - Intronic
952869510 3:37886004-37886026 CTGTGGCAGTGGGAAATGGAGGG - Intronic
953038306 3:39232714-39232736 CAGGTACAGTGGAAAGAGCATGG + Intergenic
953070121 3:39511815-39511837 CTGGCACAGTGAGAAGGGTAAGG + Intronic
953085907 3:39667014-39667036 ATGGTACAGTGGAAAGAGCATGG + Intergenic
953405204 3:42656519-42656541 CTGGGACAGAGGGAGATGGATGG + Intronic
953578738 3:44134486-44134508 GTGGGAAAGTGGGATGTGGAAGG + Intergenic
954213401 3:49111000-49111022 CTGGTCCAGGGTGAAGTGGCCGG + Exonic
954375495 3:50192226-50192248 CTGCTACTTTGGGAAGGGGATGG + Intronic
954559196 3:51542067-51542089 CTGGTACAATGGGAAGAGCTTGG + Intronic
954716275 3:52528467-52528489 CTGGTATAGTGGGATGTGCTGGG + Exonic
954764829 3:52905228-52905250 CTTGAACAGTGGGAAGGGTAAGG + Exonic
955058652 3:55477523-55477545 CTGGGTCGATGGGAAGTGGATGG - Intronic
955102382 3:55863009-55863031 ATGGGAAAATGGGAAGTGGAGGG - Intronic
957436643 3:80186124-80186146 GTGGTATAGTGTGAAGTGGTTGG + Intergenic
960325883 3:116295537-116295559 CAGGAACAGAGGGAATTGGAGGG + Intronic
962471957 3:135716950-135716972 CTGGTACAGTGGGAAGGGGAAGG + Intergenic
963616438 3:147544300-147544322 CTGGTACAGTGGGTATTTCAAGG + Intergenic
963778869 3:149466651-149466673 CTGCTCCAGTGGGAAGTCTAAGG + Intergenic
964886741 3:161492213-161492235 ATGGCACAGTGGGAAGTGCATGG + Intergenic
965698663 3:171437315-171437337 CTGGAACAGAGCAAAGTGGAAGG - Intronic
967779348 3:193418972-193418994 ATGGTACAGTGGGAATAAGAGGG - Intronic
968562584 4:1292416-1292438 CTGGTGAAGTGGGAAGAGAATGG + Intronic
968571702 4:1345692-1345714 CGGATACAGAGGGCAGTGGACGG + Intergenic
969910602 4:10441788-10441810 TTGGTAGAGAGGGGAGTGGAAGG + Exonic
971110379 4:23578439-23578461 ATGGTACAGTGGGAGGAAGATGG + Intergenic
974165694 4:58198700-58198722 GAGGTAGAGTGGGAAGGGGATGG - Intergenic
977588046 4:98796998-98797020 CTGGTACAGTGGGATATTAAAGG - Intergenic
978237440 4:106476031-106476053 CTGGTGCTGGGGGAAGTGCAGGG + Intergenic
979563219 4:122123260-122123282 CAGGTACAGTGGGAAGTTTATGG + Intergenic
979729184 4:124002115-124002137 CTAGCACATTGGGAAGCGGATGG + Intergenic
980492434 4:133545326-133545348 CTTGTGCAGTGAGAGGTGGAGGG + Intergenic
981790911 4:148535750-148535772 CTGGCACAGAGGGGAGTGGGGGG - Intergenic
982749461 4:159142388-159142410 CTAGTACATTGGCAAGTGGATGG + Intronic
982754691 4:159204305-159204327 AAGGTACAGTGGGATGTAGAGGG + Intronic
986581605 5:9271882-9271904 CTGGTAGTGTGGGCACTGGAGGG - Intronic
988967316 5:36432338-36432360 TTGGGATAGTGGGAGGTGGATGG + Intergenic
989308606 5:39986696-39986718 CAGATACAGTGGGAAGTGATTGG + Intergenic
992771816 5:80055726-80055748 GTGGCAGAGGGGGAAGTGGAGGG - Intronic
993554961 5:89325253-89325275 CTGATAAAGGAGGAAGTGGAAGG - Intergenic
994891686 5:105643939-105643961 CTGCTACAGGGGGAAAGGGAGGG - Intergenic
995199288 5:109409458-109409480 CTTGTACAGTGGCGAGTGTAGGG + Intronic
995295145 5:110511784-110511806 GTGGTAGAGTGAGGAGTGGAAGG - Intronic
995570666 5:113477658-113477680 GTGGTGCAGAGGGAAGAGGAAGG + Intronic
