ID: 1084690110

View in Genome Browser
Species Human (GRCh38)
Location 11:70720161-70720183
Sequence CTCCCAGGTACCAGGCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 486
Summary {0: 1, 1: 0, 2: 10, 3: 47, 4: 428}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084690110 Original CRISPR CTCCCAGGTACCAGGCCCTG GGG (reversed) Intronic
900314271 1:2049432-2049454 CTCCTTGATGCCAGGCCCTGGGG - Intergenic
900409974 1:2508050-2508072 CTCCCAGGGGCCAGGCCCAGCGG + Intergenic
900777748 1:4597135-4597157 CTCCCAAATACAAGTCCCTGGGG - Intergenic
900800184 1:4732426-4732448 CTCCAAGCTACCCTGCCCTGTGG + Intronic
900815228 1:4838396-4838418 CTCCAATGAACCAGTCCCTGGGG - Intergenic
901089179 1:6629996-6630018 GGGCCAGGTGCCAGGCCCTGGGG + Intronic
901135985 1:6995928-6995950 CTGCCTGGTACCTGGCCCTGGGG + Intronic
902038805 1:13477286-13477308 TTGCCATGTACAAGGCCCTGGGG + Intronic
902779936 1:18698616-18698638 CTCCGAGCTTCCAGGCTCTGCGG - Intronic
902894314 1:19468447-19468469 CTCCTATGTTCCAGGCCTTGGGG - Intronic
903371424 1:22838562-22838584 CTTCCATGCACCAGGCCCTGGGG + Intronic
903408948 1:23123699-23123721 CTCCCTGCTCTCAGGCCCTGAGG + Intronic
903542921 1:24107029-24107051 GTCGCAGGTCCCAGGCCCTGGGG + Intronic
903816978 1:26071349-26071371 CTACTAGGTACCAGGCATTGGGG - Intergenic
904118262 1:28177989-28178011 CCCCCAGGCACCAGGCACTGGGG + Intronic
904586646 1:31584468-31584490 CTCCCAGGTATCAGGTGGTGGGG - Intronic
905018129 1:34791462-34791484 CCCTCAGGGACCCGGCCCTGGGG + Intronic
905135610 1:35796950-35796972 CTACCATGTGCCAGACCCTGTGG - Intergenic
905178356 1:36151926-36151948 CTCCCAGGGCCCACTCCCTGTGG - Intronic
905238971 1:36570416-36570438 TTCCCAGGGACCAGGGCCTGGGG + Intergenic
905582049 1:39089740-39089762 CTGCCATGTGCCAGGCACTGCGG + Intronic
905969403 1:42129937-42129959 CTACCATGTGCCAGGCACTGGGG - Intergenic
906551751 1:46671336-46671358 TTCCCAGGCCCCAGGCCCTGTGG - Intronic
906657960 1:47562263-47562285 CTCCCAGGGTCTGGGCCCTGTGG - Intergenic
906874953 1:49527397-49527419 CTCCCAAGCACTAAGCCCTGAGG - Intronic
907182989 1:52587244-52587266 CCCCCATGTACCAGGCATTGAGG + Intergenic
907268629 1:53277426-53277448 TTCCCAGGGACCAGGGTCTGGGG + Intronic
908030132 1:59990276-59990298 CTACTAGGTTCCAGGCACTGTGG + Intronic
911013463 1:93306543-93306565 CTCCTATGTGCCAGGCACTGTGG + Intergenic
911052750 1:93685094-93685116 CTACCATGTGCCAGGCCCAGGGG - Intronic
911468035 1:98279726-98279748 ATACCATGTACCAGGACCTGTGG - Intergenic
912588221 1:110786815-110786837 TTCCCAGGTACCAGGACCTGAGG + Intergenic
912980231 1:114364788-114364810 CTCCCAGGTCTCAGGTGCTGCGG + Intergenic
913070339 1:115292911-115292933 CTAGCAGGTACCAGCGCCTGTGG + Intronic
914244875 1:145878176-145878198 ATCACAGGTACCAGGCACTTGGG - Intronic
915945875 1:160151575-160151597 CCCCCCAGTCCCAGGCCCTGTGG - Exonic
916519511 1:165551284-165551306 ATCCCAGGTCCTATGCCCTGAGG + Intronic
917535529 1:175871936-175871958 CTCCCAGATACCAGCTCCTGAGG + Intergenic
917838775 1:178960973-178960995 CTCGGAGGTGACAGGCCCTGGGG + Intergenic
918005091 1:180534521-180534543 CTCACTGGTGCCAGGGCCTGGGG + Intergenic
918028386 1:180777513-180777535 CTCCTATGTACCAGGCAATGTGG - Intronic
919044693 1:192435897-192435919 TTCCCAGGAAACAGGCTCTGAGG - Intergenic
919676501 1:200388883-200388905 CTTTCAGGTACCAGGCAATGTGG + Intergenic
919835664 1:201571455-201571477 CTGCCAGGCTCCAGGCACTGGGG + Intergenic
919842094 1:201616912-201616934 CTTCCATGTACCAGGTGCTGTGG - Intergenic
920186842 1:204164898-204164920 CCCCTAGGTGCCAGGCCTTGTGG - Intronic
920446490 1:206022347-206022369 CTCCCAGGGGCCAGAGCCTGGGG + Intronic
920531596 1:206706497-206706519 CTCCCAGGCTCCAGGCTCTCTGG + Intronic
920871058 1:209795393-209795415 ATCCCAGGGAGCAGACCCTGTGG + Exonic
921332843 1:214057272-214057294 CTCCTAGGCACAAGGACCTGGGG - Intergenic
921453646 1:215340640-215340662 CTTCCATGTGACAGGCCCTGGGG - Intergenic
922226417 1:223649810-223649832 CTGCTAGGTACCAGGCACCGTGG + Intronic
922339133 1:224641428-224641450 CACCCAGGTGCAACGCCCTGGGG + Intronic
922542557 1:226430023-226430045 CACCCATGCACCAGGCACTGGGG + Intergenic
922925108 1:229342083-229342105 CTGCCAGGTACCCGGCCCGGAGG - Exonic
922980452 1:229821774-229821796 CTATCATGTGCCAGGCCCTGGGG - Intergenic
923045915 1:230355567-230355589 CTGCCCTGTAACAGGCCCTGTGG - Intronic
