ID: 1084691922

View in Genome Browser
Species Human (GRCh38)
Location 11:70732565-70732587
Sequence GCTTCTAGGGAGGGGAGGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 892
Summary {0: 1, 1: 0, 2: 4, 3: 51, 4: 836}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084691922 Original CRISPR GCTTCTAGGGAGGGGAGGGT CGG (reversed) Intronic
900619915 1:3581929-3581951 GCTTCCTGGGAGGGCAGGGAGGG - Intronic
900684984 1:3942552-3942574 CCTTCTAAGAAGGGGAGGTTTGG + Intergenic
900930201 1:5731590-5731612 GTTTCTAGACAGGGGAGGGAAGG - Intergenic
901043149 1:6378227-6378249 GATTGTCGGGAGGGGAGGGAGGG + Intronic
901679841 1:10906552-10906574 GATTCTCTGGAGGGGAGGGAGGG - Intergenic
901792918 1:11664040-11664062 GCCTCTAGGGAGGGGACCGCGGG + Intergenic
902206025 1:14868730-14868752 GCTACTAGGGAGGCTGGGGTGGG + Intronic
902428330 1:16342468-16342490 GCTACTAGGGAGGCTGGGGTAGG + Intronic
902523480 1:17037411-17037433 GCTACTTGGGAGGGTGGGGTGGG - Intronic
902590609 1:17471713-17471735 GCTTCTAGGGAGGCTGTGGTGGG - Intergenic
902985499 1:20152041-20152063 GCTTCTCGGGAGGGTGGGGGCGG - Intergenic
904659471 1:32073583-32073605 GCTTCTAAAGAGAGGAGAGTGGG + Intronic
904826823 1:33279134-33279156 GCTACTAGGGAGGCTGGGGTGGG - Intronic
904883925 1:33721607-33721629 GTTCCTAAGGAGGGGAGGGCTGG - Intronic
905083762 1:35350531-35350553 GCATCTTGGGAGGGTGGGGTGGG - Intronic
905107357 1:35572402-35572424 GCTTGTCAGGAGGGGAGGGTTGG + Intergenic
905725745 1:40250441-40250463 GCTACTAGGGAGGGTAAGGTGGG - Intronic
905865690 1:41375306-41375328 GCTACTCGGGAGGGTAGGGCGGG + Intronic
905879734 1:41455759-41455781 GCCTGGAGGGAGGGGAGGGGTGG - Intergenic
906550896 1:46665865-46665887 GCTTCTTTGGAGGGTAGGTTAGG - Intronic
906793048 1:48675268-48675290 GGGTCTAGGGAGGGGAGAGAGGG - Intronic
907099910 1:51821552-51821574 GTTTCTTGAGAGGGGAGGGCAGG + Exonic
907434325 1:54434504-54434526 GCTACTTGGGAGGGTAAGGTGGG + Intergenic
909177876 1:72382945-72382967 GCTACTTGGGAGGGTGGGGTGGG - Intergenic
909261726 1:73498684-73498706 GATTTTAGGGAGGGGAGGCGGGG - Intergenic
909596094 1:77407780-77407802 ACTACTAGAGAGGGGAGGGAAGG - Intronic
909752080 1:79174615-79174637 ACTTCTTGGAAGGGGAAGGTAGG + Intergenic
910077618 1:83299092-83299114 GCTACCAGGGTGGGGAGGGGAGG - Intergenic
910355089 1:86344167-86344189 GGTTGTGGGGAGGGGAGGGGAGG - Intergenic
910432617 1:87173984-87174006 GCTTCATGGAAGGGGAAGGTGGG + Intergenic
910834372 1:91493590-91493612 GCTACTTGGGAGGTGAAGGTGGG - Intergenic
911090256 1:94011966-94011988 TTGTCTAGGGAGAGGAGGGTTGG + Intronic
912272363 1:108224166-108224188 TCTTCTAGGGAGGAGCGGGAGGG + Intronic
912295858 1:108470155-108470177 TCTTCTAGGGAGGAGCGGGAGGG - Intronic
912328015 1:108787214-108787236 GCTACTAGGGAGGCAAGGGTGGG - Intronic
912366728 1:109139881-109139903 GCTACTTGGGAGGGTAAGGTGGG - Intronic
912403990 1:109421073-109421095 GCTGCTAGGGAGGTTAAGGTGGG + Intronic
912459571 1:109821876-109821898 TCTGCTAGGGAGGGGAGGCCTGG - Intergenic
913151333 1:116046972-116046994 GCTACCAGGGTGGGGAGGGAAGG - Intronic
913259788 1:116987765-116987787 GCTGCAAGGAAGGGGAGGATGGG + Exonic
914689667 1:150014286-150014308 GCTACTAGGGAGGCTAAGGTGGG + Intergenic
914796969 1:150928167-150928189 GCTACTCGGGAGGGGGAGGTGGG - Intronic
914854394 1:151340337-151340359 GCTACTAGGGAGGGTGAGGTGGG + Intergenic
914884665 1:151575039-151575061 GGTTGCAGGGAGGGGAGGGCAGG + Intronic
915179008 1:154042209-154042231 GCTTCTAGGGAGGTTGAGGTGGG - Intronic
915182858 1:154078203-154078225 GCTACTAGGGAGGCTGGGGTGGG + Intronic
915190760 1:154148369-154148391 GCTACTGGGGAGGTTAGGGTGGG + Intronic
915220506 1:154370746-154370768 GCTACTTGGGAGGCTAGGGTGGG + Intergenic
915241313 1:154524276-154524298 GCTACTAGGGAGGCTAAGGTGGG - Intronic
915330107 1:155106159-155106181 GCTTCTAGGGAGGCTGAGGTGGG + Intergenic
916045193 1:160994653-160994675 GATCCTGGGGAGGGGAGGTTGGG - Intergenic
916226148 1:162491340-162491362 GATTCTAGGGAGAGGATTGTGGG - Intergenic
916407623 1:164513217-164513239 GCTTCTAGGGAGGCTGAGGTGGG - Intergenic
917102395 1:171459458-171459480 GCTTCTGGGGAGGTTAAGGTGGG + Intergenic
918028872 1:180783140-180783162 GCTACTAGGGAGGCTAAGGTGGG + Intronic
918539140 1:185608818-185608840 TCTACTTGAGAGGGGAGGGTGGG + Intergenic
918603795 1:186396495-186396517 GCTACTTGGGAGGCGAAGGTGGG + Intronic
921297662 1:213719828-213719850 GGTGATAGGGAGGAGAGGGTTGG + Intergenic
921888841 1:220333541-220333563 GCTACTTGGGAGGGTAAGGTGGG + Intergenic
921986830 1:221321609-221321631 GCTACTAGGGAGGCTAGGGCAGG - Intergenic
922162754 1:223090473-223090495 GCTACTTGGGAGGTGAAGGTGGG - Intergenic
922575385 1:226657941-226657963 ACTTGGAGGGAGGGGAGAGTAGG - Intronic
923632358 1:235659726-235659748 GCTTCTTGGTGGGTGAGGGTGGG - Intergenic
923715797 1:236423992-236424014 GCTTCTTGGGAGTCTAGGGTAGG + Intronic
923753347 1:236767432-236767454 GCTACTCGGGAGGTGGGGGTGGG + Intergenic
923871982 1:238004902-238004924 GCTACTAGGGAGGCCAAGGTGGG + Intergenic
923889153 1:238192006-238192028 GCTACTAGGGAGGCTAAGGTGGG + Intergenic
924058913 1:240151876-240151898 GCTACTAGGGAGGTTAAGGTGGG - Intronic
924083902 1:240428341-240428363 GCTACTTGGGAGGGTGGGGTGGG - Intronic
924508171 1:244705478-244705500 ACTGCCAGGGAGTGGAGGGTGGG - Intronic
924520235 1:244799981-244800003 TCTTCCCGGGAGAGGAGGGTGGG + Intergenic
924681178 1:246235716-246235738 TCCTCTAGGAAGGGGAGGGCTGG + Intronic
924707353 1:246511090-246511112 GCTTGCAGGGAGGGGTGGGGGGG + Intergenic
924744548 1:246819364-246819386 TGTTGTAGGGAGGGGAGGGGAGG - Intergenic
1063434155 10:6017271-6017293 GCTTCTGTGGACGGGAGGGTGGG + Intronic
1064067899 10:12199185-12199207 GCTTCTAGAAAGTGGAGGGGGGG - Intronic
1064401498 10:15025033-15025055 GCTACTAGGGAGGGGGAGGCAGG + Intergenic
1064537988 10:16378011-16378033 GCTGCTTGGGAGGGCTGGGTTGG - Intergenic
1064636593 10:17374600-17374622 GCTTCTTGGGAGGCGGAGGTAGG + Intronic
1065001618 10:21342542-21342564 GCTACTAGGGAGGCTAAGGTGGG + Intergenic
1065004555 10:21367512-21367534 GCTTCTAGGGAGGCTGAGGTGGG - Intergenic
1065024274 10:21526210-21526232 CCTGCGAGGGAGGGGAGGGACGG + Intergenic
1065188994 10:23193546-23193568 GATTCCTGGGAGGGGACGGTGGG + Intronic
1065323573 10:24531091-24531113 GCTACTAGGGAGGCTAAGGTGGG + Intronic
1065351225 10:24797382-24797404 GCTGCTTGGGAGGCTAGGGTAGG - Intergenic
1067226073 10:44376534-44376556 GCGTCTAGAAAGGGGAAGGTGGG - Intronic
1067236519 10:44455066-44455088 GTTACTCGGGAGGGGAGGCTGGG - Intergenic
1067850365 10:49750485-49750507 TCTTCCAGGGAAGGGAGGGCAGG - Intronic
1068136302 10:52953545-52953567 GAGCCGAGGGAGGGGAGGGTTGG + Intergenic
1068725084 10:60291822-60291844 GCTACTAGGGAGGTCAAGGTGGG - Intronic
1068777083 10:60879443-60879465 GCTACTAGGGAGGTGGAGGTGGG - Intronic
1068896784 10:62212589-62212611 GCTACTAGGGAGGTTAAGGTGGG + Intronic
1069237571 10:66096633-66096655 GCTACTAGGAAGGGTAAGGTGGG - Intronic
1069784033 10:70976752-70976774 GCTTCTAGGAAGGGGACTGCAGG + Intergenic
1069819411 10:71218118-71218140 GTTTGCAGGGAGGGGAGGGTGGG + Intronic
1069837127 10:71316590-71316612 GACTCCAGGGAGGGGAGGGATGG - Intergenic
1070326313 10:75391659-75391681 GCTTCCAAAGAAGGGAGGGTAGG - Intergenic
1071307603 10:84312956-84312978 GCTACTAGGGAGGCTGGGGTGGG + Intergenic
1072206076 10:93206462-93206484 CCTGCTAGGGAGGGCTGGGTTGG - Intergenic
1072340223 10:94440278-94440300 GCTACTTGGGAGGCTAGGGTGGG - Intronic
1072604863 10:96972025-96972047 GTTTCTAGAGAGGGGTGGGGTGG + Intronic
1072789289 10:98305940-98305962 GCTACTTGGGAGGCTAGGGTGGG + Intergenic
1072948791 10:99834767-99834789 GCTTCCAGGGAGTGAAGGGTGGG - Intronic
1072982721 10:100113264-100113286 GCTACTAGGGAGGCTAAGGTGGG - Intergenic
1073018593 10:100421838-100421860 GCTACTAGGGAGGCTAAGGTGGG + Intergenic
1073103749 10:101020675-101020697 TCTCCTGGGGAGGGGATGGTGGG + Exonic
1073521998 10:104140699-104140721 GCTACTTGGGAGGTGAAGGTGGG + Intronic
1073593730 10:104780010-104780032 GCTTATGGGGAGGGGAAGGGAGG + Intronic
