ID: 1084693383

View in Genome Browser
Species Human (GRCh38)
Location 11:70739698-70739720
Sequence CATTCTGAGGAGCAGGGGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 622
Summary {0: 1, 1: 0, 2: 17, 3: 106, 4: 498}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084693383_1084693388 -10 Left 1084693383 11:70739698-70739720 CCTAACCCCTGCTCCTCAGAATG 0: 1
1: 0
2: 17
3: 106
4: 498
Right 1084693388 11:70739711-70739733 CCTCAGAATGTGACTGTATTTGG 0: 220
1: 666
2: 1431
3: 2158
4: 2745
1084693383_1084693390 10 Left 1084693383 11:70739698-70739720 CCTAACCCCTGCTCCTCAGAATG 0: 1
1: 0
2: 17
3: 106
4: 498
Right 1084693390 11:70739731-70739753 TGGAGATAAGGTCTTTAAAGAGG 0: 30
1: 200
2: 589
3: 1095
4: 1587
1084693383_1084693391 29 Left 1084693383 11:70739698-70739720 CCTAACCCCTGCTCCTCAGAATG 0: 1
1: 0
2: 17
3: 106
4: 498
Right 1084693391 11:70739750-70739772 GAGGTGATTAAGTTAAAACGAGG 0: 8
1: 74
2: 343
3: 877
4: 1661
1084693383_1084693389 -2 Left 1084693383 11:70739698-70739720 CCTAACCCCTGCTCCTCAGAATG 0: 1
1: 0
2: 17
3: 106
4: 498
Right 1084693389 11:70739719-70739741 TGTGACTGTATTTGGAGATAAGG 0: 189
1: 756
2: 1475
3: 2452
4: 3684

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084693383 Original CRISPR CATTCTGAGGAGCAGGGGTT AGG (reversed) Intronic
900520554 1:3103425-3103447 CATTCTGAGCTCCTGGGGTTAGG + Intronic
900535355 1:3174347-3174369 CATTCTGAGGCCTGGGGGTTAGG + Intronic
900767799 1:4517034-4517056 CAATCTGAGGAGCATGTGTCTGG - Intergenic
901040319 1:6359475-6359497 CATCCTCTGAAGCAGGGGTTGGG - Intronic
901794359 1:11671909-11671931 CATTCTGGGGAGCAGAGTTGGGG - Exonic
902310600 1:15578819-15578841 CATTTTGAGGGGCAAGGGTGGGG + Intronic
903391987 1:22971215-22971237 CATTTTGAGGAGGAGGGGGGTGG - Intergenic
904957425 1:34296636-34296658 CATTCTGGGGCACAGGGGTTAGG - Intergenic
905206271 1:36344408-36344430 CATCCTGAGGAACAGGGGAGCGG - Intronic
905379550 1:37551479-37551501 CATTCTGAGGTACTTGGGTTTGG - Intronic
906523239 1:46479419-46479441 CATTCTGTGGAGCCTGGGGTGGG + Intergenic
906699715 1:47849146-47849168 CATTCTGAGGTCCTGGGGGTGGG - Intronic
908109785 1:60885284-60885306 CATTTTCAAGAGCAGAGGTTTGG - Intronic
908595178 1:65681029-65681051 CATCAGCAGGAGCAGGGGTTGGG + Intergenic
908736971 1:67286613-67286635 CATTCTGAGGTACTGGAGTTGGG + Intergenic
908775386 1:67634491-67634513 CATTCTGCGGAGCAGGGCATGGG + Intergenic
908941783 1:69443910-69443932 CATTCTAAGGTTCTGGGGTTGGG + Intergenic
910460472 1:87443623-87443645 CATTCTGAGGCACTGGGGGTTGG - Intergenic
910824941 1:91396833-91396855 CAGTCTGCGGCCCAGGGGTTGGG - Intronic
912335665 1:108860042-108860064 CATTTTGAGGAGCATAGATTAGG - Intronic
912870066 1:113295532-113295554 GGTTCTCAGGGGCAGGGGTTGGG + Intergenic
913066196 1:115257646-115257668 CATTCTGTGGTACTGGGGTTAGG + Intergenic
913160376 1:116139794-116139816 CATTCTGAGGTGCTGGGGGTTGG - Intergenic
914091854 1:144507506-144507528 GATACTGTGCAGCAGGGGTTTGG + Intergenic
914306685 1:146426358-146426380 GATACTGTGCAGCAGGGGTTTGG - Intergenic
914595364 1:149146444-149146466 GATACTGTGCAGCAGGGGTTTGG + Intergenic
915650105 1:157303387-157303409 CCTTCTGAGGTGCTGGGTTTAGG - Intergenic
915780628 1:158546241-158546263 CATTCTGAGAGACTGGGGTTAGG + Intergenic
917124267 1:171671643-171671665 CATTCTGAGGTACTGGGGTTAGG + Intergenic
917480963 1:175411793-175411815 CATTCTGAGGTTCTGGGGTTAGG + Intronic
917740238 1:177954453-177954475 CATCCTGAGCAGCAGAGGCTAGG + Intronic
920424756 1:205866169-205866191 CAGTCTGTGGCCCAGGGGTTGGG + Intergenic
920832575 1:209478913-209478935 CATTTTAAGGAGCAGGGTCTTGG - Intergenic
921166005 1:212507571-212507593 GATTATGAGGAGCTGGGATTCGG - Intergenic
921970592 1:221144275-221144297 CATTCTGAGGTACAGGGGTTAGG + Intergenic
922819839 1:228476693-228476715 CATTCTGAGGTCCTGGGGGTAGG - Intergenic
922999895 1:229998501-229998523 CACTCTGAGAAGTAGAGGTTAGG + Intergenic
923109801 1:230881750-230881772 TATTCTTTGGAGCAGGAGTTTGG - Intergenic
923660923 1:235956600-235956622 CATTCTGAGGTACTGGGATTAGG + Intergenic