923520783 1:234733495-234733517 CTGCTATGTACCAGGCTCTGTGG - Intergenic
924516449 1:244770112-244770134 CTCCCAGGTACAGCCCCCTGAGG - Intergenic
924706104 1:246503454-246503476 CTCCCATGTGGTAGGCCCTGGGG + Intronic
924737195 1:246768907-246768929 CTCCCAGTGGCCAGGCCCAGAGG + Intergenic
1062834354 10:626302-626324 ATCCCAGCTGCCAGGCTCTGGGG + Intronic
1066006155 10:31147820-31147842 CGCCCAGGGACCAGGCACAGTGG + Intergenic
1066224067 10:33365323-33365345 TTGCCAGTTACAAGGCCCTGTGG + Intergenic
1067727286 10:48779831-48779853 CTCCATGGTACAAGGCCCAGTGG + Intronic
1067735224 10:48845349-48845371 CTGCCATGTTCCAGGCCCTTGGG + Intronic
1069632591 10:69905964-69905986 CTCCCACTTATCAGGCCCTCGGG - Intronic
1069756021 10:70774915-70774937 CTCCCAGGTGCCTAGGCCTGGGG + Intronic
1069849974 10:71397999-71398021 CTCCCGGGTGCCAGCTCCTGGGG - Intronic
1069939440 10:71944357-71944379 CTCCCAGGTCTCAGGTGCTGCGG - Intergenic
1069947290 10:71996760-71996782 CTGCCACGTGCCAGGCACTGTGG + Intronic
1070587773 10:77779779-77779801 CTCCCCTGTTCCTGGCCCTGGGG - Intergenic
1070824688 10:79384334-79384356 CTTCCAGGGACCCGGCCATGGGG - Exonic
1071564922 10:86666858-86666880 CCCCCAGCTCCCTGGCCCTGAGG + Intergenic
1071925158 10:90398253-90398275 CTACCATGTACCAAGCACTGGGG + Intergenic
1072660553 10:97361059-97361081 CTACTAAGTGCCAGGCCCTGGGG + Intronic
1073287866 10:102399349-102399371 CTCCCGGGTAGCAGCCCATGGGG - Exonic
1073607186 10:104908189-104908211 CTTCCAAGTGCCAGGCCTTGGGG - Intronic
1074313704 10:112343693-112343715 CTCCATGCTGCCAGGCCCTGGGG + Intergenic
1074410903 10:113227646-113227668 CTCCCAGCTGCCAGAACCTGGGG + Intergenic
1074915407 10:117950598-117950620 CTTCCAAGTACCAGGCATTGTGG - Intergenic
1075462166 10:122624106-122624128 CTCCCAAGAACCAGGTCCTAGGG + Intronic
1075519892 10:123136940-123136962 CCTCCAGGTCCCAGGCCATGAGG - Intronic
1075612109 10:123862598-123862620 CATCCAGGTACCTGGCCCTGTGG - Exonic
1075643311 10:124080875-124080897 TTCCCATGGACTAGGCCCTGGGG + Intronic
1076861868 10:133141607-133141629 CTCCCAGGGCTCAGCCCCTGCGG - Intergenic
1076978351 11:192336-192358 CCCCCAGGTTGAAGGCCCTGGGG - Intronic
1077170470 11:1163786-1163808 ACCCCAGGGACCCGGCCCTGGGG + Intronic
1077182627 11:1223434-1223456 CTCCCAGGGGCCTTGCCCTGCGG - Intronic
1077581297 11:3418888-3418910 CTCCCAGCCAGCAGGCACTGCGG - Intergenic
1079114912 11:17634808-17634830 CCCCGAGGTGACAGGCCCTGTGG + Intronic
1079234262 11:18676528-18676550 CTCACATGTGCAAGGCCCTGTGG + Intergenic
1080011990 11:27469472-27469494 CTCCTATGTACCGGGCTCTGGGG + Intronic
1080784173 11:35459868-35459890 CTATGAGGTACCAGGCACTGGGG - Intronic
1081909816 11:46693716-46693738 CTCCCAGGTCCCAGGCCTGCTGG - Intronic
1083158700 11:60841584-60841606 CCCCCAGGTAGCAGTCCCTCAGG + Intergenic
1083261637 11:61526251-61526273 CTCCCAGGGACCTTGCCCAGGGG + Intronic
1083301292 11:61740816-61740838 CTCCCAGGGGCCTGTCCCTGAGG + Intronic
1084099137 11:66933972-66933994 TTCCCAAGTGCTAGGCCCTGAGG + Intronic
1084196524 11:67525873-67525895 CTGCCAGGTTCCAGCTCCTGGGG - Intergenic
1084436494 11:69144519-69144541 CTGTCTGGTACCTGGCCCTGGGG + Intergenic
1084483367 11:69434594-69434616 CTTCCAGGCCCCAGGCCCTGGGG + Intergenic
1084494772 11:69497548-69497570 CCCCCAGATATCAGGCTCTGTGG + Intergenic
1084690110 11:70720161-70720183 CTCCCAGGTACCAGGCCCTGGGG - Intronic
1084784293 11:71433190-71433212 TTCCCAGGGATCAGGCACTGTGG + Intronic
1085239967 11:75044968-75044990 CTCCCAGGTCTCAGGTGCTGCGG - Intergenic
1086377629 11:86217207-86217229 CTCCCAAGTAGCTGGCACTGTGG - Intergenic
1086575927 11:88338745-88338767 CTACTAGGTGTCAGGCCCTGTGG + Intergenic
1087076105 11:94128669-94128691 CTCCCGGGTGCCAGGACGTGAGG + Intergenic
1088542662 11:110929413-110929435 CTACTATGTACCAGGCACTGAGG + Intergenic
1088568506 11:111198064-111198086 CTGCCATGTGCCAGGCACTGAGG - Intergenic
1088937444 11:114417471-114417493 CTCCCAGGAACCAGGAACAGAGG + Intronic
1089401415 11:118166624-118166646 CTCCCACCTGCCAGTCCCTGGGG - Exonic
1089500469 11:118928957-118928979 GTGGCAGGTGCCAGGCCCTGGGG - Intronic
1089681589 11:120121821-120121843 CATCCATGGACCAGGCCCTGGGG - Intronic
1090568915 11:128026149-128026171 TTCCCAGGAAGCAGACCCTGAGG - Intergenic
1091252611 11:134156212-134156234 CTCCCAGGTTCCAGGCACTGTGG + Intronic
1091778371 12:3199233-3199255 CTCCCAGAGGCCAAGCCCTGTGG + Intronic