1074470823 10:113725232-113725254 GTTACAAGGGAGGGGAGGGGAGG - Intronic
1074717084 10:116229577-116229599 GCTCCTAAGGAGGGGTGGGAAGG - Intronic
1075828208 10:125378875-125378897 CCTTCTTGAGAGTGGAGGGTGGG - Intergenic
1076006018 10:126948748-126948770 GATTCCAGGGAGGGGAAGCTTGG - Intronic
1076055154 10:127366753-127366775 GCTTCTGGGATGGGGATGGTCGG + Intronic
1076413239 10:130266274-130266296 GAATCATGGGAGGGGAGGGTTGG + Intergenic
1076653529 10:132006190-132006212 TCTTCTATGGAGCGGGGGGTGGG + Intergenic
1076792661 10:132785452-132785474 GCTGCAAGGGAGGGGAAGGGAGG + Exonic
1076883443 10:133250903-133250925 GCTTCCAGGGACCGGAGGGTCGG + Intergenic
1076883515 10:133251149-133251171 GCTTCCAGGGACCGGAGGGTCGG - Intergenic
1077490536 11:2858998-2859020 GATGGTAAGGAGGGGAGGGTGGG - Intergenic
1077777204 11:5284829-5284851 GGTTCCAGGGAGGGTGGGGTGGG - Intronic
1078258976 11:9686470-9686492 GCTACTAGGGAGGCTAAGGTAGG - Intronic
1079107229 11:17579286-17579308 GCTTCTAGGGTAGGAAGGGGAGG + Intronic
1079187384 11:18249359-18249381 GCATCCAGGCAGGGAAGGGTGGG + Intergenic
1079548053 11:21659136-21659158 GTTTCTAGGGACTCGAGGGTGGG + Intergenic
1080411530 11:32029475-32029497 GCTACTAGGGAGGGTCAGGTGGG - Intronic
1080514795 11:33010116-33010138 GCTACTTGGGAGGCGAAGGTGGG + Intergenic
1081188072 11:40069850-40069872 ACTACTAGAGAGGGGAGGGCAGG + Intergenic
1081260205 11:40950135-40950157 GATTCTGAGGAGGGGTGGGTGGG - Intronic
1081546307 11:44074437-44074459 GGTACTGGGGAGGGGAAGGTGGG + Intronic
1081907800 11:46680358-46680380 GGTTCTAGGCAGGGCTGGGTGGG + Intronic
1082001222 11:47394683-47394705 GCTGTTAGGGAAGGGAGGGATGG + Intergenic
1082055495 11:47811829-47811851 GCATATATGGAGGGGACGGTGGG - Intronic
1082055649 11:47813712-47813734 GCTGCTAGGGAGGCTGGGGTGGG + Intronic
1082712061 11:56565100-56565122 TCTTCTTGAGGGGGGAGGGTGGG - Intergenic
1082933919 11:58637336-58637358 TCTTTTAGTGTGGGGAGGGTTGG - Intergenic
1084202609 11:67571301-67571323 GCTACTCGGGAGGCTAGGGTAGG - Intergenic
1084296993 11:68218647-68218669 GCTTCTAGAGAGGGCTGGTTAGG - Intergenic
1084332090 11:68436450-68436472 GCTTGAGGGGAGGGGAGGGGAGG - Intronic
1084563276 11:69915815-69915837 GCTTCCAGTGAGGTGGGGGTGGG + Intergenic
1084605860 11:70171228-70171250 GCATCTTGGGAGGGGAAGGGTGG - Intronic
1084691922 11:70732565-70732587 GCTTCTAGGGAGGGGAGGGTCGG - Intronic
1084740166 11:71134253-71134275 GCATCTGGGGAGGGGAGAGGGGG + Intronic
1084964285 11:72736352-72736374 GCTACTGGGGAGGGGGAGGTGGG - Intronic
1085989547 11:81825316-81825338 GCTTCCATGGAGGCGAGGCTGGG + Intergenic
1086099195 11:83081623-83081645 GCTACTCGGGAGGGTGGGGTGGG - Intergenic
1086141264 11:83503149-83503171 TCTGCTATGGAGGGGAGGATAGG + Intronic
1086383631 11:86285306-86285328 GCTACTAGGGAGGCTAAGGTGGG + Intergenic
1086486645 11:87310470-87310492 GCTTCTAGAGGAGGGAGGGAGGG + Intronic
1087441763 11:98193467-98193489 TCATCAAGCGAGGGGAGGGTGGG + Intergenic
1087843291 11:102942392-102942414 GCTACTAGGGAGGCTAAGGTGGG - Intergenic
1088088726 11:106012279-106012301 GGTTTAAGGGAGGGGAGGATGGG - Intronic
1090025537 11:123164413-123164435 GCTACTGGGGAGGCTAGGGTGGG - Intronic
1090363730 11:126189948-126189970 CCTCCTAGGGAGGGAGGGGTGGG - Intergenic
1090366255 11:126209101-126209123 GCTACTTGGGAGGCCAGGGTGGG - Intronic
1090597181 11:128332778-128332800 GCTACTTGAGAGTGGAGGGTGGG + Intergenic
1090669570 11:128936994-128937016 GCTTCTGGGGAGAGAAGTGTGGG + Intronic
1090887851 11:130895088-130895110 GCTTCCAGAGAGGGCAGGCTCGG + Intronic
1091281561 11:134384516-134384538 AGGGCTAGGGAGGGGAGGGTCGG - Intronic
1091509630 12:1108843-1108865 GGTTCAAGGGAGGGGAGGAGAGG - Intronic
1091739835 12:2952961-2952983 GCTACTTGGGAGGCTAGGGTGGG + Intergenic
1092152126 12:6256521-6256543 GCTACTAGGGAGGCTGGGGTAGG + Intergenic
1092528968 12:9328512-9328534 GCTTGCAAGGAAGGGAGGGTAGG + Intergenic
1092649988 12:10624310-10624332 GCTTCTAGGGAGGCTGAGGTGGG + Intronic
1092904385 12:13088748-13088770 GCCCCAAGGGAGGGGAGGGGAGG + Intronic
1095174994 12:39081355-39081377 GCTGCTAGGGAGGCTAAGGTGGG - Intergenic
1095391026 12:41706853-41706875 ACTGCTAGAGTGGGGAGGGTGGG - Intergenic
1096144261 12:49266735-49266757 GCTTCTCGGGAGGCAGGGGTGGG + Intronic
1096179417 12:49542459-49542481 GCTTCCAGGAAGAGGAGGTTTGG - Intronic
1096264765 12:50114047-50114069 GCTACTAGGGAGGTTTGGGTGGG - Intronic
1096482775 12:51952880-51952902 GCTTCTACAGAGAGGAGAGTGGG - Intronic
1096642156 12:53003281-53003303 GCTTCTCGGGAGGCTAAGGTAGG + Intergenic
1096683769 12:53274376-53274398 TATTCTAGGCAGGGAAGGGTGGG + Intronic
1096702087 12:53391748-53391770 ACTACTAGATAGGGGAGGGTCGG - Intronic
1096950011 12:55458639-55458661 TCTACTTGAGAGGGGAGGGTGGG + Intergenic
1097075063 12:56386872-56386894 GCTTTTTGGGAGGTGAAGGTGGG + Intergenic
1097117287 12:56706944-56706966 GCTACTAGGGAGGCGGAGGTGGG - Intergenic
1097291739 12:57922358-57922380 GCTTCTCGGGAGGCCAAGGTGGG + Intergenic
1097697940 12:62792714-62792736 GCTTCTAGGGAGGAGGGGGAGGG - Intronic
1098308760 12:69127164-69127186 TCTTCTTGGGGGTGGAGGGTGGG - Intergenic
1099439818 12:82686765-82686787 GCCTCCAGGCCGGGGAGGGTGGG + Intergenic
1099924387 12:88999815-88999837 GTTTCTAGGGGTGGGAGGCTTGG + Intergenic
1099961622 12:89402520-89402542 TCTACTAGAGAGTGGAGGGTGGG - Intergenic
1100321756 12:93500845-93500867 GCTACTAGGCAGGGTAAGGTAGG + Intronic
1100495695 12:95122968-95122990 GCTTCTTGGGAGGCTAAGGTAGG + Intronic
1100511542 12:95279701-95279723 GCTACTTGGGAGGCTAGGGTGGG - Intronic
1100542829 12:95574077-95574099 GCTGCCGGGGAGGGGAGGGCTGG + Intergenic
1101167186 12:102050529-102050551 GCTTCTAGGGAGGCTGAGGTGGG + Intronic
1101329770 12:103748233-103748255 CATTCTAAGGATGGGAGGGTGGG - Intronic
1101733590 12:107446236-107446258 GCTTCTAGAGAGGAGTGGCTGGG + Intronic
1101978567 12:109384777-109384799 GGTCCTAAGGATGGGAGGGTGGG - Intronic
1102012347 12:109626444-109626466 GATTATGGTGAGGGGAGGGTTGG + Intergenic
1102101441 12:110281529-110281551 CCTTCTGGCGAGGGGAGGGAGGG + Intronic
1102111550 12:110369109-110369131 GCTACTTGGGAGGGTAGGGCAGG - Intergenic
1102637561 12:114337351-114337373 ACTACTAGAGAGGGGAGGGAGGG - Intergenic
1102971496 12:117171244-117171266 GCTACTAGGGAGGCTGGGGTGGG + Intronic
1103657050 12:122479920-122479942 GCTACTAGGGAGGCTGGGGTGGG - Intronic
1103766402 12:123283373-123283395 GCTACTTGGGAGGCGGGGGTGGG - Intergenic
1103866421 12:124055573-124055595 GGTTCTAGGGATGGGAGGGAGGG - Intronic
1104015162 12:124957095-124957117 GCTTCCACGGAGGGGGGCGTCGG + Exonic
1104059695 12:125257192-125257214 GCTACTTGGGAGGTGAAGGTGGG + Intronic
1104174517 12:126317056-126317078 GCTACTTGGGAGGCTAGGGTGGG - Intergenic
1104190747 12:126479942-126479964 GCTTCCAGGGAGGGGCAGGGAGG - Intergenic
1104338010 12:127918783-127918805 AATTCTGGGGAGGGGAGGGCAGG - Intergenic
1104535653 12:129615658-129615680 GCTACTTGGGAGGCCAGGGTGGG + Intronic
1105362526 13:19733839-19733861 GCTACTAGGGAGGCTAAGGTGGG + Intronic
1105499021 13:20955316-20955338 GCTACTAGGGAGGCTAAGGTGGG - Intergenic
1106088447 13:26563541-26563563 GCTTCTAGGGAGGGTGAGGCAGG + Intronic
1106657814 13:31765890-31765912 GCTTCTAGGGAAGAGTGGGTTGG + Intronic
1107134577 13:36930005-36930027 GCCTGTTGGGAAGGGAGGGTGGG - Intergenic
1107412609 13:40172096-40172118 CCTACTAGGGGGTGGAGGGTGGG - Intergenic
1107755993 13:43622846-43622868 GCTACTAGGGTGGGTAGGGAAGG + Intronic
1107845069 13:44504216-44504238 GTTTCCGGGGAGGGGCGGGTGGG - Intronic
1107938519 13:45364833-45364855 GCTTCTAGGGTGGGAAGCCTTGG - Intergenic
1108026623 13:46184709-46184731 GCTTCAGGGCAGGAGAGGGTGGG - Intronic
1108566886 13:51708365-51708387 GCTACTAGGGAGGCTAAGGTGGG + Intronic
1109560764 13:64047220-64047242 GCTACCAGGGTGGGGAGGGGAGG - Intergenic
1110005559 13:70262499-70262521 GCTACTAGGGAGGCTAAGGTGGG + Intergenic
1111122824 13:83877676-83877698 GTTGCTGGGGCGGGGAGGGTGGG + Exonic