924284831 1:242475683-242475705 CATTCTGAGATACTGGGGTTGGG - Intronic
1062895688 10:1101502-1101524 CATTCTGAGGTCCTGGGGTGAGG + Intronic
1063009415 10:2007883-2007905 CACTCTGAGGTGCAGCGGTTAGG - Intergenic
1063430580 10:5984854-5984876 CATTCTGAGGGTCAGGGGTTAGG + Intergenic
1064280149 10:13944132-13944154 CAGTCTGTGGCCCAGGGGTTGGG - Intronic
1064676676 10:17767090-17767112 CATTCTGAAGTACTGGGGTTTGG + Intronic
1064929626 10:20610626-20610648 GATTCAGAGAATCAGGGGTTAGG - Intergenic
1065044321 10:21732388-21732410 CATGCTGAGCAGCTGGGATTAGG + Intronic
1065138099 10:22692425-22692447 CCATCTGTGGAGTAGGGGTTGGG + Intronic
1065164519 10:22961039-22961061 CATTATGAGGTACTGGGGTTAGG + Intronic
1066474339 10:35730221-35730243 CATTTTGAGGTACCGGGGTTAGG + Intergenic
1066641603 10:37559650-37559672 CATTTTGAGGTACTGGGGTTAGG + Intergenic
1067051881 10:43026355-43026377 CAGTCAGAGGAGCAGGCATTGGG - Intergenic
1067250867 10:44586373-44586395 AGTTCTGAGGAGCAGTGGATGGG + Intergenic
1067427448 10:46220685-46220707 CATTCTGAGGAACCAGGGGTTGG - Intergenic
1067582881 10:47456595-47456617 CATTCTGAGGAATCTGGGTTAGG - Intergenic
1067767050 10:49094768-49094790 CATTCTCAGTGGCAGGGGGTGGG + Intronic
1067822302 10:49540705-49540727 CATTCTGAGGTCCCGGGGTGGGG - Intergenic
1068383951 10:56299034-56299056 CAGTCTGTGGCCCAGGGGTTGGG - Intergenic
1069325198 10:67224775-67224797 CAGCCAGAGAAGCAGGGGTTGGG + Intronic
1069358535 10:67615049-67615071 CATTCTGAGAAACTGGGGTTAGG + Intronic
1069825117 10:71250167-71250189 CATCCTGGGGAGCAGGGCCTGGG - Intronic
1069980112 10:72246597-72246619 CATTCTGAGATACTGGGGTTAGG + Intergenic
1070279470 10:75038106-75038128 CACACTGAGGGGCAGGTGTTGGG + Intronic
1072057307 10:91772734-91772756 CATTCTGAAGTACTGGGGTTAGG + Intergenic
1072205940 10:93205366-93205388 CATTCTGAGGTACTGGGGTAAGG + Intergenic
1072260514 10:93666024-93666046 CATTCTGAGGTACTGGGGATTGG + Intergenic
1075599449 10:123756610-123756632 CATTCTGAGATACTGGGGTTAGG - Intronic
1075682897 10:124345009-124345031 CAGTCTGCGGCCCAGGGGTTAGG + Intergenic
1075902703 10:126055866-126055888 CATGCTCAGGTGCAGGGGGTAGG - Intronic
1075929346 10:126282308-126282330 CATTCTAAGGTACCGGGGTTAGG + Intronic
1075936897 10:126350747-126350769 CATTCTACTGAGCAGGGGATAGG + Intronic
1075937222 10:126352725-126352747 CATTCTGCTGAGCAGGGGAAGGG + Intronic
1076071069 10:127490073-127490095 CATTCTGAGTTGTTGGGGTTGGG - Intergenic
1076107372 10:127834373-127834395 CACTCTGGGGAGCAGGGGTAAGG + Intergenic
1076538796 10:131200378-131200400 CAGACACAGGAGCAGGGGTTGGG - Intronic
1076701182 10:132274066-132274088 CAAGCTGAGGTGCAGGGGTTGGG + Intronic
1076890262 10:133279950-133279972 CATGCTGGGCAGCAGGGGTGTGG + Intronic
1077247194 11:1545405-1545427 CATTCTGAGGTACTGGGGTCAGG - Intergenic
1078540972 11:12212704-12212726 CATACTGAGGTACTGGGGTTAGG + Intronic
1078826359 11:14934418-14934440 CAGTCTGTGGCCCAGGGGTTGGG + Intronic
1081480913 11:43488007-43488029 CATTCTGAGGTACAGGGGATTGG + Intronic
1082222802 11:49661876-49661898 CATTCAGAGGAGGAGGGCTGTGG - Intergenic
1083034733 11:59626237-59626259 CATTCTGAGGTACAGGGGTTAGG + Intergenic
1083344150 11:61977828-61977850 CAGTCTATGGACCAGGGGTTGGG - Intergenic
1083940593 11:65893369-65893391 GGTTCTGAGGAGCTGGGGTTGGG + Intronic
1084509654 11:69595243-69595265 CATTCTGAGGCACCGGGGTTAGG - Intergenic
1084693383 11:70739698-70739720 CATTCTGAGGAGCAGGGGTTAGG - Intronic
1084747524 11:71182705-71182727 CATTCTCAGGTCGAGGGGTTAGG + Intronic
1084770920 11:71342446-71342468 CATGCTGAGGTGCTGGGGTTAGG - Intergenic
1084967961 11:72754124-72754146 CAGTCTGTGGCCCAGGGGTTGGG - Intronic
1086204892 11:84246056-84246078 CATTCTGGGGACCAGGAGGTGGG - Intronic
1086582035 11:88410423-88410445 CATTCTGAGGTACTGGGGTTAGG + Intergenic
1087159277 11:94933375-94933397 CACTCTGAGCAGCAGCAGTTTGG - Intergenic
1087730456 11:101772741-101772763 CATTCTGAGGTACTGGGGGTGGG - Intronic
1088432956 11:109778586-109778608 CATTCTGAGGTACTGGGGTTAGG + Intergenic
1088504721 11:110516664-110516686 CATGCTGGGGTGCAGGGTTTGGG + Intergenic