1091853303 12:3718412-3718434 CTCCCAGTTTCCATGCCTTGGGG + Intronic
1091857441 12:3751232-3751254 CTGCCATGTGCCAGGGCCTGTGG - Intronic
1092408897 12:8239357-8239379 CTCCCAGCCAGCAGGCGCTGCGG - Intergenic
1094524879 12:31224955-31224977 CTGCCAGATTCCAGGCCCTGTGG + Intergenic
1096122539 12:49097567-49097589 CTCTCAGATTCCAGGTCCTGAGG + Exonic
1096193030 12:49632527-49632549 CCCCCAGGACCCAGGCCATGGGG - Intronic
1097233282 12:57524902-57524924 CTCACAGGTTCCAGCCCCTCAGG + Intronic
1098352660 12:69580630-69580652 CTCCCAAGTAGCTGGCCCTACGG + Intergenic
1100386457 12:94108962-94108984 CTCCCAGGTCTCAGGACCTGGGG - Intergenic
1101904514 12:108814777-108814799 CTCCCAGGTCCCTCTCCCTGTGG - Intronic
1102061922 12:109939106-109939128 CTGCCAGGTCTCTGGCCCTGGGG + Intronic
1102252518 12:111397162-111397184 GTCCCAGGCATCAGGCCCTGAGG - Intergenic
1102911111 12:116714827-116714849 TTGCCAGATCCCAGGCCCTGTGG + Exonic
1103253923 12:119523878-119523900 CTGCCAGGTGCCAGGTGCTGGGG + Intronic
1103736754 12:123065498-123065520 TTCCAAGGCACCAGGCTCTGTGG + Intronic
1104639881 12:130460765-130460787 GTCCCCGGCGCCAGGCCCTGGGG - Intronic
1105836623 13:24217767-24217789 CTCCCAGGTCCGAGGTCCTGTGG - Intronic
1106103439 13:26713927-26713949 CTCCCCAGTTCCAGTCCCTGAGG - Intergenic
1107559001 13:41543962-41543984 CTGCCTGGCACCTGGCCCTGGGG - Intergenic
1107719710 13:43235443-43235465 CACCCAGGGACCAGGCGCGGTGG + Intronic
1110694050 13:78466369-78466391 GACCCAGGTACCAAGCCCTCAGG + Intergenic
1112172655 13:96990513-96990535 CTTCCATGTGCCAGCCCCTGGGG - Intronic
1113088804 13:106595872-106595894 CTCCCAGGCACCAGGCCCAGTGG + Intergenic
1113594992 13:111524887-111524909 CTCCCTAGTTCCAGGCTCTGTGG - Intergenic
1113965385 13:114150219-114150241 CACCCAGGTGCCAAGCACTGGGG - Intergenic
1117282994 14:54258684-54258706 CCACCAGGTGCCAGGCCCTGGGG + Intergenic
1117625856 14:57637446-57637468 CGCCCAGCTCCCTGGCCCTGTGG + Intronic
1117955023 14:61116197-61116219 CTCCCAGGTCTCAGGTGCTGTGG + Intergenic
1118816607 14:69318559-69318581 CACCCATCTACCAGGCACTGGGG - Intronic
1119265297 14:73260632-73260654 ATCCCAGGACCCAGGCTCTGAGG - Intronic
1119470961 14:74898829-74898851 CCCCAAGGTAACAGGGCCTGTGG - Intronic
1119688733 14:76654113-76654135 TTATCAGATACCAGGCCCTGGGG + Intergenic
1119744390 14:77033769-77033791 CGCCCAGGTACCAGGCCTAGAGG + Intergenic
1120853516 14:89192916-89192938 CTTGCAGGCAACAGGCCCTGTGG - Intronic
1121336981 14:93083585-93083607 CCTCCAGGTACCAGGCACTGGGG + Intronic
1121408350 14:93732949-93732971 CACCCAGGTGCCAGGCACGGGGG + Intronic
1122073599 14:99221557-99221579 CTGCCAGGTACAAGGCCAGGCGG + Intronic
1122096882 14:99378824-99378846 CTCCTACTTCCCAGGCCCTGGGG + Intergenic
1122458438 14:101875562-101875584 CTCCTAGGTGCCAGGCACAGTGG + Intronic
1122823224 14:104357431-104357453 CTACCAAGGACCAGGCCCTGGGG - Intergenic
1123716703 15:23039183-23039205 GTCCCGGGTAACACGCCCTGTGG + Intronic
1123944011 15:25230253-25230275 CACCCAAGTACCAGGCTCAGAGG + Intergenic
1124038960 15:26082584-26082606 TTCCTAGGGACCAGGGCCTGAGG - Intergenic
1127355016 15:58189670-58189692 CTACCATGTTCTAGGCCCTGGGG - Intronic
1127826620 15:62709365-62709387 TTACCTGGTACCTGGCCCTGGGG + Intronic
1128364329 15:66986715-66986737 GTCCTAGTTACCAGGCCCTAGGG - Intergenic
1128695962 15:69763054-69763076 CTCCCAGGGACCAGCCAGTGTGG + Intergenic
1128806631 15:70536002-70536024 CTCCCATGTACCAGACTCTGCGG + Intergenic
1129450248 15:75647591-75647613 GTCCCAGGGACCAGCCCCGGAGG + Intronic
1129655899 15:77525685-77525707 CTCACTGGTCCCAGGACCTGTGG + Intergenic
1129897359 15:79118189-79118211 CTACCATGAGCCAGGCCCTGTGG - Intergenic
1129969994 15:79769687-79769709 CTACCATGTGCCAGGCCCTTGGG + Intergenic
1130338699 15:82980314-82980336 TTGCCTGGTACCTGGCCCTGGGG - Intronic
1131111374 15:89767172-89767194 TGCCCATGTACCAGCCCCTGGGG + Intronic
1131757737 15:95583943-95583965 CTTCCAGGTACCTGGCCTTAGGG - Intergenic
1132018439 15:98339361-98339383 GTCCCAGGATCCAGGGCCTGCGG + Intergenic
1132041078 15:98525015-98525037 CCCCCAGGGACCTGTCCCTGTGG - Intergenic
1132471405 16:105623-105645 CTCCGAGTTAACAGGACCTGTGG - Intronic
1132573280 16:653327-653349 CCCCCTTGTGCCAGGCCCTGTGG + Exonic
1132664456 16:1075253-1075275 CTGCCAGGTCCCCGGCTCTGCGG - Intergenic