1111677894 13:91409859-91409881 ACTTCTAGAGAGGGGAGGGAGGG - Intronic
1111927308 13:94477481-94477503 ACTGCTAGAGAGGGGAGGGAGGG + Intronic
1112125471 13:96462179-96462201 GCTTCTTGGGAGGGTCAGGTGGG - Intronic
1112243539 13:97706173-97706195 ACTTTGAGGGAGGGGAGTGTGGG - Intergenic
1112831750 13:103460868-103460890 GCTGCTAGAGGGAGGAGGGTTGG + Intergenic
1113058317 13:106293974-106293996 GCTACTAGGGAGGCTAAGGTAGG - Intergenic
1113508938 13:110836495-110836517 ACTTCTAGGGAGGGAGGGGTGGG + Intergenic
1114437514 14:22719640-22719662 GCTACTTGGGAGGTGAAGGTGGG + Intergenic
1114624815 14:24122052-24122074 GCTACTTGGGAGGCTAGGGTGGG + Intronic
1114665391 14:24374474-24374496 CCTGCTGGGGAGGGGAGGGCAGG + Intronic
1114978188 14:28127825-28127847 GCTTCTAGGGAGGCTGAGGTGGG + Intergenic
1115492029 14:33967008-33967030 GCTTCTAGGGAGGCTGAGGTAGG + Intronic
1116017781 14:39427834-39427856 GCTACTAGGGAGGCTGGGGTGGG + Intronic
1116082834 14:40198353-40198375 GCTTTTAGGGAGTAGAGGGTGGG + Intergenic
1116798233 14:49414434-49414456 GCTGCTTGGGAGGCTAGGGTGGG + Intergenic
1116852701 14:49924285-49924307 GCTACTTGGGAGGCTAGGGTGGG + Intergenic
1116893771 14:50295516-50295538 GCTTCTAGGGAGGCCGAGGTGGG - Intronic
1117705689 14:58464958-58464980 GCTACTCGGGAGGCTAGGGTGGG + Intronic
1118400562 14:65375507-65375529 GCTACTTGGGAGGCTAGGGTGGG + Intergenic
1118762592 14:68889670-68889692 GCTACTAGGGAGGCTAGGGCAGG + Intronic
1119044147 14:71302751-71302773 GCTTCTTGGGAGGCTAAGGTGGG - Intergenic
1119289671 14:73485512-73485534 GCTACTAGGGAGGCTAAGGTGGG - Intronic
1119363960 14:74075543-74075565 GCTACTAGGGAGGCCAAGGTGGG + Intronic
1119404694 14:74390332-74390354 GCTTCGGGAGAGGGGAGGGGTGG - Intergenic
1119553342 14:75533649-75533671 GCTTCCTAGGAGGGGTGGGTTGG + Intronic
1119655188 14:76412481-76412503 GCTTCCAGCCAGGGTAGGGTGGG - Intronic
1119902981 14:78277075-78277097 GCTTCTAGGGGAGGCAAGGTGGG + Intronic
1120205043 14:81578973-81578995 GCTACTAGGGAGGGTGAGGTGGG + Intergenic
1120514257 14:85451827-85451849 GCGTCTAGTGAGGGGCAGGTAGG + Intergenic
1120913684 14:89690805-89690827 GCTGCCAGGGAGTGAAGGGTGGG + Intergenic
1121432865 14:93899856-93899878 GCTTCTAGGGAGGGAGAGGGAGG + Intergenic
1121652214 14:95566838-95566860 GCTGCTAGGGAGGCTGGGGTAGG + Intergenic
1122056340 14:99100833-99100855 GCAGGTAGGGAGGGGTGGGTGGG - Intergenic
1122118610 14:99540251-99540273 TCTTCTAGGGAGCTGAGTGTGGG - Intronic
1122364621 14:101187267-101187289 GCTTCTTGGGAGGAGAATGTGGG + Intergenic
1122594511 14:102880002-102880024 GCTACTAGGGAGGCCAAGGTAGG + Intronic
1122960096 14:105090329-105090351 GCTGCTAGGGTGGGGAGTGTGGG - Intergenic
1202834116 14_GL000009v2_random:65177-65199 GATTCTGGGGTGGAGAGGGTTGG + Intergenic
1124204722 15:27707435-27707457 GCTTCCAGGGAGGGAGGGTTAGG + Intergenic
1124872964 15:33561786-33561808 GCTACTTGGGAGGGTAAGGTGGG + Intronic
1125539340 15:40460734-40460756 GCTGCTGGGGAGGTGAGGGCTGG + Intronic
1125714318 15:41810605-41810627 GCTACTAGGGAGGCTAAGGTGGG + Intronic
1126586366 15:50291804-50291826 GCTACTTGGGAGGCTAGGGTGGG + Intronic
1126636918 15:50788871-50788893 GCTTCTTGGGAGGCTGGGGTGGG - Intergenic
1127296518 15:57613480-57613502 GCTTCTTGGGAGGCTAAGGTGGG - Intronic
1127408499 15:58680232-58680254 GCTACTAGGGAGGCGGAGGTGGG - Intronic
1127421519 15:58811004-58811026 GCTTCCAGGGAGGGAAGGGTAGG - Intronic
1128172891 15:65528758-65528780 GCTACTCGGGAGGCTAGGGTGGG - Intergenic
1128478755 15:68019471-68019493 GAAAGTAGGGAGGGGAGGGTGGG + Intergenic
1128565148 15:68696136-68696158 GCTACTAGGGAGGGTGAGGTGGG + Intronic
1128949821 15:71866416-71866438 GCTACTAGGGAGGGTAAGGTGGG + Intronic
1129233522 15:74209719-74209741 CCCTCTAGGAAGGGGAGGGAGGG - Intronic
1131102093 15:89700672-89700694 GCTACTTGGGAGGGTGGGGTGGG - Intronic
1131141947 15:89983832-89983854 GCTACTTGGGAGGCTAGGGTGGG - Intergenic
1131144607 15:90002587-90002609 GCGCCTAGGGTGGGGAGGCTGGG - Intronic
1131243004 15:90764458-90764480 GCTTCTTGGGAGGCTAAGGTGGG - Intronic
1131305273 15:91237322-91237344 GCATCTAGTGAGTGGAGGCTAGG - Intronic
1131676109 15:94672348-94672370 GCTTCTAGGGAGGAGGGGGTAGG + Intergenic
1132301822 15:100780758-100780780 TCTTCTGTGGAGGGGATGGTTGG - Intergenic
1132498586 16:275079-275101 GCCTCTGGGGAGGGGTGGGACGG + Exonic
1132732036 16:1367429-1367451 GATGCTGGGGAGGGGAGGGGAGG - Intronic
1133052141 16:3123367-3123389 GCTACTTGGGAGGCTAGGGTGGG + Intergenic
1133060693 16:3172479-3172501 GTTTCTAGGGCGGGGAGGGGAGG - Intergenic
1133078108 16:3295382-3295404 GCTGGAAGGGAGGGGAGGGGCGG - Intronic
1133154309 16:3861981-3862003 TCTCCTGGGGAGGAGAGGGTGGG - Intronic
1134017678 16:10900626-10900648 GCTACCAGGGAGGCTAGGGTGGG + Intronic
1134092513 16:11399179-11399201 GCTTCTCGGGAGGGGGCGGAGGG - Intronic
1134793802 16:17015595-17015617 GCTTCTTGGGAGGCTGGGGTAGG - Intergenic
1134869572 16:17639442-17639464 GCTACTAGAGAGGGGAGAGAAGG - Intergenic
1135391074 16:22093874-22093896 GCTACTAGGGAGGATGGGGTGGG - Intronic
1135629883 16:24027879-24027901 GCTACTAGGGAGGCCAAGGTGGG - Intronic
1136604780 16:31325952-31325974 GCTACTCGGGAGGCTAGGGTGGG + Intronic
1137434901 16:48447147-48447169 GCTACTTGGGAGGCCAGGGTGGG + Intronic
1138179209 16:54930939-54930961 GCAGCAAGGGAGGGGAGGGGAGG + Exonic
1138379034 16:56587687-56587709 GCTACTTGGGAGGCCAGGGTGGG - Intergenic
1138523875 16:57590549-57590571 GCCTCTGGGGAGGGGAGGTAGGG + Intronic
1139277674 16:65743063-65743085 GCTACTAGGGAGGGTGAGGTGGG - Intergenic
1139399879 16:66673019-66673041 GCTTCTTGGGAGGCGGGGGCAGG - Intronic
1139945876 16:70641676-70641698 GCTGCTAGGGAGGCTAAGGTGGG - Intronic
1140208549 16:72952820-72952842 GCTTCTAGGAACTGGAGGGAAGG - Intronic
1140475607 16:75238062-75238084 GCACCTGGGGAGGGGAGGGCTGG - Intronic
1140510353 16:75503065-75503087 GCTTCCAGGGAGGGTGAGGTGGG + Intergenic
1140813097 16:78597043-78597065 GCTTCTACGCAGAAGAGGGTAGG - Intronic
1140860082 16:79010691-79010713 GCTTCCAGGCAGAGGAGGTTTGG + Intronic
1141081313 16:81055580-81055602 GCTACTAGGGAGGCTATGGTAGG + Intronic
1141571244 16:84934917-84934939 GCTACTAGGGAGGGTGAGGTGGG - Intergenic
1141585582 16:85031370-85031392 GCTACTAGGGAGGCTGGGGTGGG + Intronic
1141688561 16:85583860-85583882 GCTCCCAGGGAGGGGAGTGAGGG + Intergenic
1141711906 16:85704700-85704722 GCTACTAGGGAGGCCAGGGTAGG - Intronic
1142472090 17:170275-170297 GGTTCTAGAGAGGGCAGGGGTGG + Intronic
1142796701 17:2313316-2313338 GCTACTAGGGAGGCTAGGGCAGG + Intronic
1142801090 17:2346313-2346335 GGTTCTTGGCAGAGGAGGGTTGG + Intronic
1143048031 17:4098298-4098320 GCTACTTGGGAGGCCAGGGTGGG + Intronic
1143329774 17:6124984-6125006 CCTTCTAGGGAGGGTAGGTGTGG + Intergenic
1143403552 17:6661039-6661061 GCTGGTAGGAAGGGGAGGGGAGG + Intergenic
1143579660 17:7818129-7818151 GATGCTAGGGAGGGAAGGGCTGG + Intronic
1144454931 17:15411047-15411069 GCTACTCGGGAGGCTAGGGTGGG + Intergenic
1145747934 17:27333753-27333775 GCTACTAGGGAGGCTAAGGTGGG - Intergenic
1145924039 17:28632844-28632866 CCCTCTGGGGAGGGGAGGGGAGG - Intronic
1145976161 17:28985658-28985680 GCTTCTAGGGTAGGAAGGGGTGG + Intronic
1146123717 17:30216245-30216267 TGTTCCAGGGAGGGGAGGGGAGG + Intronic
1146328054 17:31904077-31904099 GCTACTTGGGAGGCGGGGGTGGG - Intergenic
1147119150 17:38325447-38325469 GATTCTTGGGCGGGGAGGGGTGG + Intergenic
1147340625 17:39751454-39751476 GCTTCTCTGGGGGAGAGGGTGGG + Intergenic
1147478857 17:40739970-40739992 GCTACTCGGGAGGGTGGGGTGGG - Intergenic
1148372642 17:47112225-47112247 GCTACTAGGGAGGCTGGGGTAGG + Intergenic
1148630482 17:49104376-49104398 GCTTCTTGGGAGGCGGAGGTGGG + Intergenic
1148708097 17:49654337-49654359 GCTCCTGGGGAGGTCAGGGTAGG - Intronic
1148985876 17:51620622-51620644 GCTACTTGGGAGGGTGGGGTGGG + Intergenic
1149097070 17:52855983-52856005 GCTACTAGGGAGGCTAAGGTGGG + Intergenic
1149230793 17:54531712-54531734 GCTACTAGGGAGGCTAAGGTAGG - Intergenic
1150261145 17:63791933-63791955 GCTACTAGGGAGGGCAAGGCAGG + Intronic