1088820479 11:113452396-113452418 CATGTTGAGGAGCAAGGGCTAGG + Intronic
1088877448 11:113947729-113947751 TATTCTGAGTACTAGGGGTTAGG + Intergenic
1089116604 11:116100266-116100288 CATTCTGAAGAGCAGGGGTCAGG + Intergenic
1089136736 11:116255220-116255242 CATTCTGAAGTACAGGGGCTAGG + Intergenic
1089218691 11:116852498-116852520 CTTCCTGAGGAGCAGGAGCTCGG + Intronic
1089315372 11:117587644-117587666 TAAACTGAGGAGCAGGGGATGGG + Intronic
1089370887 11:117956178-117956200 CATTCTGAGGTACGGGGGTTAGG - Intergenic
1089540927 11:119188555-119188577 CGTGCTGAGGGGCAGGGGCTAGG + Intronic
1089983867 11:122794772-122794794 CCTTATGAGGACCAGGGGCTCGG + Exonic
1090178563 11:124673600-124673622 CAGGCTGAGGGGCAGGGGTCCGG + Intronic
1090972476 11:131655155-131655177 GATTCTGAGGTGATGGGGTTGGG + Intronic
1091846025 12:3656954-3656976 CATCCTGAGGAGCAGGGCTTGGG - Intronic
1092134450 12:6136822-6136844 CATTCTGGGGTGCAGGGTGTGGG - Intergenic
1092578017 12:9811438-9811460 CATTCTGGGGATCAGGGTTGGGG + Intergenic
1092973666 12:13723454-13723476 AATTCTAGGGAGCAGGGCTTAGG - Intronic
1093881013 12:24404807-24404829 CATTCTGAGATCCTGGGGTTAGG - Intergenic
1094555020 12:31490432-31490454 CTTTTTGAGGAGACGGGGTTTGG - Intronic
1095186524 12:39207396-39207418 CATTCTGAGATACCGGGGTTAGG - Intergenic
1096918976 12:55063619-55063641 CATCCTGAGAAGCAGGGGTGGGG + Intergenic
1097100110 12:56581856-56581878 CATTCTGAAGAGCTGTGGTGGGG - Exonic
1097313473 12:58147333-58147355 GCTACTGAAGAGCAGGGGTTGGG + Intergenic
1098019378 12:66136510-66136532 CATTCTGAAGTGCTGGGATTAGG - Intronic
1098273857 12:68794276-68794298 CATTCTGAGATAGAGGGGTTAGG + Intergenic
1099705669 12:86150287-86150309 CAGTCCGTGGACCAGGGGTTAGG + Intronic
1099947196 12:89258205-89258227 CATTCTGAGATATAGGGGTTAGG - Intergenic
1100163969 12:91895020-91895042 CATTTTGGGGGGCAGGGGTGTGG + Intergenic
1100420081 12:94424191-94424213 CATTCTGAAGAGCTGTGGTGGGG + Intronic
1100477395 12:94947059-94947081 CATTTTGAGGTACTGGGGTTAGG - Intronic
1101008704 12:100427848-100427870 CATTCAGAGGAGAAGAGATTGGG + Intergenic
1101026463 12:100611804-100611826 CAGTCTGTGGCCCAGGGGTTGGG + Intronic
1101051556 12:100868985-100869007 CATCCTGTGGAGAAGGGGGTTGG - Intronic
1101917639 12:108908267-108908289 CATTCAGAGGAACAGGGATCTGG - Intergenic
1102403303 12:112649985-112650007 CATTCTGAGGTCCTAGGGTTGGG + Intronic
1102597358 12:114002979-114003001 CATTCTGAGGTACTAGGGTTAGG + Intergenic
1102663123 12:114546934-114546956 CACTCTGAGGTACTGGGGTTTGG - Intergenic
1102664924 12:114563694-114563716 CACTCTGAGGTGCTGGAGTTTGG + Intergenic
1102809213 12:115809470-115809492 CATTCTGAGGTCTAGGGGCTAGG + Intergenic
1102921827 12:116797223-116797245 AATTCTGAGGTCCTGGGGTTTGG - Intronic
1103998925 12:124847809-124847831 GTTTCTGATGAGCCGGGGTTGGG - Intronic
1105930058 13:25044024-25044046 GATTCTGAGGCCCTGGGGTTAGG - Intergenic
1106084297 13:26526444-26526466 CATTCTGAGGTACTGGGGTTTGG - Intergenic
1106437856 13:29739757-29739779 CATTCTGAGGTCCTGGGGGTAGG - Intergenic
1106759889 13:32858105-32858127 CAATTTGAGCAGCAGGGTTTGGG + Intergenic
1106900164 13:34347381-34347403 CTCTCTGAGGAGCAGGGGATGGG + Intergenic
1109059928 13:57602641-57602663 CATTTTGAAGAGCAGGGTCTGGG - Intergenic
1110109253 13:71722911-71722933 AATGCTTAGGAGCAGGGGCTAGG + Intronic
1110482424 13:75995093-75995115 CAATCTGTGGCCCAGGGGTTGGG + Intergenic
1111208104 13:85039218-85039240 ACTTCGAAGGAGCAGGGGTTGGG + Intergenic
1111905339 13:94249240-94249262 TATGCTGAGGAGCAGGGTATGGG - Intronic
1112473279 13:99708733-99708755 CATTCTGAGTACCTGTGGTTAGG - Intronic
1112539524 13:100294293-100294315 CATTCTGAGGTGGTGGGGCTAGG + Intronic
1113164480 13:107423272-107423294 CAGTCTGAGGAGCAGAGGTCAGG + Intronic
1113228064 13:108180600-108180622 CATTCTGAGGTGCGGGGGCTGGG - Intergenic
1113977953 13:114245468-114245490 CACTCTGAGCAGCAGGGATTCGG - Intronic
1113978338 13:114249445-114249467 CAGTCTGTGGCCCAGGGGTTGGG + Intronic
1116569715 14:46499862-46499884 CATGCTGAGGGGGAGGGGTGGGG + Intergenic
1117815410 14:59592873-59592895 ATTTCTGAGGTACAGGGGTTTGG - Intergenic