1132725049 16:1334788-1334810 CTCCCCTTCACCAGGCCCTGGGG - Intronic
1132749580 16:1451328-1451350 CTCCCAAGTACCTGGGACTGTGG + Intronic
1132858476 16:2058059-2058081 ATCCTTGGAACCAGGCCCTGGGG + Intronic
1132959224 16:2612869-2612891 CCCGCAGGCACCAGCCCCTGTGG + Intergenic
1132972284 16:2694844-2694866 CCCGCAGGCACCAGCCCCTGTGG + Intronic
1133025113 16:2985810-2985832 CTCCCAGGCACCCTGGCCTGAGG - Intergenic
1133317777 16:4894831-4894853 CTCCCAATTCCCAGTCCCTGTGG + Intronic
1133349864 16:5094174-5094196 CTCCCAGCCAGCAGGCACTGTGG - Intronic
1136367078 16:29813798-29813820 CTCCCAGTTGGCAGGTCCTGGGG + Exonic
1137537394 16:49337777-49337799 CTACCATGTACCATGCACTGTGG - Intergenic
1137593609 16:49709056-49709078 CTACTATGTACCAGGCCCTGAGG + Intronic
1137788377 16:51154724-51154746 CCCCTAAGTACCAGGCCCTCTGG - Intergenic
1138130978 16:54479693-54479715 CTACCAGGTACTAGGCACTGTGG - Intergenic
1139440074 16:66962168-66962190 CTTCCTGGTACCCGGCTCTGTGG + Intronic
1139656137 16:68388234-68388256 CTGCCAGGTACTTGGCTCTGAGG - Intronic
1139941726 16:70610478-70610500 CAAGCAGGTGCCAGGCCCTGAGG + Intronic
1140522530 16:75594080-75594102 CTTTCTGGTACCTGGCCCTGCGG + Intergenic
1141888784 16:86912267-86912289 CTACCAGGTGCCAGTCACTGGGG + Intergenic
1141892326 16:86934704-86934726 ACCCCACGTACCAAGCCCTGTGG - Intergenic
1141939969 16:87269087-87269109 CTGTCAGGTACCTGGCCCTGGGG - Intronic
1142135887 16:88451916-88451938 CTCTCCTGTACCAGGCTCTGAGG + Intergenic
1142141624 16:88475255-88475277 CTGGCAGGGCCCAGGCCCTGGGG + Intronic
1142144639 16:88487762-88487784 CTGGCAGGCAGCAGGCCCTGGGG + Intronic
1142319338 16:89370933-89370955 CGCCCAAGAACCAAGCCCTGCGG + Intronic
1142645664 17:1312522-1312544 CTCCCAGCCACCTGGCCCTGGGG - Intergenic
1142734657 17:1888899-1888921 CTCCCGTGTGCCAGGCACTGTGG + Intronic
1142787163 17:2233395-2233417 CTCCCAGGTACTGGGGTCTGTGG - Intronic
1142830495 17:2545552-2545574 CTCAGAGGTCACAGGCCCTGTGG + Intergenic
1144726895 17:17506692-17506714 CTCCCAGAAACCATGCTCTGAGG + Intronic
1144734471 17:17547307-17547329 CTGCCAAGTGCCAGGCCCTGGGG + Intronic
1144931250 17:18860621-18860643 CTTCCAGCTACTAGGCCATGTGG - Intronic
1145366606 17:22270981-22271003 ATCCCAGGGGCCAGGCCCTAAGG + Intergenic
1146012489 17:29207029-29207051 CTACCAGGTGCCAGGTACTGAGG - Intergenic
1146474791 17:33154044-33154066 TTCCCAGGAAGCAGACCCTGAGG - Intronic
1147348421 17:39821149-39821171 GTCTCAAGTACCAGGCCCTCAGG - Intronic
1147478707 17:40738573-40738595 GTGCCTGGTACCTGGCCCTGGGG - Intergenic
1147602035 17:41752763-41752785 CTCCCTGGGACAAGACCCTGTGG - Intergenic
1147673451 17:42189874-42189896 CTCCCCGCTACAAGTCCCTGCGG - Exonic
1148198619 17:45733016-45733038 CTCACAGGTACCGGCCTCTGTGG + Intergenic
1148233700 17:45953131-45953153 CTACCTGCTGCCAGGCCCTGGGG + Intronic
1148795794 17:50196114-50196136 CTCCCCACTCCCAGGCCCTGAGG + Intronic
1151254850 17:72868684-72868706 CTCCCAAGTAGCTGGGCCTGTGG - Intronic
1151459472 17:74245997-74246019 CTCCAAGCTTCCAGGCCCTGGGG + Intronic
1151815838 17:76471013-76471035 CTCCCTGGGAGCAGGCCCTGGGG + Exonic
1152456729 17:80421327-80421349 CTCCTATGGACCAGGTCCTGGGG + Intronic
1152539999 17:80970047-80970069 TTCCCAGCTCCCAAGCCCTGTGG - Intergenic
1152759672 17:82101310-82101332 CTACCTGCTACCAGGCTCTGAGG + Intergenic
1152995126 18:399526-399548 CTCCTAAGTGTCAGGCCCTGGGG + Intronic
1153707595 18:7762246-7762268 CTCCCAGGTACCTGTTGCTGAGG - Intronic
1155426480 18:25712801-25712823 TTACTAGGTACCAGACCCTGAGG - Intergenic
1155565443 18:27128954-27128976 CTCCTATGTTCTAGGCCCTGTGG + Intronic
1159934555 18:74352520-74352542 CTACCACGTACCAGGCACTGTGG + Intronic
1160552959 18:79706801-79706823 CTCCCAGGGAGCAGGCCATGCGG - Intronic
1160708798 19:541332-541354 CCCCCAGGAAGCAGGTCCTGGGG + Exonic
1160770129 19:827472-827494 CCCCCCGGTGCCAGGCCCAGCGG + Intronic
1160806487 19:994390-994412 CTCCCAGCAACCAGGGCCCGCGG + Exonic
1160881630 19:1323441-1323463 CTCCCAGGTGCCAGCCCAGGTGG + Intergenic
1161343350 19:3754324-3754346 GTCACAGGGACCAGGCACTGAGG + Exonic
1161575796 19:5053597-5053619 CTCCCAGGGACCATGGGCTGGGG - Intronic
1161807693 19:6454507-6454529 CTCCCAGGTGTCAGGCCTGGGGG + Intronic
1163729813 19:18942227-18942249 CTCCCTGGAACCAAGGCCTGTGG + Intergenic
1164477993 19:28590011-28590033 CTCCTGTGTACCGGGCCCTGTGG - Intergenic