1150280676 17:63928234-63928256 GCTTCCTGGGAGGTGGGGGTGGG + Intergenic
1150353452 17:64463760-64463782 GCTACTAGGGAGGCTAAGGTGGG - Intronic
1150542026 17:66111700-66111722 TCTACTTGAGAGGGGAGGGTGGG + Intronic
1150855413 17:68747557-68747579 GGTTGTAGGCATGGGAGGGTGGG + Intergenic
1151440362 17:74124787-74124809 GCATCTAGAGAGTGGAGGCTGGG - Intergenic
1151904651 17:77039755-77039777 CCTTCTAGGGAGGCAAAGGTTGG - Intergenic
1152104943 17:78323333-78323355 GGTTCTGGGGAGGGGAGCCTGGG + Intergenic
1152201807 17:78951784-78951806 ACTTCTAGGCAGGAGAAGGTGGG + Intergenic
1152789813 17:82273056-82273078 GGGTCTGGAGAGGGGAGGGTTGG - Intronic
1153241659 18:3036426-3036448 GCATTTAGGGAGGGCAAGGTGGG - Intergenic
1153678435 18:7477025-7477047 GCTACTCGGGAGGGCAGGGCAGG - Intergenic
1153880917 18:9421227-9421249 GGTTCGAGGGAAGGGAGGGAAGG - Intergenic
1154142220 18:11834272-11834294 CCTGCTAGGGAGGGGCGTGTGGG + Intronic
1154230083 18:12548722-12548744 GCTACTAGGGAGGCTAAGGTGGG - Intronic
1154390483 18:13932375-13932397 GCTCCTGGGGAGGTGGGGGTCGG + Intergenic
1154399299 18:14020103-14020125 GCTTCCATGGTGGGGAGGGGGGG + Intergenic
1155211786 18:23608313-23608335 GCTTCTATGGAGTGGCTGGTAGG + Intronic
1155970263 18:32076425-32076447 GCTACTAGGGAGGGTGAGGTGGG - Intergenic
1156015789 18:32545791-32545813 GCTACTAGGGAGGCTAAGGTAGG - Intergenic
1156036578 18:32771971-32771993 GCATCTAGGCAGAGGAGGGCAGG + Intronic
1156297796 18:35808663-35808685 GCTTCTTGGGAGGCTAAGGTGGG - Intergenic
1156910124 18:42402162-42402184 GGTAGTAGGGAGGGGAGGATAGG - Intergenic
1156997820 18:43489318-43489340 GCTACTCGGGAGGCTAGGGTGGG + Intergenic
1157216957 18:45792191-45792213 GCTTGTGGGGGGTGGAGGGTGGG + Intergenic
1157393520 18:47323039-47323061 GCTTTGAGAGAGGGGAGGGTGGG - Intergenic
1157757320 18:50230338-50230360 ACCTCTTGGGAGGGGAAGGTGGG + Intronic
1158592578 18:58790107-58790129 CCTTCTTGGGAGGGGAGAGCTGG + Intergenic
1158837568 18:61347200-61347222 GCACTTAGGGAGGGCAGGGTGGG + Intronic
1158934100 18:62348816-62348838 CATTCTGGGGAGGGGAAGGTGGG + Intronic
1159011100 18:63059148-63059170 GCTACTAGGGAGGGAAAGGCAGG - Intergenic
1159143275 18:64422711-64422733 GCTACTGGAGAGTGGAGGGTGGG - Intergenic
1159796113 18:72846256-72846278 GCATCTTGGGAGGGCAAGGTGGG + Intronic
1159974328 18:74691980-74692002 GCTGCTAGGGAGGCTAGGGTGGG + Intronic
1160160790 18:76468526-76468548 GCTACTAGGGAGGCCAAGGTGGG - Intronic
1160231602 18:77053256-77053278 GCTTCAGGGGAGGGGTGGGCAGG + Intronic
1160517304 18:79485604-79485626 ACTTTTAGGGAGGGCTGGGTGGG + Intronic
1160547815 18:79672680-79672702 GGCTCTAGGGAGGTGAGGGCAGG - Intergenic
1160837468 19:1131634-1131656 TCTTGTAGGGAGCGGAGGCTGGG - Intronic
1160957339 19:1699690-1699712 GCCGCTGGGGAGGGGAGGGTGGG + Intergenic
1161081228 19:2311195-2311217 GCTTCTCGGGAGGCTGGGGTAGG - Intronic
1161315821 19:3617165-3617187 GCTTCTAGGGAGGCTGAGGTGGG + Intronic
1161500199 19:4610292-4610314 GCTTCTGCGGCGGGGAGGGGGGG + Intergenic
1161673660 19:5629317-5629339 GCTACTAGGGAGGCCAAGGTAGG + Intronic
1161937473 19:7381011-7381033 GCTTCTGGGGAGGGCAGCCTTGG + Intronic
1161938776 19:7389260-7389282 GCTACTTGGGAGGCTAGGGTGGG - Intronic
1162390264 19:10385570-10385592 GCTACTAGGGAGGCTGGGGTGGG + Intergenic
1162603068 19:11684463-11684485 GCTACTAGGGAGGTTAAGGTGGG + Intergenic
1162754987 19:12852428-12852450 GGTTCCTGGGAGGGCAGGGTGGG + Intronic
1162791077 19:13063301-13063323 GCTTCTGGGGAAGGGAGGGAAGG - Intronic
1162805141 19:13134168-13134190 GCTACTAGGGAGGGTGTGGTGGG - Intronic
1162827538 19:13262920-13262942 ACTTCTAGGCCTGGGAGGGTAGG - Intronic
1162900576 19:13793344-13793366 GCTACTAGGGAGGCTAGGGCAGG - Intergenic
1163102689 19:15107652-15107674 GCCTCCAGCCAGGGGAGGGTAGG + Intronic
1164628549 19:29745830-29745852 GCCTCTAGCGAGGCCAGGGTGGG + Intergenic
1164774732 19:30844081-30844103 GCTTCTCGGGAGGCTAAGGTAGG + Intergenic
1164967862 19:32501088-32501110 GCTACTAGGGAGGCTGGGGTGGG + Intergenic
1165074074 19:33271027-33271049 GCTACTAGGGAGGTGGAGGTGGG + Intergenic
1165166308 19:33859732-33859754 GCTTCTTGGGAGGCCAAGGTGGG - Intergenic
1165384085 19:35500298-35500320 GTTACTTGGGAGGTGAGGGTAGG + Intronic
1165425221 19:35741728-35741750 GCTACTAGGGAGGCCAAGGTAGG + Intronic
1165738272 19:38191286-38191308 GCTACTTGGGAGGCCAGGGTAGG + Intronic
1165770306 19:38376138-38376160 GCTGATGGGGAGGGGAGGGAGGG - Exonic
1165811461 19:38614350-38614372 GATTCTGGGGATGGGAGGGGAGG - Intronic
1166049679 19:40250714-40250736 GCTACTAGGGAGGCTGGGGTGGG + Intronic
1166561594 19:43736343-43736365 GCTTATAGGGAGGGGAGAAATGG - Intronic
1166565735 19:43764515-43764537 GCTACTTGGGAGGGTAAGGTGGG - Intergenic
1166667107 19:44687139-44687161 GCTTCGAGCAATGGGAGGGTGGG + Intergenic
1166676337 19:44743422-44743444 GCTACTTGGGAGGGTAAGGTGGG - Intergenic
1166683624 19:44782134-44782156 GGTTTGAGGGAGGGGAGGGCTGG + Intronic
1166964203 19:46518234-46518256 GCTACTAGGGAGGCTAGGGCAGG - Intronic
1167175964 19:47864673-47864695 GCTACTAGGGAGGGTAAGGCAGG - Intergenic
1167250619 19:48396741-48396763 GCCTCGAGGCAGGGGAGGGGTGG + Intronic
1167482251 19:49740180-49740202 GCTCCTGGGGAGAGGAGCGTAGG + Exonic
1167823602 19:51952427-51952449 GCTACTAGGGAGGCTGGGGTGGG - Intergenic
1168113604 19:54208737-54208759 GCCTGGAGGGAGGGGAGAGTGGG + Intronic
1168477179 19:56684820-56684842 GCTACTCGGGAGGCTAGGGTGGG + Intergenic
1202638565 1_KI270706v1_random:62515-62537 GATTCTGGGGTGGAGAGGGTTGG - Intergenic
925265370 2:2563171-2563193 GCTTCAAGGGATGGGTGGGTGGG - Intergenic
925753514 2:7110952-7110974 GCTACTAGGGAGGGCAAGGTAGG - Intergenic
925761881 2:7192596-7192618 GCTACTAGGGAGGGTGAGGTAGG + Intergenic
925959637 2:9003399-9003421 CCTTCCAGGGAGCGGCGGGTAGG + Intronic
925983378 2:9195010-9195032 GCTACTAGGGAGGCTAGGGCAGG - Intergenic
926975547 2:18513479-18513501 GAATCTGGGGAGGGGTGGGTTGG - Intergenic
927186392 2:20485523-20485545 TCTTCTCAGGAGGGGAGGGAAGG - Intergenic
927455702 2:23247501-23247523 GCTTCCAGGGAGGGCTGGGCAGG + Intergenic
927554085 2:24020443-24020465 GCCTCTGGGGAGGGGAGGAGAGG - Intronic
927567398 2:24124804-24124826 GCTACTAGGGAGTGGAAGGATGG - Intronic
928245333 2:29621771-29621793 GCTTCTGGAGAGGTGAGGGCTGG + Intronic
929569546 2:43012535-43012557 GCTACTAGGGAGGCTAAGGTGGG - Intergenic
929751096 2:44714582-44714604 GCTGCTAGGGAGGGGTGGAGAGG - Intronic
929768981 2:44875479-44875501 TCTTCTAGGCAGGGGAGTGGAGG + Intergenic
930130515 2:47845143-47845165 GATTCCAGGGTGGGGTGGGTGGG - Intronic
930462001 2:51693164-51693186 GCTTCTTGAGGGTGGAGGGTGGG + Intergenic
931191549 2:60005573-60005595 GCTACTAGGGAGGCCAAGGTGGG - Intergenic
931360722 2:61575497-61575519 TCTTGGAGGGAGGGGTGGGTGGG - Intergenic
931523456 2:63126044-63126066 GCTACTTGGGAGGCTAGGGTGGG - Intronic
932344226 2:70985268-70985290 GTTTGTGGGGAGGGCAGGGTGGG - Exonic
932447137 2:71787892-71787914 GCCTCTGTGGAGGGGAGGGGTGG - Intergenic
932823710 2:74921997-74922019 GCTACTAGGGAGGCTGGGGTGGG + Intergenic
933506565 2:83183113-83183135 GCTACTAGGGAGGCTGGGGTGGG + Intergenic
933887795 2:86736293-86736315 GCTTCTAGGGAGGCTGAGGTGGG - Intronic
933922381 2:87060419-87060441 GCTTCTAGGGAGGCTGAGGTGGG + Intergenic
934061052 2:88293968-88293990 ACTTTAAGGGAGGGGAGGCTAGG - Intergenic
935281171 2:101519041-101519063 GCGCCCAGGGAGGGGAGGGAGGG - Intergenic
935410441 2:102756595-102756617 GCTACTTGGGAGGGTGGGGTGGG + Intronic
935709983 2:105889693-105889715 GCTACTTGGGAGGCCAGGGTGGG - Intronic
935850882 2:107217390-107217412 GCTTCTTGGGAGGCTGGGGTAGG - Intergenic
936037332 2:109123386-109123408 GCTTCAGGGGAAGGGAGGGAGGG - Intergenic
936042728 2:109161927-109161949 CCTCCTGGGGAGGGGAGGGTTGG + Intronic
936103613 2:109604711-109604733 GACTCTGGGGAGGGGAGGGGAGG + Intronic
936459092 2:112698362-112698384 ACTACTAGAGAGGGGAGGGAGGG - Intergenic
937309801 2:120895047-120895069 GCTGATGGGGAGGGGAGGGGAGG + Intronic
937793920 2:125994649-125994671 GCTTCTGGAAAGGGGATGGTAGG - Intergenic