1117951142 14:61083435-61083457 CATTCTGAGGTCCTGGGGATTGG - Intronic
1119182362 14:72613746-72613768 AACTCTGAGGAGGAGGGGTCCGG - Intergenic
1119340809 14:73875940-73875962 CCTTCTGAGTAGCTGGGTTTTGG + Intronic
1119426538 14:74539023-74539045 CATTATGAGGAGCAGAAGGTGGG + Intronic
1119900821 14:78258292-78258314 CATTGTGAGGAGCAGGTTTGGGG + Intronic
1120092113 14:80343994-80344016 CATTCTGAGGTACTGGCGTTAGG + Intronic
1120148626 14:81006826-81006848 CTTTCTGAGGTACTGGGGTTAGG + Intronic
1121273480 14:92652552-92652574 CAGCCTGAGAAGCAGGGCTTTGG - Exonic
1121293470 14:92796594-92796616 CATTCTGAGGTCTGGGGGTTAGG + Intronic
1121883721 14:97523689-97523711 CATTCTGAAGTACTGGGGTTAGG + Intergenic
1122143085 14:99674007-99674029 CAGCCTGAGGAGCAGGAGGTGGG + Intronic
1122432970 14:101667612-101667634 CATTCTGAGGCACTGGGGGTTGG + Intergenic
1122869403 14:104629257-104629279 CATTCTGAGGTACTGGGGATTGG + Intergenic
1122900009 14:104778527-104778549 CAGGCTGAGGGGCTGGGGTTGGG - Intronic
1122909541 14:104820546-104820568 CATTTTGAGGGATAGGGGTTAGG + Intergenic
1123147471 14:106146889-106146911 CTGTCTCAGGAGCAGGGGTGAGG + Intergenic
1123482361 15:20644081-20644103 CACACTGAGGAGCAGGTGCTGGG - Intergenic
1123663360 15:22586195-22586217 CCTACTCAGCAGCAGGGGTTGGG - Intergenic
1124317190 15:28680627-28680649 CCTGCTCAGCAGCAGGGGTTGGG - Intergenic
1124566260 15:30816847-30816869 CCTACTCAGCAGCAGGGGTTGGG + Intergenic
1124808219 15:32907527-32907549 CAGTCTGTGGCCCAGGGGTTGGG + Intronic
1124871840 15:33551462-33551484 CCTTCTTTGGTGCAGGGGTTCGG + Intronic
1125108151 15:35998085-35998107 CAGTCCGAGGCGCAGGAGTTGGG + Intergenic
1127344754 15:58083259-58083281 CATTCTGAGATAGAGGGGTTAGG + Intronic
1127401437 15:58590263-58590285 CATGCTGAGGAGGAGGTTTTTGG - Exonic
1127903684 15:63360193-63360215 CATTCTGTGGAACTGGGGCTGGG - Intronic
1128234317 15:66057168-66057190 AATTCTCAGGAGCAGGGAGTTGG - Intronic
1128662724 15:69513959-69513981 CAGTCTGTGGCCCAGGGGTTGGG - Intergenic
1128906925 15:71475597-71475619 CACTCTAAGTAGCAGGTGTTAGG + Intronic
1129955762 15:79635424-79635446 GATTTGGAGGAGCAGAGGTTAGG - Intergenic
1133190134 16:4127648-4127670 TATTCTGAGGTACCGGGGTTGGG - Intergenic
1133204003 16:4222022-4222044 CATTCTGAGGTTCTGGGGTTAGG + Intronic
1133235508 16:4385690-4385712 CAGTGAGAGGAGCAGGGGCTGGG - Intronic
1134754767 16:16657187-16657209 CATTCTGAGGAGGACTGGTCAGG + Intergenic
1134991293 16:18701855-18701877 CATTCTGAGGAGGACTGGTCAGG - Intergenic
1135169274 16:20168993-20169015 CATTCTGAGGAACGGGGGTTAGG - Intergenic
1135298540 16:21303780-21303802 GATGCTGAGGAGCCGGGCTTCGG + Intergenic
1135498746 16:22975520-22975542 CATTTTGAGCAGCAAGGGTCTGG - Intergenic
1135923186 16:26669467-26669489 CATTCTGAGGTACTGGAGTTAGG + Intergenic
1136248926 16:28990965-28990987 CATCCTGAGGAGCAAGGGCGTGG + Intergenic
1137774646 16:51044903-51044925 CATTCTGAGGTTCTGGGGTTAGG - Intergenic
1138334573 16:56242840-56242862 CAGTCTGTGGCCCAGGGGTTGGG - Intronic
1138627870 16:58266758-58266780 CAATCTAAGAAGCAGGGGTGGGG + Intronic
1139347373 16:66312788-66312810 CAATCTGTGAAGGAGGGGTTCGG - Intergenic
1139531087 16:67543060-67543082 AATGCTGGGGTGCAGGGGTTGGG - Exonic
1140202796 16:72907976-72907998 AATTTGGAGGAGCAGGGGCTGGG - Intronic
1140520893 16:75580677-75580699 CTTTTTGAGGAGTAGGGTTTGGG - Intergenic
1140706305 16:77633443-77633465 CATTTTGAGGTACTGGGGTTAGG + Intergenic
1140764222 16:78140776-78140798 CATTCTGAGGTACTGGGCTTAGG + Intronic
1140884630 16:79232177-79232199 CAATCTGTGGCCCAGGGGTTGGG + Intergenic
1141183621 16:81771719-81771741 CATTCACAGGTGCAGGGTTTAGG - Intronic
1141673963 16:85507766-85507788 CATTCTGAGGCCCGGGGGCTGGG + Intergenic
1141826592 16:86485032-86485054 CATTCACAGGCTCAGGGGTTAGG - Intergenic
1142126022 16:88411128-88411150 CATTCGTAGGTGCTGGGGTTAGG + Intergenic
1142997450 17:3769248-3769270 CTTCCTGAGGAGCTGGGGTTTGG - Intronic
1143327255 17:6107546-6107568 CATTCTAAGGCCCTGGGGTTAGG + Intronic
1144368647 17:14569300-14569322 CATTCTGAGGCACTAGGGTTAGG + Intergenic