1165139148 19:33688754-33688776 GTCCCTGGTACCCGGCCCGGTGG - Intronic
1165250684 19:34531470-34531492 CTGTCTGGTACCTGGCCCTGGGG - Intergenic
1165871290 19:38975458-38975480 CTCCCAGGGACCCGCCCCTCCGG + Intronic
1165968566 19:39605405-39605427 CTCCCAGCACCCAGGCTCTGTGG + Intronic
1166419144 19:42621367-42621389 CTCCTATATGCCAGGCCCTGTGG + Intronic
1167459019 19:49614683-49614705 CTCCTAGATACCACGCCCCGGGG - Intronic
1168295034 19:55374178-55374200 CAGCCAGGGCCCAGGCCCTGGGG + Intergenic
925424459 2:3737112-3737134 CCCCCAGGTGCCAGGCCCTGGGG + Intronic
925744601 2:7033406-7033428 CTCCCAGGTTCCAAGACCAGTGG - Intronic
925907910 2:8550483-8550505 CTCCCAGGTCCCCGGCCCACAGG - Intergenic
926586700 2:14694043-14694065 CTACCAGGAGCCAGGCACTGTGG - Intergenic
927442290 2:23127779-23127801 CCCACAGGAACCAGGCGCTGAGG + Intergenic
927939261 2:27093484-27093506 CTACCATGTCCCAGGCACTGGGG + Intronic
927941088 2:27103217-27103239 GTCACAGCTACCAGCCCCTGTGG + Intronic
928377119 2:30784338-30784360 ATCCCAGGGAATAGGCCCTGAGG + Intronic
929950669 2:46407363-46407385 CTACCAGGTGCCAAGCACTGTGG + Intergenic
931698241 2:64888283-64888305 CTCCCAGGTCTCAGGTGCTGCGG + Intergenic
933767729 2:85721781-85721803 CCACCAAGCACCAGGCCCTGAGG - Intergenic
933772786 2:85754583-85754605 CCCCCAGGTGCCTGGCTCTGGGG - Exonic
934131699 2:88954954-88954976 CTCCCAGGTCCTCAGCCCTGTGG - Intergenic
934610345 2:95730822-95730844 CTCACAGGTACCAGGCTCTGTGG + Intergenic
934976265 2:98804970-98804992 CCACTAGGTGCCAGGCCCTGGGG + Intronic
935573879 2:104689286-104689308 CTCCCAGGTACCTGGGACTATGG + Intergenic
935729437 2:106053261-106053283 CTCCCAGATGCCAGTCTCTGTGG + Intergenic
936155227 2:110042720-110042742 GTCTCATGTGCCAGGCCCTGGGG - Intergenic
936189454 2:110328693-110328715 GTCTCATGTGCCAGGCCCTGGGG + Intergenic
936376024 2:111942144-111942166 CTCCCGGGTCCCAGACCTTGAGG + Intronic
937150610 2:119683281-119683303 GTCCTAGGTACCAGGGCCTGGGG - Intronic
937201346 2:120206320-120206342 CTACCAGGCACCAGGCACAGTGG + Intergenic
937885418 2:126896423-126896445 CTCCCAGGTACCAGGGACAAAGG - Intergenic
937980181 2:127610066-127610088 CTACCAGGGCCCAGTCCCTGGGG + Intronic
938382740 2:130845818-130845840 CTCCAGGGAACCAGGCCCAGTGG + Intronic
938444446 2:131366603-131366625 CCCCCAGCCACCAGGCCCCGGGG - Intergenic
939280050 2:140052186-140052208 CTAAAAGGTGCCAGGCCCTGTGG + Intergenic
943782690 2:191842402-191842424 TTCACAGGTAACTGGCCCTGAGG - Intronic
944084620 2:195830898-195830920 CTACCATGTACCAGGCAGTGTGG - Intronic
944581520 2:201136970-201136992 CTCCCCAGTCCCTGGCCCTGGGG - Intronic
946972718 2:225112915-225112937 TTCCCAGGGAACAGGCACTGTGG - Intergenic
947614856 2:231549378-231549400 CTCCCTAGTACCAGGCCCACAGG + Intergenic
947626511 2:231622557-231622579 ATCCCAGGTACCTGGCCAAGAGG - Intergenic
948453675 2:238094020-238094042 CTCCCAGACCCCAGGACCTGTGG + Intronic
948515880 2:238503687-238503709 CGCCCAGGCAGCTGGCCCTGTGG + Intergenic
948778236 2:240301069-240301091 GTCCCCTGTGCCAGGCCCTGGGG - Intergenic
948795293 2:240399496-240399518 TTCCCAGGCCCCTGGCCCTGAGG + Intergenic
948829803 2:240593104-240593126 CTCCCAGGTGGGAGGCTCTGAGG - Intronic
1169204734 20:3733186-3733208 CTCAGGGGTCCCAGGCCCTGTGG + Intronic
1169289575 20:4337527-4337549 CTCCTCTGTGCCAGGCCCTGTGG + Intergenic
1169416809 20:5424162-5424184 CTCACAGGTTCCAGGGACTGGGG + Intergenic
1169545564 20:6647179-6647201 CTCCTATGCAGCAGGCCCTGAGG + Intergenic
1170714033 20:18816968-18816990 CTCCCAGGTAGCAGGGGCTTAGG - Intronic
1171366823 20:24630669-24630691 CTCCCAGGACCCAGGACCTCAGG - Intronic
1172094693 20:32454929-32454951 CTCCCTGGGACCAGGCCCGCAGG + Intronic
1172386062 20:34534975-34534997 CTCCCAGGGACCGGCCCCAGAGG + Intronic
1172501459 20:35430994-35431016 CTCCCAAGTACCAGGACCACAGG - Intergenic
1172507569 20:35474920-35474942 CTACCAGGTACAAGGAACTGGGG - Intronic
1173388019 20:42606456-42606478 CTGCTATGTGCCAGGCCCTGGGG + Intronic
1173827917 20:46058915-46058937 CTCCCGGGGACCTGGGCCTGAGG + Intronic
1174456488 20:50652255-50652277 CTCCCAGGCTCCAAACCCTGAGG + Intronic
1174574420 20:51526517-51526539 CTTGCAAGTGCCAGGCCCTGTGG - Intronic
1175277596 20:57782788-57782810 CGCCCCGGTTCCAGTCCCTGAGG - Intergenic
1175278397 20:57787374-57787396 CTCCCAGGAAACATGCCCGGAGG - Intergenic
1175879710 20:62250136-62250158 CTACCTGGTGCCAGGCCTTGAGG - Intronic