938051383 2:128175743-128175765 GCTCCTGGGAAGGGGAGGGCTGG - Intronic
938589498 2:132722925-132722947 GCTACTCGGGAGAGGAAGGTGGG - Intronic
938815147 2:134895192-134895214 GCTACTAGGGAGGCTAAGGTAGG + Intronic
939090421 2:137773919-137773941 ACTTCTAAAGAGGAGAGGGTGGG - Intergenic
939700891 2:145389111-145389133 GCCTATTGGGAGTGGAGGGTGGG - Intergenic
940256341 2:151734440-151734462 GGTTCTCAGGAGGGGAGAGTTGG - Exonic
940932200 2:159446000-159446022 GCTTCTAGGGAAGCTAAGGTGGG + Intronic
941722599 2:168827677-168827699 GCTACTAGGGAGGCCAAGGTAGG - Intronic
941876341 2:170437370-170437392 GCTTCAAGGGAGAAGGGGGTGGG - Intronic
942064264 2:172255343-172255365 GCTTCTGGAGAGGGGAGTGGTGG - Intergenic
942746820 2:179243746-179243768 GCTACTAGAGGGGAGAGGGTGGG + Intronic
942806639 2:179938704-179938726 ACTACTAGAGAGGGGAGGGAGGG + Intergenic
943645462 2:190405028-190405050 GCTACTAGGGAGGCTAAGGTAGG - Intergenic
944752316 2:202722664-202722686 CCTTCTAGAGGGTGGAGGGTGGG + Intronic
944778984 2:202998231-202998253 TCTACTAGAGTGGGGAGGGTGGG - Intronic
944781609 2:203024082-203024104 GCTCTTTGGGAGGGCAGGGTGGG + Intronic
944842729 2:203639961-203639983 GCTACTTGGGAGGCTAGGGTGGG - Intergenic
945370382 2:209009178-209009200 GCATTTAGGGAGGTGAGGTTGGG - Intergenic
945506021 2:210641231-210641253 GCTTCTAGGGAGGCTGAGGTGGG - Intronic
945990677 2:216393006-216393028 GCTACTAAGGAGGCTAGGGTGGG + Intergenic
946373522 2:219294820-219294842 GCTTTTAGGGGTGGGAGCGTGGG + Intronic
946926085 2:224628288-224628310 GCTACTCGGGAGGCGAAGGTGGG - Intergenic
947065208 2:226216811-226216833 GCACCTAGGGCGGGGAGGGAGGG + Intergenic
947615730 2:231555640-231555662 GCTACTTGGGAGGGTAAGGTGGG + Intergenic
948207924 2:236172742-236172764 GCATCTGGGAATGGGAGGGTGGG + Intergenic
948927635 2:241109534-241109556 GCTGGGAGGGAGGGGAGGGGAGG + Intronic
1168757668 20:327418-327440 GCTTCTGGGGAGGAGGGGGCTGG + Exonic
1168836098 20:878326-878348 CCCTATAGGGAGGGGAGCGTGGG + Exonic
1169180481 20:3561837-3561859 GCTACTAGGGAGGCTAAGGTGGG - Intronic
1169215267 20:3790038-3790060 GCTCCTAGGGAGGCTGGGGTGGG + Intronic
1169284586 20:4297438-4297460 GCTTCTAGAAAGAGGGGGGTGGG + Intergenic
1170652921 20:18258907-18258929 GATCCTGGGGAGGGGAGGGTTGG + Intergenic
1170859231 20:20087285-20087307 ACTTCTAGGGAGGGGAGAGAAGG - Intronic
1171324935 20:24282845-24282867 GCTGCTATGGAGGGAAGGGGAGG + Intergenic
1171964463 20:31518895-31518917 TCTTTTATGGTGGGGAGGGTAGG + Intronic
1172146454 20:32761830-32761852 TCTTGAAGGGAGGGGAGGGCAGG - Intergenic
1172457570 20:35090006-35090028 GCTACTAGGGAGGCTAAGGTGGG + Intronic
1172576967 20:36016945-36016967 GCTACTTGGGAGGGTGGGGTGGG + Intronic
1172592134 20:36125286-36125308 GTTTCTGGGGAGTGGAGGATAGG + Intronic
1172648481 20:36486535-36486557 GGAATTAGGGAGGGGAGGGTGGG + Intronic
1172864502 20:38085311-38085333 AGTTCTAGGCAGGGGAGCGTGGG + Intronic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1175173264 20:57094180-57094202 GCTTCTACTGAGTGGCGGGTGGG - Intergenic
1175304892 20:57969140-57969162 GGTTGGAGGAAGGGGAGGGTGGG + Intergenic
1175310866 20:58010907-58010929 GCTCCCAGGGAGGCGAGGGGAGG - Intergenic
1175839371 20:62017027-62017049 GCTACTTGGGAGGCTAGGGTGGG + Intronic
1176027506 20:62993503-62993525 GCTTGGAGGCAGGGGAGGCTGGG + Intergenic
1176027528 20:62993554-62993576 GCTGGGAGGCAGGGGAGGGTGGG + Intergenic
1176193493 20:63825287-63825309 GCTTCTAGGGAGGCCAAGGCAGG + Intronic
1176254871 20:64146649-64146671 GGGTCTGAGGAGGGGAGGGTGGG + Intergenic
1178282289 21:31293944-31293966 GTTTGTTGGGAGGGGAGGGAGGG - Intronic
1178369614 21:32016642-32016664 CCTTCTAAGGAGGTGGGGGTGGG + Intronic
1178417630 21:32416688-32416710 GCTTCTAGGTAGAGGTGGGGAGG + Intronic
1178638118 21:34322905-34322927 GCTTCTCTGAAGGGGAAGGTGGG - Intergenic
1178661295 21:34509911-34509933 GCTACTTGAGAGTGGAGGGTGGG - Intergenic
1179411029 21:41163354-41163376 GCTTCTAGGTGGAGGAGAGTTGG - Intergenic
1180082797 21:45494326-45494348 GCCACTGGTGAGGGGAGGGTCGG - Intronic
1180363401 22:11919373-11919395 GATTCTGGGGTGGAGAGGGTTGG + Intergenic
1181303806 22:21902593-21902615 GCTACTCGGGAGGTGAAGGTGGG - Intergenic
1181548481 22:23620189-23620211 GCTGCTTGGGAGGTGAGGGAGGG - Intronic
1181643586 22:24218186-24218208 ACTTCTAAGGAGGAGAGGTTGGG - Intergenic
1182438254 22:30345237-30345259 GCTCCAGGGGAGGGGAGGGGAGG + Intronic
1182888516 22:33796874-33796896 GCTACTCGGGAGGCTAGGGTAGG - Intronic
1183067098 22:35370758-35370780 GCTACTTGGGAGGCTAGGGTGGG + Intergenic
1183287592 22:36977243-36977265 TCTGATAGGGAGGAGAGGGTTGG + Intergenic
1183351434 22:37336842-37336864 GCCTCAAGGCAGGGCAGGGTGGG + Intergenic
1183390900 22:37545375-37545397 GGTTTTAGGGAGTGGAGGGCTGG - Intergenic
1183400186 22:37599027-37599049 GCTACTAGGGAGGCAAAGGTGGG - Intergenic
1183537892 22:38413681-38413703 GCCTTTGGGGAGGGGAGGGAAGG - Intergenic
1183617512 22:38954501-38954523 GCTTCTAGGCTGAGGAGGGCGGG + Intronic
1183676247 22:39300408-39300430 GCTTCCAGAGAAGGGAGGGCGGG - Intergenic
1183970681 22:41475282-41475304 GCTACTAGGGAGGCTGGGGTGGG - Intronic
1184034405 22:41911590-41911612 GGCTCCAGGGAGGGGAGGGGAGG - Intronic
1184037460 22:41925595-41925617 TCTTCTAGGGGAGGGAGGGAAGG - Intronic
1184112146 22:42401733-42401755 TCTACTAGGGAGGGGAGACTTGG - Intronic
1184464318 22:44659981-44660003 GCTTCTTGGGAGGCTAAGGTGGG - Intergenic
1184544053 22:45153655-45153677 GCTACTAGGGAGGCTAAGGTGGG - Intergenic
1184777825 22:46632143-46632165 CCTGCTTGGGAGGGGAAGGTTGG + Intronic
1184836994 22:47029644-47029666 GCTTCTGGGGCGGGGATGGCAGG + Intronic
1184922928 22:47618416-47618438 GCTTCTAGGAAGGGGCTGATTGG + Intergenic
1185172003 22:49299632-49299654 GTGTCTGGGGAGGGGAGGGCAGG - Intergenic
1185242770 22:49755373-49755395 GCTTCTAGAAGGAGGAGGGTCGG - Intergenic
949499512 3:4665982-4666004 GCATCTGGTGAGGGGAGGCTAGG + Intronic
949988093 3:9554858-9554880 GCTACTAGGGAGGGTAAGGTGGG + Intergenic
949992843 3:9593123-9593145 GCTACTCGGGAGGATAGGGTGGG + Intergenic
950286547 3:11749771-11749793 GCTTCTAGGGATGGCAGAGCTGG + Intergenic
950652668 3:14416954-14416976 GCTGCTAGGGAGGCTGGGGTGGG - Intronic
950700951 3:14745993-14746015 GTTTCTAGGGAAGGGAGAATGGG - Intronic
950769649 3:15301303-15301325 ACTTCAAGGGAGGGCAGGGGAGG + Intronic
951695314 3:25440332-25440354 GCTACTCGGGAGGCTAGGGTGGG + Intronic
952148590 3:30561397-30561419 GCTACTAGGGAGGCTAAGGTGGG + Intergenic
952331069 3:32364967-32364989 GCTGCTAGGAAGGGGAGGAGGGG - Intronic
952376274 3:32770252-32770274 GCTACTAGGGAGGGTAAGATGGG - Intronic
953048928 3:39322595-39322617 GCTACTAGGGAGGCTAAGGTGGG + Intergenic
953600379 3:44357254-44357276 GCTACTTGGGAGGGTAAGGTGGG + Intronic
954263107 3:49454134-49454156 GCTGCTTGGGAGGGTAAGGTGGG + Intergenic
954311882 3:49775748-49775770 GGGTGAAGGGAGGGGAGGGTTGG - Intronic
954344678 3:49986895-49986917 GCTACTAGGGAGGGTGAGGTAGG - Intronic
954908435 3:54083044-54083066 GCTACTTGGGAGGCTAGGGTGGG + Intergenic
955251641 3:57288824-57288846 GCTACTCGGGAGGGTGGGGTAGG - Intronic
955261513 3:57395843-57395865 GCTACTAGGGAGGGTGAGGTGGG + Intronic
955698997 3:61664717-61664739 GCTACTAGGGAGGCTGGGGTGGG + Intronic
955787502 3:62555850-62555872 GCTACTAGGGAGGCTAAGGTGGG - Intronic
955793434 3:62610991-62611013 GCATCTAGTGAGTGGAGGCTGGG + Intronic
956933236 3:74070342-74070364 CCTACTTGGGAGTGGAGGGTGGG + Intergenic
957671923 3:83316214-83316236 GCTACTAGAGAGTGGAGGGAGGG - Intergenic
957951327 3:87131166-87131188 GCTACTTGGGGGTGGAGGGTGGG - Intergenic
958864237 3:99482583-99482605 GCTTGTGGGGGTGGGAGGGTGGG - Intergenic
958866334 3:99505952-99505974 TCTGCTTTGGAGGGGAGGGTTGG - Intergenic
959997289 3:112693528-112693550 GCTACCAGGGAGGGTAGGGAAGG - Intergenic
960435199 3:117618209-117618231 ACTATTAGAGAGGGGAGGGTGGG + Intergenic
960699242 3:120424766-120424788 GCTTCTAGGGCCTGGAGGGTTGG + Intronic
960907974 3:122620718-122620740 GCTGCCTGGGAGGGGAGGGTGGG + Intronic