1144631018 17:16872536-16872558 CCTGCTGAGGAGCAAGGGGTTGG - Intergenic
1145079432 17:19882575-19882597 ACTTCAGAGGAGGAGGGGTTAGG - Intergenic
1145275840 17:21429737-21429759 CATTCTGAGGCACCAGGGTTAGG - Intergenic
1145288763 17:21526445-21526467 CATTCTGAGGTACTGGGGTAAGG - Intronic
1145312110 17:21706501-21706523 CAGAATGTGGAGCAGGGGTTTGG + Intergenic
1145313685 17:21715646-21715668 CATTCTGAGGCACCAGGGTTAGG - Intergenic
1145712123 17:26987623-26987645 CATTCTGAGGCACCAGGGTTAGG - Intergenic
1145714874 17:27009989-27010011 CATTCCTAGGACCAGGTGTTTGG - Intergenic
1146708506 17:35020262-35020284 CAGTCTGTGGCCCAGGGGTTGGG - Intronic
1147934240 17:44002301-44002323 CTTTTTGGGGAGCAGGGCTTGGG - Intronic
1148565088 17:48627806-48627828 GAAGCTGAGGAGCAGGGGCTGGG - Intronic
1149594107 17:57853661-57853683 CATTCTGAGGTACTGGAGTTAGG + Intergenic
1149953531 17:61019080-61019102 CAGTCTGTGGCCCAGGGGTTGGG - Intronic
1150158496 17:62874037-62874059 CATTCTAATAAGCTGGGGTTTGG + Intergenic
1150318768 17:64192217-64192239 CATTCTGAGATACTGGGGTTAGG - Intronic
1150434835 17:65145736-65145758 CAGTCTGAGGTACTGGGGTTAGG + Intronic
1150650769 17:67008627-67008649 CATTCTGAAGTACTGGGGTTAGG - Intronic
1151216354 17:72579382-72579404 GATTCTGAGGGGCAGGGGGAAGG - Intergenic
1151359403 17:73579564-73579586 CATGCTGAGGTGCAGGGGTTAGG - Intronic
1151383619 17:73742074-73742096 CTTTCTGAGGTGCTGGGGTTGGG - Intergenic
1151871119 17:76837601-76837623 CATTCTGAAGTACAGGGGTTAGG - Intergenic
1151871949 17:76842396-76842418 CATTCTGAGCTACAGGGTTTGGG - Intergenic
1152154904 17:78626625-78626647 CATTCACAGGGGCTGGGGTTAGG - Intergenic
1152270944 17:79324606-79324628 CTTTCTGAGGAGCAGAGCTGGGG - Intronic
1152494319 17:80660505-80660527 CACTCTGAGGAGCAGAGTTGGGG + Intronic
1152822746 17:82445552-82445574 GGGTCTGAGGAGCAGGGGTCTGG - Intronic
1152822754 17:82445583-82445605 GGGTCTGAGGAGCAGGGGTCTGG - Intronic
1153035762 18:760793-760815 CATTGAGAGGGGCAGGGGTGGGG + Intronic
1153448012 18:5195937-5195959 CATTCTGAGGGGGAGGGGGAGGG + Intronic
1153643628 18:7175680-7175702 TATTCTGAGGCACTGGGGTTTGG + Intergenic
1153885501 18:9461079-9461101 CATTCTGAGGTACTGGGGTTAGG - Intergenic
1155346558 18:24862902-24862924 CATTCAGATGAAAAGGGGTTAGG + Intergenic
1155844325 18:30686541-30686563 CCAACTGAGGAGCAGGGGTAAGG - Intergenic
1155938978 18:31784619-31784641 CATTCTGAGGTACTGGGGTCTGG - Intergenic
1157540152 18:48495870-48495892 CAGTCTGTGGCCCAGGGGTTGGG - Intergenic
1158334633 18:56402624-56402646 CATTTTGATGTGCTGGGGTTGGG - Intergenic
1158661262 18:59390341-59390363 CATTCTGAGGCACTGAGGTTAGG - Intergenic
1159093159 18:63871827-63871849 GAGGCTGAGGAGTAGGGGTTTGG + Intronic
1159096027 18:63903023-63903045 CATTCTGAGAAGCATGGGCATGG + Exonic
1159285378 18:66342846-66342868 CAGTCTGTGGCCCAGGGGTTGGG + Intergenic
1159913387 18:74167095-74167117 CATTCAGAGGTGCTGGGGTTGGG - Intergenic
1159923908 18:74250016-74250038 CACACTGAGGTGCTGGGGTTAGG - Intergenic
1160297503 18:77651252-77651274 CATGGTGACGAGCATGGGTTTGG + Intergenic
1160375541 18:78409277-78409299 CATTCTGAGGAAGAGGAGTTAGG - Intergenic
1160892519 19:1386838-1386860 CATTCTGAGGTCCTGGGGTTAGG + Intronic
1161043276 19:2121375-2121397 CTGTCTCAGGAGCAGGTGTTGGG - Intronic
1161735595 19:5990521-5990543 CATTTTGAGGAGCAGGGCCAAGG + Intergenic
1162172576 19:8803058-8803080 CATTCTGAGGTACTGGGGTTAGG - Intergenic
1163068231 19:14815475-14815497 ATTTCTAAGGAGGAGGGGTTGGG - Intronic
1163288809 19:16365284-16365306 TATTCTAAGGCACAGGGGTTAGG - Intronic
1163360045 19:16840186-16840208 CGTTCTGAGGCGCTGGGGCTAGG - Intronic
1163391148 19:17030755-17030777 CAGTCTGTGGCCCAGGGGTTGGG + Intergenic
1163450399 19:17373622-17373644 CATTGTGGGGAGCAGGTGTGGGG - Intronic
1164401102 19:27902986-27903008 CATCCAGAGAAGCAGGGGTGTGG - Intergenic
1166315715 19:41988374-41988396 CTGTCTGAGGAACAGGAGTTTGG + Exonic
1166552974 19:43679052-43679074 CATTCTGAGTACTGGGGGTTAGG - Intergenic
1166604337 19:44127120-44127142 CAGCCAGAGGAGCAGGGGGTGGG - Intronic
1167499514 19:49837234-49837256 GACTCTGAGGAGCTGGGGCTGGG - Intronic