1175983892 20:62754845-62754867 CTGGCAGGGTCCAGGCCCTGCGG + Exonic
1176121667 20:63456872-63456894 CTCCCAGGTCCCCAGCCCCGGGG - Intronic
1176218106 20:63957699-63957721 CTCTCAGGTACTTGGCCCTTGGG - Exonic
1176249352 20:64112883-64112905 CACCCAGGGACACGGCCCTGAGG - Intergenic
1177054905 21:16289652-16289674 CTCCAGGGTGCCAGGCACTGTGG - Intergenic
1178567781 21:33703975-33703997 CTCTGAGGTCCCTGGCCCTGTGG - Intronic
1179643914 21:42763934-42763956 CTCCCTGGGACGGGGCCCTGAGG + Intronic
1180023584 21:45145443-45145465 CTGCCTGCTACCAGGCCCTGGGG + Intronic
1180050126 21:45327282-45327304 CTCTCAAGGAACAGGCCCTGGGG + Intergenic
1180173143 21:46071259-46071281 CTCCCAGGTGCCAGGTTCTCAGG - Intergenic
1180255398 21:46624069-46624091 CTCCCTGGAACGAGGCCCAGGGG + Intergenic
1180790934 22:18575189-18575211 CTCCCAGGGATCAGGTACTGGGG + Intergenic
1181230801 22:21420125-21420147 CTCCCAGGGATCAGGTACTGGGG - Intronic
1181247846 22:21514744-21514766 CTCCCAGGGATCAGGTACTGGGG + Intergenic
1181864940 22:25847477-25847499 CTGCCTGGTACCAAACCCTGTGG + Exonic
1182080348 22:27524395-27524417 CTGCCAAGGACCAGGGCCTGGGG - Intergenic
1182421574 22:30251039-30251061 TTTCCAGGTACCAGGGCCAGAGG - Intergenic
1184116774 22:42426898-42426920 GTCCCAGGTGCCACGCCCTGAGG + Intronic
1184594172 22:45503898-45503920 CCCCCAGGGACCAGGCCTTGAGG - Intronic
1185223958 22:49642723-49642745 CTCCCAGGTACCAGGACATCAGG + Intronic
1185310224 22:50150257-50150279 GTCCCAGTCACCAGGCACTGTGG + Intronic
1185311568 22:50158617-50158639 CTTCCTGGGACCAGCCCCTGGGG - Intronic
949574517 3:5325730-5325752 TTCCCAGGAAGCAGACCCTGAGG - Intergenic
949905778 3:8857291-8857313 ATACCAGGTACCAGGGGCTGTGG - Intronic
950012529 3:9733056-9733078 CTACCAAGTGCCAGGCCCTAAGG - Intronic
950012714 3:9734383-9734405 CTCACAGTCACCAGGCCGTGAGG + Exonic
950116240 3:10451904-10451926 CTACTATGTACCAGGCACTGTGG + Intronic
950139678 3:10606822-10606844 CTACTATGTGCCAGGCCCTGGGG - Intronic
950545764 3:13637149-13637171 CTCCCAAGTGCCGGGCCGTGTGG - Intronic
950831631 3:15880089-15880111 CTCCCCTGTCCCTGGCCCTGGGG + Intergenic
951162536 3:19442169-19442191 CTACAATGTGCCAGGCCCTGTGG + Intronic
953918628 3:46936870-46936892 CTCACAGGCAGCAGGCCCTGGGG + Intronic
955496930 3:59543084-59543106 CTCCCAGATTCAAGGCACTGAGG + Intergenic
956650171 3:71497728-71497750 CTCCCAGGGATGAGCCCCTGGGG - Intronic
958609837 3:96410680-96410702 CTCCTAGGTACCTGGGACTGAGG + Intergenic
960965938 3:123104756-123104778 CTCACAGCTACTGGGCCCTGAGG - Intronic
961340433 3:126213538-126213560 GCCCCAGGCGCCAGGCCCTGCGG - Intergenic
961662253 3:128475580-128475602 CACCCTGGTACCAGGCCCTGGGG + Intergenic
961736215 3:129003642-129003664 CTTCCGGGTGCCAGGCCCTTAGG - Intronic
961887826 3:130107899-130107921 CTCCCAGCCAGCAGGCACTGCGG - Intronic
963831598 3:150014895-150014917 CTCCCAGGTGGCTGGCCCTGTGG + Intronic
968506926 4:974962-974984 CTCCCAGGGCCCAGGCACAGGGG - Intronic
968663980 4:1810739-1810761 CACACTGGGACCAGGCCCTGTGG - Intergenic
968715803 4:2158564-2158586 CTCACAGCTGCCAGGCCCTCAGG + Intronic
968736597 4:2300500-2300522 CTCCCAGGTGACAGCACCTGAGG + Intronic
968801197 4:2744219-2744241 CGCCCAGGTACCAGGCCAGGTGG + Intronic
969757041 4:9156849-9156871 CTCCCAGCCAGCAGGCACTGCGG + Intergenic
969817000 4:9694424-9694446 CTCCCAGCCAGCAGGCACTGCGG + Intergenic
969907504 4:10410843-10410865 CACCCAGCTCCCGGGCCCTGCGG - Intergenic
970487829 4:16542196-16542218 CTACCAGGTTCCAGGCACTTGGG + Intronic
973759653 4:54104246-54104268 CCCCCGGCTCCCAGGCCCTGCGG + Intronic
973951963 4:56025019-56025041 GTCCCAGGTACCAGCTGCTGGGG + Intronic
976270175 4:83222488-83222510 GGGCCAGGTAGCAGGCCCTGGGG - Intergenic
976874397 4:89836614-89836636 CTCCCAGAGACCTGGCCCAGCGG + Intronic
976969846 4:91091676-91091698 CTCCCAGGTTCCAGTGGCTGCGG + Intronic
980975128 4:139604022-139604044 CTACTATGTACCAAGCCCTGGGG + Intronic
983656048 4:170086120-170086142 CTCCCAGGTAGCTGGGACTGCGG - Intronic
985667220 5:1187445-1187467 CTCACAGGGACCAAGCCCTCAGG - Intergenic
985793472 5:1945422-1945444 CTTCCTGGTGCCTGGCCCTGTGG + Intergenic
991248553 5:64533861-64533883 CTACTATGTACCAGGCACTGGGG + Intronic
996445854 5:123549503-123549525 CTTCCAGGTACCTGGCCCTGGGG - Intronic
997085264 5:130789856-130789878 CTCCCAGTGACCAGGCGCAGTGG + Intergenic