960962795 3:123083917-123083939 GCTTATGGGGAGGGGAGGAAAGG + Intronic
961144830 3:124584973-124584995 GGTGGTAGGGAGGGAAGGGTTGG + Intronic
961199815 3:125036096-125036118 GCTACTTGGGAGGCTAGGGTGGG + Intronic
961731538 3:128968805-128968827 GGTTATAGAGAGGGGAGGCTAGG + Exonic
962314482 3:134350687-134350709 GCTTCCAGGGAGGAAGGGGTGGG + Intergenic
962547823 3:136455366-136455388 GCTTGTAGGGAGGGGGCAGTTGG - Intronic
963411037 3:144928022-144928044 ACTACTAGGGATGGGGGGGTGGG + Intergenic
963772771 3:149405624-149405646 GCTTCTCGGGAGGCCAAGGTGGG + Intergenic
963940681 3:151093190-151093212 GCTACTAGGGAGGTCAAGGTAGG + Intronic
964060193 3:152512708-152512730 GCTACTAGGGAGGCTAAGGTGGG + Intergenic
964229176 3:154442891-154442913 GCTTATAGGGACAGGATGGTAGG + Intergenic
964379088 3:156079301-156079323 GCTTCTGGAAAGGGGAGGGAAGG - Intronic
964782374 3:160354539-160354561 GCTGCTAGGGAGGCTAAGGTAGG + Intronic
965593526 3:170385187-170385209 GCTACTAGGGAGGGTGAGGTGGG - Intronic
965783644 3:172314195-172314217 GCTCTTAGAGAGGGGAGGGGTGG - Intronic
966408193 3:179621187-179621209 GCTACTAGGGAGGCTTGGGTGGG - Intronic
966621968 3:181974982-181975004 GAGACTAGGGAGGGGATGGTGGG - Intergenic
967416643 3:189225710-189225732 TCCTGTAGGGAGGGTAGGGTGGG + Intronic
967651359 3:191990395-191990417 GCTACTAGGGTGGGTAGGGAAGG - Intergenic
967879721 3:194292947-194292969 GCTACTAGGGAGGCTAAGGTGGG - Intergenic
967990486 3:195126713-195126735 TTCTCTAGGGAGGGGAGTGTTGG - Intronic
968124003 3:196145140-196145162 GCTACTAGGGAGGCTAAGGTGGG - Intergenic
968168045 3:196484591-196484613 GCTACTTGGGAGGTGAAGGTGGG - Intronic
968323118 3:197788951-197788973 GCTACTTGGGAGGGTAAGGTGGG - Intergenic
968522405 4:1039914-1039936 GGGCCTTGGGAGGGGAGGGTTGG + Intergenic
968673409 4:1864301-1864323 GCCTCCAAGGAGGGGAGGGAAGG - Intergenic
968776401 4:2543448-2543470 GCATTTAGGGAGGCCAGGGTGGG + Intronic
969084013 4:4641865-4641887 GCTACTCTGGAGGGGAGGGAAGG - Intergenic
969345026 4:6564694-6564716 CCTTCCTGGGAGGGGAGGGTAGG - Intergenic
970284617 4:14496176-14496198 GTTTCAAGGGAGTGGAGGGGAGG + Intergenic
970660237 4:18277214-18277236 GCTACTAGGGAGGCTGGGGTAGG + Intergenic
971033415 4:22666342-22666364 GCTACTTGGGAGGCGAAGGTGGG + Intergenic
971341687 4:25775035-25775057 GTTTGTAGGGAGCAGAGGGTGGG + Intronic
972772906 4:42214903-42214925 GCTACTAGGGAGGCTAAGGTGGG - Intergenic
974366257 4:60953542-60953564 ACTACTAGAGAGGGGAGGGAGGG - Intergenic
974379239 4:61117434-61117456 GCTACTCGGGAGGCTAGGGTGGG - Intergenic
974444608 4:61963412-61963434 CCTTCTTGAGAGTGGAGGGTGGG - Intronic
974891615 4:67890925-67890947 GCTACTAGGGAGGCCAAGGTGGG - Intergenic
975022813 4:69511101-69511123 GCTACTCGGGAGGGTAGGGTAGG - Intronic
975626169 4:76349555-76349577 GCTACTAGGGAGGCTAAGGTAGG + Intronic
975640595 4:76496201-76496223 GCTTCTGGGGTGAGGAGGGCAGG + Intronic
976220665 4:82754519-82754541 GCTGCTGGTGAGGGGAGGGTGGG - Intronic
976249991 4:83040585-83040607 TCTTGTAGGGAGGAGAAGGTGGG - Intronic
976644530 4:87373596-87373618 GCTACTAGGGAGGCCAAGGTGGG + Intronic
976717179 4:88135508-88135530 GTGTGTAGGGATGGGAGGGTGGG - Intronic
977286783 4:95117672-95117694 GCTACTAGGGAGGCTAAGGTGGG + Intronic
977895400 4:102358888-102358910 TCTTCTGGGGAGTGGAGAGTGGG - Intronic
979145814 4:117246523-117246545 GACTCTAGGGAAGGGAAGGTGGG - Intergenic
979234705 4:118386386-118386408 GCTTCTTGGGAGGCTAAGGTGGG + Intergenic
979854730 4:125617725-125617747 GCTACTCGGGAGGCTAGGGTAGG + Intergenic
979988901 4:127350703-127350725 TCTACTTGCGAGGGGAGGGTGGG + Intergenic
979996814 4:127441061-127441083 TCTACTTGCGAGGGGAGGGTGGG + Intergenic
980087171 4:128403492-128403514 GCTACTAGGGTGGGTAGGGAAGG + Intergenic
980455006 4:133028029-133028051 ACTACTGGAGAGGGGAGGGTGGG + Intergenic
980923597 4:139113244-139113266 GCTACTAGGGAGGCTAAGGTGGG + Intronic
981046579 4:140270443-140270465 GCTACTAGGGAGGGTAAGGTGGG - Intronic
981229897 4:142340517-142340539 GCTTCTAGGGAGGCTGAGGTGGG - Intronic
981312168 4:143307857-143307879 GCTTCCTGGGAGGTGAGGGCTGG + Intergenic
981748021 4:148069381-148069403 CCTTCCAGGGAGGGGAGGGCTGG + Intronic
981966013 4:150604290-150604312 GCTTCTTGGGAGGCTAAGGTGGG + Intronic
983905230 4:173174621-173174643 GGTCTTAGGGAGGGGAGGATGGG - Intronic
985132034 4:186748444-186748466 CCTTTTAGTGAGTGGAGGGTGGG - Intergenic
1202765904 4_GL000008v2_random:148374-148396 GATTCTGGGGTGGAGAGGGTTGG - Intergenic
985694142 5:1330473-1330495 GCTTCTTGGGCGTGGTGGGTTGG - Intronic
986280473 5:6318032-6318054 GCCTCTGGAGAGGGCAGGGTGGG + Intergenic
986737125 5:10676094-10676116 CCTTCACTGGAGGGGAGGGTAGG - Intergenic
987320931 5:16768785-16768807 GCTGCTTGGGAGGAGAGGGTGGG - Intronic
987506220 5:18776631-18776653 GCTTCTTGGGAGGCTAGGGTGGG - Intergenic
987831521 5:23101847-23101869 ACTTCTAGAGAGGGGACGTTGGG + Intergenic
988401376 5:30765320-30765342 GGTGCGAGTGAGGGGAGGGTTGG - Intergenic
988899304 5:35715025-35715047 GCTACTCGGGAGGCTAGGGTGGG - Intronic
989708015 5:44361383-44361405 GCCTCTAGGGAGGAGAAGGATGG - Intronic
989727483 5:44603992-44604014 GCTACCAGGGTGGGTAGGGTGGG - Intergenic
990495855 5:56347055-56347077 GATTTTAGGGAGGGGATGGAAGG - Intergenic
990800806 5:59600234-59600256 GCTTTAAGAGAGGGTAGGGTTGG + Intronic
991583062 5:68176578-68176600 GCTACTAGGGAGGCCAAGGTAGG - Intergenic
991630382 5:68650633-68650655 GCTTCCAGGGTGGAGATGGTGGG - Intergenic
991725326 5:69530090-69530112 GCTACTCGGGAGGCTAGGGTAGG + Intronic
992065633 5:73104996-73105018 GCATCCAGGGAGAGGAGGGCAGG + Intergenic
993269654 5:85778034-85778056 TCTTTTGGGGTGGGGAGGGTAGG - Intergenic
993308186 5:86295826-86295848 TCTTCTAGGGAGGAGTGGGAGGG - Intergenic
993964782 5:94347211-94347233 GCTACTAGGGTGGGTAGGGAAGG - Intronic
994370641 5:98963594-98963616 GCTTCTGCTGGGGGGAGGGTTGG + Intergenic
994535969 5:101029793-101029815 CCTACTTGAGAGGGGAGGGTGGG + Intergenic
994712472 5:103282456-103282478 ACTTCTAGGGAGTGGGGGGAAGG - Intergenic
994956109 5:106535176-106535198 CCTACTTGGGAGTGGAGGGTGGG - Intergenic
995412464 5:111874032-111874054 GTTCCCAGGGACGGGAGGGTGGG + Intronic
995555583 5:113324942-113324964 GCTACTTGGGAGGCTAGGGTGGG - Intronic
995787870 5:115849809-115849831 GCTACTTGGGAGGGTAAGGTGGG + Intronic
995817824 5:116191694-116191716 GCTACTAGGGTGGGTAGGGAAGG - Intronic
995878791 5:116820998-116821020 GCTTCTGGGGAAGGGTAGGTAGG - Intergenic
996421504 5:123267853-123267875 GCTACTAGGGAGGCCAAGGTAGG + Intergenic
996571400 5:124935983-124936005 GCCTCTGGGGAGGGAAGGGGGGG - Intergenic
996681575 5:126233161-126233183 TCTACTGGAGAGGGGAGGGTAGG + Intergenic
996793334 5:127317148-127317170 GCTTTTAAGAAGGGGAGTGTGGG + Intronic
997060174 5:130491666-130491688 GCTTCTTGGGAGGCTAAGGTGGG - Intergenic
998115199 5:139531873-139531895 GCTACTCGGGAGGCTAGGGTGGG + Intronic
998155418 5:139784051-139784073 GCTACTTGGGAGGCTAGGGTGGG - Intergenic
998889799 5:146734165-146734187 GCTACTTGGGAGGCGAAGGTGGG - Intronic
999144883 5:149385802-149385824 GCTTCTGCTGAGGGCAGGGTTGG - Intronic
999147163 5:149404070-149404092 GCTTCTTGGGAGGTGAAGGGAGG - Intronic
999191084 5:149747933-149747955 GGTTCCAGGGAGAGCAGGGTGGG + Intronic
999270647 5:150294703-150294725 GCTTGTGGGGAGGGAAGGGAGGG - Intergenic
999407617 5:151321274-151321296 GCTACTTGGGAGGCTAGGGTGGG - Intronic
999463078 5:151772910-151772932 GCTTCCAGGGAGACAAGGGTTGG + Intronic
1000023749 5:157341167-157341189 TCTTCTAGGCAGGGTAGGGCAGG - Intronic
1000189619 5:158897407-158897429 CCTTCTAGAGGGTGGAGGGTTGG + Intronic
1000535165 5:162470328-162470350 TCTTCCAGGGAGGAGATGGTAGG - Intergenic
1000730552 5:164829149-164829171 GATTCTGGGGTGGGGTGGGTGGG + Intergenic
1000929033 5:167229848-167229870 GCTACAAGGGAGGGCAGGATTGG + Intergenic
1001037908 5:168311167-168311189 GCTGCCTGGGAGGGGAGGGGAGG - Intronic
1001093233 5:168756778-168756800 GCTTCTTTGTTGGGGAGGGTGGG + Intronic