1167579352 19:50332744-50332766 GATTGGGAGGAGCAGGGGTGGGG - Intronic
1167743057 19:51336145-51336167 CATTCACAGGAACAGGGGTTAGG - Intronic
1167765246 19:51478477-51478499 CACTCTGACCAGCAGGGGTGGGG - Intergenic
925081344 2:1070130-1070152 CAGTCTGAGGGGCGGGGGATGGG + Intronic
925133674 2:1511801-1511823 CATTCTGAGGCCCAGGGTGTTGG + Intronic
925898905 2:8494622-8494644 CATTCTGAGGCCCTGGGGGTTGG + Intergenic
926052815 2:9755621-9755643 CATCCTGAGGTACAGGGGTTAGG - Intergenic
926110960 2:10183547-10183569 CATTCAGAGAAGCAGGGTTCTGG + Intronic
926236139 2:11045477-11045499 CGTTCTGTGGCTCAGGGGTTGGG + Intergenic
926746317 2:16161288-16161310 TATTCTGAGGTCCTGGGGTTTGG - Intergenic
926774195 2:16405925-16405947 CATTCTGAGGCTCTGGAGTTAGG + Intergenic
927465591 2:23334055-23334077 CCTAGTGAGGTGCAGGGGTTGGG + Intergenic
927585141 2:24296412-24296434 CATTCTGAGGTACTGGGGCTTGG - Intronic
928265558 2:29808622-29808644 CATTCAGAGCAGCAGGGATTTGG - Intronic
928927638 2:36595595-36595617 CGGTCTGTGGACCAGGGGTTGGG + Intronic
929476152 2:42251153-42251175 CAGTCTGTGGCCCAGGGGTTGGG + Intronic
929545453 2:42852579-42852601 CATTCTGATGTGCTGGGATTAGG + Intergenic
930634416 2:53788445-53788467 CATTCTGAAGTGCAGTGGTACGG + Intronic
931412217 2:62043556-62043578 CAAACTGAGGATCAGGTGTTAGG + Intronic
931891229 2:66674788-66674810 CCTTCTGTGGAGCAGGCATTGGG + Intergenic
932571234 2:72939526-72939548 CATTCTGAGGCACAGGGCATTGG + Intergenic
933100097 2:78244565-78244587 CATTTTGAGGTACTGGGGTTAGG - Intergenic
933312002 2:80672425-80672447 CACTTTGAGTAACAGGGGTTTGG - Intergenic
933372382 2:81431782-81431804 CTTTGTGGGGAGCAGGGGTGGGG + Intergenic
933644841 2:84802595-84802617 TAATCAGAGGAGCAGGGGGTGGG + Intronic
933648525 2:84831061-84831083 CATTCTGAGGTACTGGGGATGGG - Intronic
934575107 2:95395278-95395300 CATTCTGAGGTACTGGGGTTAGG - Intergenic
935002365 2:99031625-99031647 CAGTCTGTGGCCCAGGGGTTAGG - Intronic
935092580 2:99909945-99909967 CATTGTGAGGAACTGGGGTTAGG - Intronic
935127360 2:100236133-100236155 CATTCTGAGGTACAGGAGTTAGG - Intergenic
935602239 2:104934415-104934437 CCTTCGGTGGAGCAGGGGCTTGG - Intergenic
935617614 2:105102435-105102457 CACTCTGAGGAGGAGGTGGTGGG + Intergenic
935708678 2:105878303-105878325 CATTCTGAGGTCCTGGGGATTGG - Intronic
935828596 2:106976269-106976291 CTTTCTGAGGTCCTGGGGTTAGG - Intergenic
936853825 2:116933724-116933746 CATTCTGAGGCATTGGGGTTAGG - Intergenic
936937654 2:117853627-117853649 CATTCTGAGGAGGTGATGTTTGG + Intergenic
937052277 2:118902192-118902214 CATTCTGAGGTCCTGGGGTTAGG - Intergenic
937231077 2:120398620-120398642 CAAGCAGGGGAGCAGGGGTTGGG - Intergenic
937271826 2:120657776-120657798 CCTTCTGAGGCAGAGGGGTTTGG + Intergenic
937363418 2:121244453-121244475 CATTCTGAGGAGCCAGTTTTGGG + Intronic
937899090 2:127003452-127003474 CACTCTGAGGTACTGGGGTTAGG - Intergenic
938308014 2:130267809-130267831 GATGCTGTGGAGCAAGGGTTGGG - Intergenic
938652371 2:133396735-133396757 TATTCTGAGGTTTAGGGGTTAGG + Intronic
939245986 2:139624253-139624275 CATTCTTAGGAATGGGGGTTTGG + Intergenic
939815702 2:146894382-146894404 CATGCTGAGGAGTTGGGGTGGGG - Intergenic
939981984 2:148793544-148793566 CAATCTGAGGAGCTTGGATTTGG - Intergenic
940179375 2:150914787-150914809 CATTCTGAGGTTCTGAGGTTAGG + Intergenic
941403802 2:165063652-165063674 CAGTCTGTGGCCCAGGGGTTGGG + Intergenic
941621983 2:167788697-167788719 CAGTCTGTGGCCCAGGGGTTGGG + Intergenic
941794316 2:169583368-169583390 CAGTCTGTGGCCCAGGGGTTGGG + Intergenic
942076329 2:172359904-172359926 CATTCTAGGGAGCAGGGGTTAGG + Intergenic
942752569 2:179304369-179304391 CATTCTGAGGTACTGGGGTTAGG - Intergenic
942924994 2:181420900-181420922 CTTTCTGAGGAACAGAGGGTTGG - Intergenic
943640669 2:190354405-190354427 CATTCTGAGGTACTGGGGGTTGG - Intronic
943919912 2:193692817-193692839 CATTCAGAGGTTCTGGGGTTAGG + Intergenic
944113774 2:196165095-196165117 CATTATGAGATACAGGGGTTAGG - Intronic
945175319 2:207037927-207037949 CATTCTGAGGTACTGGGGTTAGG - Intergenic
945213350 2:207407165-207407187 CATTCTGAGGTACAGGGGTTAGG + Intergenic