998480372 5:142458289-142458311 CTGTGACAGTGGAAAGGGGAGGG - Intergenic
1000671263 5:164066122-164066144 CTGTTGCAGAGGGAAGTCGAAGG - Intergenic
1000987381 5:167875593-167875615 CTGGGACAATGGGGAGTAGATGG + Intronic
1001311702 5:170615643-170615665 CTGTTACCATGGCAAGTGGAGGG - Intronic
1002649249 5:180679684-180679706 CGGGTACAGGGGGAGGTGGGGGG + Intergenic
1002904138 6:1435232-1435254 GTTGTAAAGAGGGAAGTGGAAGG + Intergenic
1003067992 6:2919600-2919622 CTGGCAAAGTGAGATGTGGAGGG + Intergenic
1003895007 6:10599138-10599160 CTGGTACTATGGGAAGCTGAGGG - Intronic
1004941371 6:20560690-20560712 CTGGTAAAGTAGGAATTGGTGGG - Intronic
1006430584 6:33993324-33993346 CTGAGTGAGTGGGAAGTGGAAGG + Intergenic
1006604864 6:35248989-35249011 CTGGTAAAATGGGCAGTGGAAGG - Exonic
1006983988 6:38166004-38166026 CGGGTAGAGGGGGAGGTGGAGGG - Intergenic
1007353714 6:41294629-41294651 CTGGTAAAGTGGCATGGGGAAGG - Intergenic
1007454582 6:41966556-41966578 CTGGTTCGGTGGGGAGGGGAGGG - Intronic
1008094095 6:47321227-47321249 CTTGTAAAGAAGGAAGTGGAGGG - Intergenic
1008373052 6:50758401-50758423 GTGGGACATTGGGAAATGGAAGG - Intronic
1009908509 6:69897232-69897254 TTGATTCAGTGGGAAATGGATGG - Intronic
1013072338 6:106740620-106740642 CTGGTCCAGTGGGAAGAGATGGG + Intergenic
1013072809 6:106744185-106744207 CGGGCACAGAGGGAAGTGGGAGG - Intergenic
1014303976 6:119717090-119717112 CTGGGTCAGTGGAGAGTGGAGGG + Intergenic
1014716348 6:124868790-124868812 TTGGCACAGTGGGAAGAGTATGG + Intergenic
1016548498 6:145250684-145250706 CAGGTACAGTGACAACTGGAAGG - Intergenic
1016745640 6:147576508-147576530 GTGGTACAGTGGAAAGGGGGTGG + Intronic
1019713312 7:2527154-2527176 CGGGTACAGGTGGCAGTGGATGG - Exonic
1019751351 7:2732300-2732322 CTGGTGCTTTGGGAAGTGGGAGG + Intronic
1020655734 7:10926417-10926439 TTTGTACAGTGGAAAGGGGATGG + Intergenic
1020830704 7:13091263-13091285 CTGTTGGAATGGGAAGTGGAAGG + Intergenic
1021586170 7:22211170-22211192 CTTTTGCAGTGGGAAGTGGGTGG - Intronic
1021929751 7:25568404-25568426 ATGGTACAATGGTAAGTGTATGG - Intergenic
1022477908 7:30723769-30723791 CTGGTACCCTGGGCAGTGGCTGG + Intronic
1023048838 7:36234420-36234442 CTAGTACTGTGGGAAGCTGAGGG + Intronic
1024117285 7:46206255-46206277 CTGGAACACTGGGAAAAGGAGGG - Intergenic
1024167067 7:46745948-46745970 CTGGTACAGTAGCACGTGCAAGG - Intronic
1024914122 7:54479859-54479881 CTGGAACAGAGGCAAGGGGAAGG + Intergenic
1025770374 7:64499776-64499798 CGGGCACAGAGGGAGGTGGAAGG + Intergenic
1026775841 7:73230508-73230530 CAGGTTCAGTGGGAAGCTGAAGG + Intergenic
1027016699 7:74783880-74783902 CAGGTTCAGTGGGAAGCTGAAGG + Intronic
1027071329 7:75162056-75162078 CAGGTTCAGTGGGAAGCTGAAGG - Intergenic
1027224392 7:76234882-76234904 CTGGTGCAGAGGGAAGCGGACGG - Intronic
1031876522 7:127147968-127147990 CTGGTTCAATGGCAAGGGGATGG - Intronic
1033939594 7:146635934-146635956 CTGTTCCAGTGGCAAGTGAATGG + Intronic
1035655444 8:1301772-1301794 CTGCTGCCGTGGGAAGGGGAGGG - Intergenic
1035941492 8:3906124-3906146 CTGGTACACTGTGGGGTGGAAGG - Intronic