1001106232 5:168856964-168856986 GCTCCTGGGGAAGGGATGGTGGG + Intronic
1001168743 5:169395975-169395997 CCTTTTAGAGAGTGGAGGGTGGG - Intergenic
1001333215 5:170777005-170777027 GCTTCCAGGGAGGGGCGGCCTGG - Intronic
1001456645 5:171866746-171866768 GCTTATTGGGAGGGGAGGTCAGG + Intronic
1001695743 5:173668336-173668358 GCTTCTGGGAACAGGAGGGTAGG + Intergenic
1002446875 5:179295407-179295429 GCTTGCAGGGCGGGGAGGCTGGG - Intronic
1002471668 5:179439300-179439322 GGCTCTTGGGAGGGAAGGGTTGG - Intergenic
1002575429 5:180171281-180171303 GTTTCTGGGGAAGGGAGGGCAGG + Intronic
1002603807 5:180370332-180370354 GCTGCTGGGGAGGGGAGGGAGGG + Intergenic
1002670249 5:180861047-180861069 GTTTCTGGGGAGCGGAGGGGAGG - Intronic
1002948990 6:1789645-1789667 GCTACTAGGGAGGCTAAGGTGGG - Intronic
1003428999 6:6021967-6021989 GCTTCTAAGAAGGGGAAGTTTGG + Intergenic
1003563071 6:7199773-7199795 GCTACTCGGGAGGGTAAGGTGGG - Intronic
1003645343 6:7910031-7910053 GCACCGAGGGAGGGGAAGGTGGG - Intronic
1003980097 6:11381249-11381271 GCTTCTGGGCAGGGGAAGGAGGG + Intronic
1004516205 6:16324337-16324359 GCTACTAGGGAGGTTGGGGTGGG + Intronic
1005045018 6:21633694-21633716 GCTACTAGGGAGGTGGAGGTTGG + Intergenic
1005365316 6:25070363-25070385 GCTACTAGGGAGGGTGAGGTGGG + Intergenic
1005703215 6:28425437-28425459 GCTACTAGGGAGGCTAAGGTGGG - Intergenic
1006417051 6:33910866-33910888 GCAGGTAGGGAGGGGAGGGCAGG - Intergenic
1006897280 6:37479271-37479293 GCTGCTAAGGAGGGCAGGCTTGG - Intronic
1007154143 6:39725501-39725523 GGGGCTAGGGAGGGGAGGGCGGG + Intergenic
1007173834 6:39883093-39883115 GATTCCTGAGAGGGGAGGGTTGG + Intronic
1007355554 6:41313061-41313083 GCTGCTAGAGAGGTGAGGGGAGG + Intergenic
1007743734 6:44029490-44029512 GGTTCTAGGGAGGGGAGGGCAGG + Intergenic
1009051731 6:58283738-58283760 GCTTGGAGGAAGGGGAGGGGTGG + Intergenic
1011620399 6:89237326-89237348 GCTTCCAGGGTGGGGAGGGAAGG + Intergenic
1011862491 6:91777125-91777147 ACTACTAGAGAGGGGAGGGTGGG + Intergenic
1012077352 6:94707162-94707184 GCTACTAGGGAGGCTAAGGTGGG + Intergenic
1012572168 6:100742767-100742789 GTTTCTAGGGTGAGGAGGATGGG - Intronic
1013139201 6:107314013-107314035 GCTACTAGGGAGGCTGGGGTAGG + Intronic
1013215319 6:108022141-108022163 GCTACTTGGGAGGCGAAGGTGGG - Intergenic
1013246358 6:108290883-108290905 GCTACTAGGGAGGCTGGGGTAGG + Intergenic
1013359288 6:109379258-109379280 GCTACTAGGGAGGCCAAGGTTGG + Intronic
1013370338 6:109464692-109464714 GCTACTAGGGAGGCTAAGGTGGG + Exonic
1013554470 6:111241919-111241941 GCTACTAGGGAGGCTAAGGTGGG + Intergenic
1013858520 6:114605089-114605111 GCTACTCGGGAGGTGAAGGTGGG + Intergenic
1014075761 6:117232617-117232639 GCTTGTGGGGAGGTGAGGATGGG - Intergenic
1014304807 6:119727408-119727430 GCTTCCAGGGTGGGTAGGGAAGG + Intergenic
1014330320 6:120055903-120055925 TCTTCTAGGGAGGGGAAGATGGG - Intergenic
1014490239 6:122053555-122053577 ACCTCTAGGGCTGGGAGGGTAGG - Intergenic
1014531374 6:122563550-122563572 GCTACCAGGGAGGGTAGGGAAGG + Intronic
1015588319 6:134798679-134798701 GCTACTTGGGAGGCTAGGGTAGG + Intergenic
1015704340 6:136071679-136071701 GCTACTAGGGAGGCTAAGGTGGG + Intronic
1015725531 6:136295741-136295763 GCCTTTAGGAAGGTGAGGGTGGG - Intergenic
1015767752 6:136737228-136737250 GATACTAGAGACGGGAGGGTGGG + Intronic
1015841766 6:137484748-137484770 ACTACCAGTGAGGGGAGGGTGGG + Intergenic
1016187152 6:141210795-141210817 GTCTAGAGGGAGGGGAGGGTTGG + Intergenic
1016471840 6:144383041-144383063 GCTACTTGGGAGGGTGGGGTGGG - Intronic
1017190466 6:151648279-151648301 GCTACTAGGGAGGGTAGGGAAGG + Intergenic
1017687971 6:156932021-156932043 GCTACTAGGGAGGCATGGGTGGG + Intronic
1018441381 6:163816615-163816637 TCTTCTGGGGCGGGGAGGGGGGG + Intergenic
1018719284 6:166560666-166560688 GCTTGGTGGGAGGGGAGGGAGGG + Intronic
1019454650 7:1120401-1120423 GCTGCTAGGGAGGCGAAGATGGG - Intronic
1019630507 7:2046414-2046436 GCCTGTCTGGAGGGGAGGGTTGG - Intronic
1019912153 7:4107106-4107128 ACATCCAGGGTGGGGAGGGTGGG + Intronic
1020051484 7:5084862-5084884 GCTACTTGGGAGGCGGGGGTGGG + Intergenic
1020230395 7:6314074-6314096 GCTGCTAGGGAGGCTAAGGTGGG - Intergenic
1021022123 7:15614300-15614322 GCTTCTCAGGAGGCTAGGGTTGG + Intronic
1021733286 7:23618268-23618290 ACTTCCAGGGAGGGGAGGAGGGG - Intronic
1022371941 7:29780279-29780301 GCTACTTGGGAGGCTAGGGTGGG - Intergenic
1022514275 7:30965516-30965538 GATTCTAGGGAGGGAAGTGGTGG - Intronic
1022840353 7:34158296-34158318 GCATCTAGAGAGGGAAGGGAAGG + Intergenic
1023481183 7:40636358-40636380 GCTTCCAGGGAGAGGTGGGGAGG + Intronic
1023532565 7:41173677-41173699 AGTTGTGGGGAGGGGAGGGTGGG - Intergenic
1023803325 7:43853606-43853628 CCTTCTAGGTAGAGGAAGGTTGG - Intergenic
1023914326 7:44577222-44577244 GCTACTTGGGAGGGTAAGGTAGG + Intergenic
1024605760 7:51021440-51021462 GCTCCTTGGGAGGTGAAGGTAGG - Intronic
1025270530 7:57508713-57508735 GCTTCTGGGGAGGGAAGCGAGGG - Intergenic
1025776772 7:64567941-64567963 GATTCTAGGGAGGGGGTGGGAGG - Intergenic
1026333430 7:69373097-69373119 GCTACTTGGGAGGCCAGGGTGGG + Intergenic
1026491232 7:70865851-70865873 GCTACTTGGGAGGTTAGGGTAGG - Intergenic
1026598421 7:71753250-71753272 GCTACTAGGGAGGCTAAGGTAGG - Intergenic
1026778382 7:73246576-73246598 GCTACTCGGGAGGTGAAGGTGGG + Intergenic
1027122514 7:75532126-75532148 GCTTCTAGGGAGGGCGAGATGGG - Intergenic
1027295388 7:76764288-76764310 GCTACCAGGGTGGGGAGGGGAGG - Intergenic
1027332246 7:77109556-77109578 GCTTCTCGGGAGGTTGGGGTGGG + Intergenic
1027356847 7:77365384-77365406 TCTTCTTGAGAGTGGAGGGTGGG - Intronic
1027379402 7:77590462-77590484 GCTACTTGGGAGGCTAGGGTGGG + Intronic
1027682005 7:81233257-81233279 GGTTCTAGGCAGGAAAGGGTGGG - Intergenic
1028158598 7:87460437-87460459 TCTACTAGAGAGGGGAGGGAGGG - Intronic
1028509702 7:91610461-91610483 TCTCCTAGGGAGGGAGGGGTGGG + Intergenic
1028563347 7:92200463-92200485 GCTACTAGGGAGGCCAAGGTGGG - Exonic
1028578006 7:92374364-92374386 GCTACTAGGGAGGCTAAGGTAGG + Intronic
1028752061 7:94393617-94393639 CCTAGTAGGGAGTGGAGGGTTGG + Intergenic
1029000667 7:97151342-97151364 GCTTCTAGGGAGTGGAGGTGAGG + Intronic
1029546295 7:101212220-101212242 GCTTGCGGGGAGGAGAGGGTGGG - Intronic
1029783533 7:102761773-102761795 GCTTCTCGGGAGGTTGGGGTGGG - Intronic
1029895469 7:103978887-103978909 GCCTCCAGGGTGGGGAGGGTAGG - Intronic
1029970720 7:104786064-104786086 GCTTCTAGGAAGGGAAGGTTGGG - Intronic
1029975454 7:104828921-104828943 GCTTCTCGGGAGGCTGGGGTGGG + Intronic
1030547504 7:110915444-110915466 GTTTCCAGGGCTGGGAGGGTGGG + Intronic
1030863408 7:114667175-114667197 GCATTTTGGGAGGGGAGGGCAGG + Intronic
1030924559 7:115435865-115435887 ACTACTAGAGAGGGGAGGGAGGG + Intergenic
1032080607 7:128856693-128856715 CCTTCTGGGGAGGGGAAGGATGG + Intronic
1032149158 7:129412948-129412970 GCTACTAGGGAGGCTAAGGTGGG - Intronic
1032514544 7:132496873-132496895 CCTCCTTGGGAGGGGAGAGTTGG - Intronic
1032582000 7:133112198-133112220 GCTCCTAAGAAGGGGAGGTTAGG - Intergenic
1032658091 7:133953537-133953559 GCTACTAGGGAGGCTAAGGTGGG + Intronic
1033182567 7:139195412-139195434 GCTACTTGGGAGGCGAAGGTGGG - Intergenic
1033730884 7:144178465-144178487 GCCTCTAGGGAGAGGAGGAAAGG - Intergenic
1034211474 7:149367296-149367318 GCATCTAGGGTGGGGAGAGGGGG + Intergenic
1034422464 7:150996744-150996766 GCTCCTGGGGAGGAGAGGGGTGG - Exonic
1034521063 7:151620420-151620442 GCTTCTTGGGAGGCCATGGTAGG - Intronic
1034752371 7:153582868-153582890 GCTTCTGGGGAGGGCAGAATGGG + Intergenic
1034837197 7:154363362-154363384 GCTTCAAGAGAGGGTTGGGTAGG + Intronic
1035143025 7:156783281-156783303 GCTTCTCGGGAGGCAAAGGTGGG - Intronic
1035728800 8:1840862-1840884 GCTGCTGGGGTGGAGAGGGTGGG + Intronic
1035961257 8:4140554-4140576 GCTACTAGGGAGGCTAAGGTGGG + Intronic
1036495116 8:9263245-9263267 ACTACTAGAGAGGGGAGGGAGGG + Intergenic
1037080386 8:14778033-14778055 GCTACTAGGGAGGCTAAGGTGGG - Intronic
1037342230 8:17858411-17858433 GCTACTAGAGGAGGGAGGGTTGG + Intergenic