946013127 2:216582616-216582638 CATTCTGAGGCACTGGGGGTTGG + Intergenic
946013474 2:216585097-216585119 CATTCTAAGGTACTGGGGTTAGG - Intergenic
947659970 2:231859267-231859289 CATTCTGAGGTAGAGGGGTTGGG + Intergenic
947796296 2:232896142-232896164 CATTCACAGGTGCTGGGGTTAGG - Intronic
948024787 2:234768383-234768405 CATTCTGAGGAACCAGGGTTTGG + Intergenic
948152705 2:235756876-235756898 TTTTCTGAGGATCAGGGGTTGGG - Intronic
948670012 2:239562182-239562204 CGTTCTGAGGTGCCAGGGTTAGG + Intergenic
948803354 2:240442665-240442687 CATCCTGAGGAATCGGGGTTAGG + Intronic
948859132 2:240744455-240744477 CATTCTGAAGTCCTGGGGTTGGG - Intronic
949007153 2:241656196-241656218 CATGCTGAGGAGCAGGCTGTGGG - Intronic
1169257077 20:4107706-4107728 CATTCTGAGGGACTGGGGTCAGG + Intergenic
1169348372 20:4848157-4848179 CAGTCTGCGGCCCAGGGGTTGGG - Intergenic
1169349093 20:4853933-4853955 TATTCTGTGAAGCAGGGGTGGGG + Exonic
1169512046 20:6275003-6275025 TATTCTGAGGTACTGGGGTTAGG + Intergenic
1169550373 20:6695962-6695984 CAGTCTGTGGCCCAGGGGTTGGG + Intergenic
1169908083 20:10623786-10623808 CAGGCTGAGGAGCAGGGGGATGG - Exonic
1170512837 20:17096689-17096711 GATTCTGTGGGTCAGGGGTTTGG - Intergenic
1170533974 20:17322410-17322432 CATTCTGAGGAAGGGGGGTTGGG - Intronic
1170753158 20:19170696-19170718 CATTCTGAGGTACTGGGGATAGG - Intergenic
1172176767 20:32977218-32977240 CTTCCTGGGGAGCAGAGGTTAGG + Intergenic
1173247169 20:41344816-41344838 TGGTCTGAGGAGCTGGGGTTAGG + Intronic
1173687195 20:44931945-44931967 TGTTCTGAGGAGCATGGTTTGGG + Intronic
1174008357 20:47428441-47428463 CATGCTTTGTAGCAGGGGTTGGG + Intergenic
1174678990 20:52386304-52386326 CAGTCTGTGGCCCAGGGGTTGGG - Intergenic
1174785857 20:53431713-53431735 CATTTTGTGGAGCTGGGGATGGG + Intronic
1174882161 20:54291820-54291842 CATTCTGAACAGCAAGGCTTTGG - Intergenic
1174894962 20:54438587-54438609 CATTCTGATGTGCTGGGGGTAGG + Intergenic
1175289807 20:57868173-57868195 GATTCTGGGGAGCAGGAGTGAGG - Intergenic
1175321615 20:58092231-58092253 CATTCACAGCTGCAGGGGTTAGG - Intergenic
1177116233 21:17090385-17090407 CATTCTGAGGTACTGGGGGTTGG + Intergenic
1178419531 21:32432515-32432537 CATTCTGTCTAGAAGGGGTTTGG + Intronic
1178521476 21:33291237-33291259 CATTCTGAGGTAGAGGGATTAGG + Intronic
1178741472 21:35206034-35206056 CATTCTGAGGATGAGGGGTGGGG + Intronic
1178999545 21:37443928-37443950 CATTCTGAGGTACTGGGGTTAGG + Intronic
1179419437 21:41223692-41223714 CATTCACAGGTGCAGGGGTTAGG + Intronic
1179461521 21:41538576-41538598 CATTCTGAGGTACGGGGGTTAGG - Intergenic
1180055230 21:45355280-45355302 CCTTCTGAGATGCTGGGGTTAGG - Intergenic
1180094985 21:45552292-45552314 CAGCCTGAGCAGCAGGGGTCAGG + Intergenic
1180904305 22:19397923-19397945 CAGTTTCTGGAGCAGGGGTTGGG - Intronic
1181050156 22:20234547-20234569 CAGTCTGAGGTGGAGGGGTGGGG + Intergenic
1181305833 22:21916774-21916796 GCTTCAGAGGAGCAGGGGTGTGG + Intergenic
1181532688 22:23525918-23525940 CATTCTGAGGGACTGGGCTTAGG + Intergenic
1181540721 22:23571773-23571795 CATACTGACGAACTGGGGTTAGG - Intergenic
1181740441 22:24917301-24917323 CATTCTCAGGAGCAGTGTATGGG + Intronic
1181889394 22:26048454-26048476 AATTCTGAGGAACGGGGGTGGGG + Intergenic
1182756429 22:32683328-32683350 AGTTCTAAGGAGGAGGGGTTTGG - Intronic
1182987307 22:34732411-34732433 TATTTTGATGGGCAGGGGTTGGG - Intergenic
1184189088 22:42882994-42883016 CATTCCGAGGCACTGGGGTTTGG - Intronic
1184543806 22:45151277-45151299 CATTCTGAGGTACAGGGATTAGG + Intergenic
1184742601 22:46437790-46437812 CATTCTAAAGAGAGGGGGTTTGG - Intronic
1184803546 22:46777002-46777024 TCTTCTCAGGAGCAGGGGATGGG + Intronic
1184941839 22:47773755-47773777 CATTCTGAGGTACTGGGGTTAGG - Intergenic
1185051637 22:48557165-48557187 TGTTCTGAGGAGCTGGGGTTAGG - Intronic
1185380174 22:50504334-50504356 CAGCCTGGGGAGCAGGGGTAAGG - Exonic
949103719 3:178410-178432 CATTCTGAGGTTCTGGGGTTAGG - Intergenic
949249109 3:1961318-1961340 GATTCTGTGGATCAGGAGTTTGG - Intergenic
949490877 3:4587580-4587602 CATTTTGAGTAGCTGGGGTCTGG + Intronic
950433677 3:12966443-12966465 CCTTCTGAGGAGCAGGGGGGTGG - Intronic