997209588 5:132069580-132069602 TTCCCAGGTTCCTGGCACTGGGG - Intergenic
999374277 5:151076022-151076044 CTCCCAGGGACCTCACCCTGAGG - Intronic
999447802 5:151654665-151654687 CTCTCAGGTAACATCCCCTGTGG + Intergenic
999637038 5:153633851-153633873 CTCCCATGTGCCAGGCACTGTGG + Intronic
999802885 5:155054158-155054180 CTACCATATGCCAGGCCCTGAGG - Intergenic
1001247102 5:170112993-170113015 CTGCCATGCACCAGGCCCTCGGG + Intergenic
1002250357 5:177925110-177925132 CTCCCGAGTGCCAGGCCCTAAGG - Intergenic
1002330558 5:178437630-178437652 TTCTCAGGGCCCAGGCCCTGAGG + Intronic
1002559624 5:180072303-180072325 CTCCCGGGCTCCACGCCCTGCGG - Intergenic
1002607085 5:180389886-180389908 CCCCCAGGAGCGAGGCCCTGTGG - Intergenic
1002622109 5:180494955-180494977 CTCCCAGGGACTCGGCCCGGGGG - Intronic
1002925577 6:1604352-1604374 AAACCAGGTGCCAGGCCCTGCGG + Intergenic
1003149520 6:3537080-3537102 CTGCCACGTGCCAGGCCCTCAGG - Intergenic
1003494164 6:6649401-6649423 CTTCCATGTGGCAGGCCCTGGGG - Intronic
1004352688 6:14904008-14904030 CTCTCAGGCACCAGGCACTGTGG + Intergenic
1004731741 6:18366191-18366213 CTCCCCTGTCCCAGGCCCTGGGG - Intergenic
1005104209 6:22205755-22205777 CTCCCGTGTTCAAGGCCCTGGGG + Intergenic
1006106073 6:31717678-31717700 CTCCCAGGTAGCAGTCCCTGTGG - Exonic
1006911100 6:37564151-37564173 CTCCCCTGTTCCAAGCCCTGGGG + Intergenic
1011318626 6:86065242-86065264 CTCCCAGTTAGCAGGCACAGGGG + Intergenic
1011565541 6:88668283-88668305 CTCCCAGGTCTCAGGTGCTGTGG - Intronic
1011618260 6:89217846-89217868 CACGCAGGTACCGAGCCCTGGGG - Intronic
1015501990 6:133944226-133944248 CTGCCAGGGACCAGGCACAGTGG - Intergenic
1015540186 6:134305968-134305990 CCCCCAGGGGCCAGGTCCTGAGG + Intronic
1015565222 6:134563134-134563156 CTCCCAGGGGCCAAACCCTGGGG + Intergenic
1017016094 6:150100695-150100717 CCCCCAGCTTCCAGGCCCCGGGG - Intergenic
1018711638 6:166501587-166501609 CTCCCAGGTATCCTGCCGTGGGG + Intronic
1018756145 6:166851245-166851267 CTCCCAGGTCTGAGCCCCTGAGG - Intronic
1018812531 6:167308281-167308303 CTCCCGTGTACCTGGGCCTGGGG + Intronic
1018845413 6:167552054-167552076 CTCCCAGGAAGCAGGTGCTGTGG + Intergenic
1018906693 6:168079839-168079861 CTCAGGGGTTCCAGGCCCTGCGG - Intronic
1019659865 7:2218230-2218252 GTCCCAGGCCCCAGCCCCTGTGG + Intronic
1020321255 7:6940213-6940235 CTCCCAGCCAGCAGGCGCTGCGG - Intergenic
1021376081 7:19908629-19908651 CTCCCAGCAGCCAGGCGCTGTGG + Intergenic
1021849181 7:24791090-24791112 CTCCCAGGTCTCAGGTGCTGCGG + Intergenic
1022639777 7:32170912-32170934 TTGCCTGGTACCAGGCCCTGGGG - Intronic
1023623416 7:42094790-42094812 CTGCCAGGTACCAGGCCCCACGG + Intronic
1023806393 7:43875940-43875962 CTACAATGTGCCAGGCCCTGGGG + Exonic
1024229895 7:47355830-47355852 CTGGCAGATCCCAGGCCCTGAGG + Intronic
1024942261 7:54775277-54775299 CACCCAGGTTCCACGCACTGTGG + Intergenic
1024948231 7:54833371-54833393 CGCACTGGTTCCAGGCCCTGCGG + Intergenic
1024980816 7:55156184-55156206 CTGCCAGGTGCCCAGCCCTGGGG + Intronic
1025943513 7:66089723-66089745 CCCCTAGGTCCCAGGCACTGGGG + Intronic
1026928536 7:74210213-74210235 CACCCTGGCACCAGGCTCTGTGG + Intronic
1026950335 7:74342479-74342501 ATCCCAGGTCCCTGGCCCTGTGG - Intronic
1026968706 7:74455109-74455131 CTCCCAGGACCAAGGTCCTGCGG + Intronic
1029207461 7:98878324-98878346 CTCCCAGGAGCCAGGCCTCGGGG - Intronic
1030245228 7:107377955-107377977 CTCCCAGGCAGGAGGCACTGTGG - Intronic
1031388480 7:121182860-121182882 CTTCCATGTACCAGGCACAGTGG - Intronic
1031565030 7:123285378-123285400 TTGCCTGGTACCGGGCCCTGGGG + Intergenic
1032006490 7:128306001-128306023 TTGCCATGTACCAGGCCCAGGGG + Exonic
1033303490 7:140207475-140207497 CTCCAGGGTGCCAGGCCCCGTGG + Intergenic
1033420850 7:141203531-141203553 CTTCCATGTACAAGGCACTGTGG + Intronic
1034474354 7:151274150-151274172 CTCCAAGGCCGCAGGCCCTGAGG + Intronic
1035225887 7:157431957-157431979 CCCCCTGGGACCAGGCCTTGGGG + Intergenic
1035271046 7:157720152-157720174 CCACCAGGGACCAGGCCCCGGGG + Intronic
1035746433 8:1964837-1964859 CACCCAGGTTCCAGGATCTGTGG + Intergenic
1035953548 8:4051209-4051231 CTCCCAGGGACCAGGCCTGTGGG + Intronic
1036185027 8:6615171-6615193 CACCCAGGTCTCAGGACCTGAGG + Intronic
1036380271 8:8232164-8232186 CTCCCAGGCAGCAGGCGCTGCGG + Intergenic
1036849289 8:12190496-12190518 CTCCCAGCCAGCAGGCGCTGCGG - Intronic