1037486302 8:19350593-19350615 GCTACTCGGGAGGCGAGGGTGGG - Intronic
1037748218 8:21663019-21663041 GCAGCTTGGTAGGGGAGGGTGGG - Intergenic
1038030817 8:23637674-23637696 GCTACTTGGGAGGTGAAGGTGGG + Intergenic
1038038846 8:23707291-23707313 GCTCCTAGGAAGTGGCGGGTCGG - Intergenic
1038049162 8:23792890-23792912 GCTACTTGGGAGGTGAAGGTGGG - Intergenic
1038389860 8:27186573-27186595 GCTCCTAGGGAGGCTAAGGTGGG - Intergenic
1038803281 8:30768537-30768559 GCTACTAGGGAGGCTAAGGTGGG + Intergenic
1039060340 8:33567256-33567278 GCTTCCAGGGAAGGGAGGCTGGG - Intergenic
1039070468 8:33644888-33644910 TCTTCCATGGATGGGAGGGTAGG - Intergenic
1039294693 8:36137679-36137701 GCTCCTTGGGAGGCGAAGGTGGG + Intergenic
1039462173 8:37754262-37754284 CTTTCTAGGGAAAGGAGGGTGGG + Exonic
1039766412 8:40633052-40633074 TCTTCCAGGGCTGGGAGGGTAGG + Intronic
1039810485 8:41043870-41043892 GCTACTAGGGTGGGTAGGGAAGG + Intergenic
1040004891 8:42611655-42611677 GCTACTCGGGAGGCGAAGGTGGG + Intergenic
1041572198 8:59350243-59350265 ACTTCTAGAGAGGGGAAGGAGGG + Intergenic
1041672841 8:60510365-60510387 GCTACTAGGGAGGCTAAGGTGGG - Intergenic
1041771016 8:61472327-61472349 GTTTCTGGAGAGGGGAGGGAAGG + Intronic
1041776864 8:61532703-61532725 GCTTCTAGAGAAGGAAGGATAGG - Intronic
1041788257 8:61660148-61660170 ACTTCTAGAGAGGGGAGAGAGGG - Intronic
1042183731 8:66116493-66116515 GCTGCTCGGGAGGGTAAGGTAGG + Intergenic
1043601577 8:81945217-81945239 GCTTCAAGGGGTGGGAGTGTGGG + Intergenic
1043926010 8:86037711-86037733 GCTTCTAGGGAGGCTGAGGTGGG + Intronic
1044650998 8:94495110-94495132 GCTACTAGGGAGGCTAAGGTGGG - Intronic
1045048058 8:98297681-98297703 ACTACTAGAGAGGGGAGGGAAGG - Intergenic
1045383746 8:101651637-101651659 GCTGCTGAGGCGGGGAGGGTAGG - Intronic
1045524925 8:102933424-102933446 GCTTCCTGGGAGGGGAGGAATGG - Intronic
1045665042 8:104475605-104475627 GCTACTAGGGAGGCTAAGGTGGG - Intergenic
1045666968 8:104498374-104498396 CTTTCTAGGGAGGGTGGGGTGGG - Intronic
1046208267 8:111033013-111033035 ACTACTAGGGAAGGGAGGGAGGG - Intergenic
1046421339 8:113987152-113987174 ACTACTAGAGAGGGGAAGGTAGG + Intergenic
1046642141 8:116743644-116743666 GCTACTAGGGAGGCTAAGGTGGG + Intronic
1046783592 8:118242022-118242044 GCTTCTAGGGAGGCTGAGGTGGG - Intronic
1047234605 8:123028954-123028976 GCTACTAGGGAGGCTAAGGTGGG + Intronic
1047575977 8:126155655-126155677 ACTGCTAGAGAGGGGAGGGAGGG + Intergenic
1047693127 8:127376979-127377001 TCTTTTGGGGAGGGGAGGGCGGG - Intergenic
1047754438 8:127907820-127907842 GGTTGTAAGGAGGGGATGGTTGG + Intergenic
1048096733 8:131303838-131303860 TCTACTTGAGAGGGGAGGGTGGG - Intergenic
1048124710 8:131621021-131621043 ACTACTAGAGAGGGGAGGGAGGG + Intergenic
1048915730 8:139181289-139181311 GGTACTAGGTAGGGCAGGGTGGG + Intergenic
1049108561 8:140628655-140628677 GCTTCTTGGGAGGTGGAGGTGGG + Intronic
1049292556 8:141812386-141812408 GCCTCCAGGGCGGGGAGGGCGGG + Intergenic
1049555053 8:143277499-143277521 GCTTCTGGGCAGGGGAGTCTGGG + Intergenic
1049753053 8:144294758-144294780 GGGTCTTGGGAGGGGGGGGTGGG - Intronic
1049757224 8:144316091-144316113 TTTTCTAGGTAGGGGAGTGTGGG + Exonic
1050147355 9:2583469-2583491 GCTGCTATGGAGGGCATGGTGGG + Intergenic
1050575235 9:6988041-6988063 GCTACTAGGGAGGCTAAGGTAGG + Intronic
1051712277 9:19944103-19944125 ACTACTAGGCAGGGGAGGGAGGG + Intergenic
1053091827 9:35285603-35285625 GCTTCTCAGGAGGCTAGGGTAGG + Intronic
1053091918 9:35286477-35286499 GCTTCTTGGGAGGCCAAGGTGGG - Intronic
1053200621 9:36149463-36149485 CCTTGGAGGGAGGGGTGGGTAGG - Intronic
1053401241 9:37825565-37825587 CCTTCCAGAGAGTGGAGGGTGGG + Intronic
1055299861 9:74871789-74871811 GATACTCGGGAGGTGAGGGTGGG - Intronic
1055982340 9:82016696-82016718 GCTACTAGGGAGGCAAAGGTGGG - Intergenic
1057756049 9:97836717-97836739 GCTACTAGAGGAGGGAGGGTGGG - Intergenic
1057885668 9:98827905-98827927 GCTTCTTGAGGGGGGAAGGTAGG - Intronic
1058102460 9:100932405-100932427 ACTACTAGAGGGGGGAGGGTGGG - Intergenic
1058862019 9:109126008-109126030 GCTACTAGGGAGGTTGGGGTGGG - Intergenic
1059200186 9:112407526-112407548 GCTTCTTGGGAGGCTGGGGTTGG - Intronic
1059439375 9:114297034-114297056 GCTCCTGGAGATGGGAGGGTAGG + Intronic
1060706023 9:125802260-125802282 ACTACTAGAGAGGGGTGGGTGGG - Intronic
1060824976 9:126682781-126682803 GCTACTCGGGAGGGTAAGGTAGG + Intronic
1060996156 9:127875809-127875831 GAGCCTGGGGAGGGGAGGGTTGG - Intronic
1061043738 9:128153484-128153506 CCTTCGAGGAAGGGGAGGGGCGG + Intergenic
1061205402 9:129160247-129160269 GCTACTTGGGAGGCTAGGGTGGG - Intergenic
1061353793 9:130087552-130087574 GCTACTAGGGAGGCTAAGGTGGG + Intronic
1061429269 9:130520951-130520973 GCTTCCAGGGGCGGGAGGGGTGG + Intergenic
1061523554 9:131138238-131138260 GGTTATGGGGAGGGGAGGGGAGG - Intronic
1061540044 9:131273321-131273343 GCTTCCTGGGAGGGGCGGCTTGG - Intronic
1061776935 9:132971860-132971882 GCTACTAGGGAGGCGAAGGCAGG + Intronic
1061882708 9:133575998-133576020 GCTTCTGGGGAGGGGCTGCTTGG + Intergenic
1061895172 9:133643352-133643374 GCTGCTGGGGAGGGGAGGGTGGG + Intronic
1061917176 9:133761381-133761403 GCTTCTCGGGAGGGTGAGGTGGG - Intergenic
1062049442 9:134439473-134439495 GCTTCCAGGGTGCGGAGGGCCGG - Intronic
1062120888 9:134833553-134833575 GCTTCTGGGAAGGGGAGGAGTGG + Intronic
1062186798 9:135222519-135222541 GCTGCTAGGGAGGCGAGGCCTGG + Intergenic
1062392123 9:136338057-136338079 CCTTCTGGGGAGGGGAGGGGAGG - Intronic
1203546655 Un_KI270743v1:133263-133285 GATTCTGGGGTGGAGAGGGTTGG - Intergenic
1185586107 X:1243101-1243123 CCTTCCTGGGCGGGGAGGGTGGG - Intergenic
1185796447 X:2969378-2969400 GCTTCTAGGGAGTGGAGCCCAGG - Intergenic
1186198954 X:7137127-7137149 GCTACTAGGGAGGCTAGGGCAGG + Intronic
1187331615 X:18345501-18345523 GCTACTAGGGAGGGTGAGGTGGG - Intronic
1187443317 X:19339362-19339384 GCTACTAGGGAGGCCAAGGTAGG - Intergenic
1187503134 X:19856649-19856671 GCCTCTGGGGAGGGGAAGTTGGG - Intronic
1188820530 X:34769316-34769338 GCTACTAGGGAGGCTAAGGTGGG + Intergenic
1189374052 X:40452727-40452749 GCTACTCGGGAGGGTAAGGTGGG - Intergenic
1189387668 X:40550669-40550691 GCCTCCAGGGAGGTGAAGGTCGG - Intergenic
1189492381 X:41480255-41480277 GCTACTAGGGAGGCTGGGGTGGG + Intergenic
1189519021 X:41746390-41746412 GCTTCCAGGGAAGGTAGGATTGG - Intronic
1189526686 X:41830109-41830131 GCTGCTTGGGAGGGTAAGGTGGG - Intronic
1190325584 X:49205081-49205103 CCTGCTGGGGAGGGGAGGGCAGG + Exonic
1191640299 X:63424310-63424332 GGCTCTAGGGAGGGGAGAGGAGG + Intergenic
1191852693 X:65597456-65597478 GCTACTAGGGAGGGCGAGGTGGG - Intronic
1192122219 X:68467164-68467186 GCTCCTCGGGAGGCTAGGGTGGG + Intergenic
1192486669 X:71533408-71533430 GGTTCGAGGGAAGGGAGGGAAGG - Intronic
1194245491 X:91506535-91506557 ACTTCTAGAGAGGGGAGGGAGGG + Intergenic
1194938195 X:99977050-99977072 CCTTCTTGGGATGGGAGGCTAGG + Intergenic
1195033691 X:100951120-100951142 GCTACTAGGGAGGCTAGGGCAGG + Intergenic
1196170913 X:112587659-112587681 GCTGCTAGGGTGGGTAGGGAAGG - Intergenic
1196803849 X:119567579-119567601 GCTACTAGGGAGGCTAAGGTGGG - Intergenic
1197045066 X:121986444-121986466 CCTACTTGAGAGGGGAGGGTGGG + Intergenic
1198534756 X:137574694-137574716 GCTGGGAGGGAGGGGAGGGGAGG + Intronic
1198854606 X:141002937-141002959 GCTTGTAGGTAGGGGTGGGAGGG + Intronic
1198877412 X:141242210-141242232 GCTTGTAGGTAGGGGTGGGAGGG - Intronic
1198908095 X:141584431-141584453 GCTTGTAGGTAGGGGTGGGAGGG - Intronic
1198908696 X:141589993-141590015 GCTTGTAGGTAGGGGTGGGAGGG + Intronic
1198918374 X:141698158-141698180 GCTTGTAGGTAGGGGTGGGAGGG - Intronic
1199075133 X:143517138-143517160 GCTTGTAGGTAGGGGTGGGAGGG - Intronic
1199214217 X:145247815-145247837 GCTTGTAGGTAGGGGTGGGAGGG + Intronic
1199674737 X:150178467-150178489 CCTTTTAGAGAGGGGAGGGTGGG + Intergenic
1200174287 X:154101673-154101695 GCTTCTTGGGAGGCTGGGGTGGG + Intergenic
1200564461 Y:4747787-4747809 ACTTCTAGAGAGGGGAGGGAGGG + Intergenic
1201144897 Y:11058943-11058965 GCATCTGGGGAGGGGAGCGGGGG + Intergenic