1037656659 8:20889409-20889431 CTGTTACTGTGGGAAGGGCAGGG - Intergenic
1037936977 8:22921516-22921538 CTGGAAGGGTGGGAGGTGGAAGG - Intronic
1038091674 8:24261308-24261330 CTGCTACAGTTGGAAGTAGTTGG + Intergenic
1038121161 8:24617386-24617408 ATGGTATATTGGGAAGTGTAGGG - Intergenic
1038492365 8:27980404-27980426 CTGGTACAGTCTGGAGTGGATGG - Intronic
1040392484 8:46961770-46961792 CTGGCAGAGTGGGAAGGTGACGG + Intergenic
1040567317 8:48579362-48579384 CAGCTACAGTGGCCAGTGGAGGG + Intergenic
1040621902 8:49100975-49100997 TTGGCACAGTGGAAAGGGGATGG + Intergenic
1040948903 8:52916015-52916037 CTGGTTTAGTGGGAAGTTAAAGG + Intergenic
1045663057 8:104457997-104458019 CTAGTCCAGTGGGAAGACGAAGG - Intronic
1045993414 8:108336317-108336339 CTAGTACTTTGGGAGGTGGAGGG - Intronic
1047532897 8:125693446-125693468 CTGGTACAATGGAAAGTGCTCGG - Intergenic
1048643800 8:136394913-136394935 CTGTTTCAGTGGGATGTGGGTGG + Intergenic
1048986628 8:139738342-139738364 CTGGGACATGGGCAAGTGGAGGG - Intronic
1049225109 8:141446826-141446848 CTGGTGCAGAGGGAAGATGAAGG + Intergenic
1049419198 8:142509549-142509571 TTGGTACAGTGGGGACCGGATGG + Intronic
1050945783 9:11515336-11515358 CTGGAGCAGAAGGAAGTGGAAGG - Intergenic
1052527456 9:29636810-29636832 CTGGTGAACTGGGCAGTGGAGGG + Intergenic
1053414078 9:37935424-37935446 CTGGCAGACTGGGAAGTGGTGGG + Intronic
1053459947 9:38260551-38260573 CGGGAGCAGTGGGAATTGGATGG + Intergenic
1055022567 9:71685991-71686013 GTGGAAGAGTGGGAATTGGATGG - Intronic
1055125771 9:72716891-72716913 CTGGTGGCGTGGGAACTGGAGGG + Intronic
1056447992 9:86685148-86685170 CTGGAACAGTGGCATCTGGAGGG - Intergenic
1057317147 9:93976877-93976899 CTGGTACAGAGGGGAGAGAAAGG + Intergenic
1058915492 9:109560654-109560676 TGGGTAGAGTTGGAAGTGGATGG + Intergenic
1059152342 9:111960306-111960328 CTGGAACACTGGGGATTGGAAGG - Intergenic
1059283918 9:113156782-113156804 AGGGTACAGTGGGAGCTGGATGG - Intronic
1062137082 9:134934887-134934909 CTGGGACAGAGGAAAGGGGAAGG - Intergenic
1062169918 9:135129241-135129263 CTGGGACAGTGGGGTGGGGATGG + Intergenic
1186455033 X:9703981-9704003 TTGGTACATTGGGAAGTTGTTGG + Intronic
1187192048 X:17044533-17044555 TTCGTTCACTGGGAAGTGGAGGG + Intronic
1188679331 X:32982539-32982561 CTGTTTTAGTGGGAAGAGGAAGG - Intronic
1189034518 X:37482187-37482209 TTCGTACAGTGGAAAGGGGATGG + Intronic
1189195202 X:39146914-39146936 CTGGAACAGTGGGAGGTAGAAGG + Intergenic
1189898580 X:45682407-45682429 CTATTAGAGTGGGAAATGGAAGG - Intergenic
1190719134 X:53132731-53132753 TTGCAACAGTGGGAAGTTGAAGG + Intergenic
1193337855 X:80312278-80312300 CGGGAACAGTGGGAGGTGGAGGG + Intergenic
1195156539 X:102128721-102128743 CTGGTAAGGTGGGACCTGGAAGG - Intergenic
1195741424 X:108068555-108068577 CTGGAACAGGAGGAAGGGGAGGG + Intronic
1199363713 X:146952662-146952684 ATTGTACAGTGGGAAGTGATGGG + Intergenic
1199550250 X:149053648-149053670 CTAGGACAGGGGGAGGTGGAAGG - Intergenic
1201144985 Y:11059510-11059532 CTGGGACCCTGGGAAGTGCAGGG - Intergenic