1036870649 8:12432770-12432792 CTCCCAGCCAGCAGGCGCTGCGG - Intronic
1037608729 8:20458859-20458881 CAGCAGGGTACCAGGCCCTGGGG - Intergenic
1037796502 8:21999854-21999876 TTCCTAAGTACAAGGCCCTGTGG + Intronic
1038477466 8:27878140-27878162 CACCCAGTTACCAGGCCCCCTGG - Intronic
1041245159 8:55881863-55881885 CTACTATGTACCAGGCACTGGGG - Intronic
1043443203 8:80295013-80295035 CTCCTAGGTACCTGGCATTGAGG - Intergenic
1043506733 8:80910067-80910089 TGCCCAGCTTCCAGGCCCTGGGG + Intergenic
1045324614 8:101109083-101109105 CTCGCATGTACCAGACCCAGCGG - Intergenic
1045582818 8:103499464-103499486 CGCCCAGGTGTCAGGACCTGAGG - Intergenic
1047229126 8:122980932-122980954 CTCCCTGTTCCCAGGCCCTAGGG - Intergenic
1047275635 8:123402614-123402636 CTCCCCTGTCCCTGGCCCTGGGG + Intronic
1047854917 8:128899025-128899047 TTCACAGGTACCTGGCCCTTAGG + Intergenic
1048522470 8:135169506-135169528 CTCCCATGCCCCAGACCCTGGGG - Intergenic
1048543975 8:135368734-135368756 CACCCAGCTACCAGGCCTTTTGG + Intergenic
1048957178 8:139546825-139546847 CTCCCAGGTTTCAGGCACTGTGG + Intergenic
1049497505 8:142943277-142943299 CCCCCAGGGCCCAGCCCCTGGGG + Intergenic
1049801589 8:144520231-144520253 CTCCCAGGAAGCATGCGCTGCGG + Exonic
1050535138 9:6624444-6624466 CTCCCAGGTTCCTTGGCCTGTGG - Intronic
1052916379 9:33926924-33926946 CTGCCAGGTGCCAGCCCCCGAGG + Intronic
1052941056 9:34132637-34132659 CTCCCCTGTCCCTGGCCCTGGGG - Intergenic
1053287836 9:36861319-36861341 CTACTAGGTACCAGGTCCTGAGG + Intronic
1053596507 9:39567015-39567037 CTCCCATGCAGCAGCCCCTGTGG - Intergenic
1054569752 9:66798003-66798025 CTCCCATGCAGCAGCCCCTGTGG + Intergenic
1054953384 9:70879613-70879635 CTACCAGATGCCAGGCACTGGGG - Intronic
1055088468 9:72338195-72338217 CTCCCATGTGCCAAGCCCTCTGG - Intergenic
1056967731 9:91178769-91178791 CTCCCAGGGGCCAGTCCCAGGGG + Intergenic
1057336950 9:94163177-94163199 CTGTCAGGTGCTAGGCCCTGTGG + Intergenic
1057512171 9:95689850-95689872 CACCCTGGTGCCAGGCTCTGAGG - Intergenic
1057519132 9:95747143-95747165 ATACCTGGTAGCAGGCCCTGGGG + Intergenic
1058679069 9:107425612-107425634 CTCCAGGGTCCCAGGCCTTGTGG + Intergenic
1059123243 9:111661425-111661447 CACCCAGGTTTCAGGCGCTGAGG + Exonic
1059285586 9:113169057-113169079 CTACCATGTACAAGGCTCTGTGG - Intronic
1060062762 9:120475817-120475839 CTACTCTGTACCAGGCCCTGGGG + Intronic
1060087251 9:120714122-120714144 CTCCCACGGCCCAGGCCCCGAGG - Exonic
1060429735 9:123540418-123540440 CTCCTCTGTACCAGGCCCAGTGG - Intronic
1060499839 9:124144803-124144825 CTCCCAGGAACCAGGAGCCGAGG - Intergenic
1060730360 9:126033337-126033359 ATCCCAGTTGCCAGGCCCTTGGG + Intergenic
1060773429 9:126349212-126349234 TTGTCAGGTACCTGGCCCTGGGG + Intronic
1060785510 9:126449148-126449170 CTCCCATGTGCCCAGCCCTGGGG + Intronic
1061149713 9:128821796-128821818 TTACCATGGACCAGGCCCTGGGG - Exonic
1061267517 9:129515499-129515521 CTCCCAGGTAGCTGGGACTGTGG + Intergenic
1061450783 9:130665986-130666008 CTCTCTGCTCCCAGGCCCTGGGG - Intronic
1061576545 9:131510791-131510813 CTCCCAGCTGCCAGGCGCGGTGG - Intronic
1061763881 9:132869430-132869452 CACCCAGGAAGCAGGCCCTGCGG + Intronic
1061884186 9:133583355-133583377 CTCCCCAGTACCTGTCCCTGAGG - Intronic
1062348145 9:136125000-136125022 CTGCCAGGTACCAGGAACTCAGG - Intergenic
1062529365 9:136993149-136993171 CTCCAAGGTACCAGGCCCAGAGG + Exonic
1062616048 9:137396253-137396275 CTCCCAGGGGCCAGGCGCGGTGG - Intronic
1062636969 9:137496760-137496782 CTCCAAGGTGCCACGGCCTGGGG - Intronic
1185507693 X:642570-642592 CTCCTGGGTACCTGGCCTTGAGG + Intronic
1185998228 X:4977667-4977689 CTCCCAGGTCTCAGGCCTTCAGG - Intergenic
1186493942 X:9997053-9997075 CTCCCAGCAACCAGACTCTGTGG - Intergenic
1186590775 X:10927924-10927946 CCCCCAGGAACCAGTCCCTTAGG + Intergenic
1187985484 X:24806282-24806304 CTCCCATGTACCAGGCCCTCTGG + Intronic
1189361692 X:40358642-40358664 CTCCCCTGTCCCTGGCCCTGGGG - Intergenic
1190386589 X:49887631-49887653 GTTCCAGATATCAGGCCCTGAGG + Intergenic
1192190344 X:68987580-68987602 CTGGTATGTACCAGGCCCTGTGG - Intergenic
1195354021 X:104021387-104021409 CACCCACGTCCCAGACCCTGGGG - Intergenic
1198394341 X:136207215-136207237 TTCCCAGGGAGGAGGCCCTGAGG + Intronic
1198686450 X:139232726-139232748 TTCCCATAAACCAGGCCCTGTGG + Intergenic
1201680355 Y:16638740-16638762 CTCCCAGGTTCCAGTGGCTGTGG + Intergenic