950641227 3:14349768-14349790 TATTCTGAAGTGCTGGGGTTAGG - Intergenic
951046075 3:18039990-18040012 CTTCCTGAGGGGTAGGGGTTAGG + Intronic
951692456 3:25410854-25410876 CTCTCTGCAGAGCAGGGGTTGGG - Intronic
951756706 3:26098689-26098711 CATGCTGAGGTACTGGGGTTAGG + Intergenic
952225016 3:31366304-31366326 AATTCACAGGAGCAGTGGTTGGG - Intergenic
952611278 3:35213550-35213572 CATTCTAAGGAACATGAGTTAGG - Intergenic
952660992 3:35846484-35846506 CATTTTGAGGAACTGGGGCTTGG + Intergenic
952746604 3:36787699-36787721 CATTCTGAGGAGCCTGTGGTGGG - Intergenic
953236671 3:41113195-41113217 CATTCTGAGGTACTGGGGTTAGG - Intergenic
953333431 3:42073496-42073518 CATTTTGTGAGGCAGGGGTTGGG - Intronic
954898867 3:54001535-54001557 GATTCTGAGGACCAGTGGGTTGG + Intergenic
954965855 3:54610218-54610240 CATTCTAAGGTACTGGGGTTTGG + Intronic
955074299 3:55598854-55598876 CCTTCTGAGGAAGAAGGGTTAGG - Intronic
956229441 3:66997977-66997999 CATTCTGAGGGGCTGGGGTAGGG - Intergenic
956427991 3:69156496-69156518 CATTCTGAGATACCGGGGTTAGG - Intergenic
956865335 3:73363588-73363610 CATTCTGAGGCATGGGGGTTAGG + Intergenic
958143297 3:89590490-89590512 CATTCTGGGGTACTGGGGTTAGG + Intergenic
958179266 3:90037095-90037117 CATTCTGAAGCACTGGGGTTAGG - Intergenic
959019941 3:101177848-101177870 CATCCTGAGTACTAGGGGTTAGG + Intergenic
959033671 3:101334159-101334181 CAGTCTGAAGCCCAGGGGTTGGG + Intronic
959620526 3:108394531-108394553 ACATCTGAGGAGCAGAGGTTGGG + Intronic
961341651 3:126227147-126227169 CATTCTGAGGTACTGGGGTTAGG - Intergenic
962181877 3:133214677-133214699 CAGTCTGTGGCCCAGGGGTTGGG - Intronic
963045526 3:141100238-141100260 CTTTCTGAGGTGCTGGGGTTAGG - Intronic
963154532 3:142081958-142081980 CAGTCTGTGGCCCAGGGGTTTGG - Intronic
963167521 3:142220616-142220638 CATTCTGAGGAGAAGGGTAGAGG - Intronic
963370618 3:144395108-144395130 CATTCTGAGGTACTGGGGGTTGG + Intergenic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
967223802 3:187272442-187272464 CATGCAGAGAAACAGGGGTTAGG - Intronic
968193935 3:196691441-196691463 CATCCTGGGGAGCTAGGGTTGGG - Intronic
968507331 4:976913-976935 CATTCTGAGGTGCTGGGGGTTGG - Intronic
968607940 4:1544396-1544418 CATTCTGAGGTGCTGGGGGCTGG - Intergenic
968788317 4:2641160-2641182 CCTTCTGAGTAGCTGGGATTGGG + Intronic
968960100 4:3739119-3739141 CACTCTGAGGTCCTGGGGTTGGG - Intergenic
969267852 4:6077131-6077153 CATTCTGAGGTACTGGGATTAGG - Intronic
969484022 4:7461776-7461798 TATTTTGGGCAGCAGGGGTTGGG - Intronic
969978830 4:11133053-11133075 CATTCTGAGGGACTGGGGTAGGG + Intergenic
970114803 4:12682985-12683007 CATTCTGAGGTTCTGGGGTTTGG - Intergenic
970234889 4:13948683-13948705 CATCCTGAGGAGCAGGACATGGG - Intergenic
970323760 4:14901630-14901652 CTGTCTGTGGGGCAGGGGTTGGG + Intergenic
970328800 4:14957325-14957347 CATTCTGAAGTGCTGGAGTTAGG - Intergenic
970417211 4:15871199-15871221 CATTCTGAGGTACTGGGGTTAGG - Intergenic
970857727 4:20668029-20668051 CATTCTGAGGAACTTGGGATTGG - Intergenic
971708478 4:30079517-30079539 AATTGTGAGAAGCAGGGTTTGGG + Intergenic
972716501 4:41651416-41651438 CTTTCTGAGTAGTAAGGGTTAGG + Intronic
974321034 4:60350175-60350197 CAGTCTGAGCAGCAGTTGTTGGG + Intergenic
975152128 4:71033816-71033838 CATTCTGAGGCCCAGGGGCCAGG - Intergenic
976221966 4:82763160-82763182 CATTCTGAGGTACTGAGGTTAGG - Intronic
978236169 4:106463581-106463603 CATTCTGAGGAGCAGAGGATGGG - Intergenic
978712213 4:111797837-111797859 TCTTCAGAGGAGGAGGGGTTGGG - Intergenic
979107362 4:116705362-116705384 GTTTCTGAGGAGCAGGGGGAGGG - Intergenic
980447473 4:132929272-132929294 CATTCTGAGGAACTGAGGGTAGG + Intergenic
981670388 4:147279697-147279719 AACTCTGAGGAGAAGGGGTTGGG - Intergenic
981800922 4:148654712-148654734 CCATCTGATGAGCAGGAGTTCGG + Intergenic
982104242 4:151997828-151997850 CAGTCTGTGGCCCAGGGGTTGGG - Intergenic
982260379 4:153489055-153489077 CATTCTGAGGTACTGGGGTTAGG + Intronic
982385768 4:154800273-154800295 CTTTTTGAGGGGCAGGGGATAGG + Intronic
982458665 4:155640450-155640472 CTCTCTGAGGAGGAGTGGTTAGG + Intergenic
982747307 4:159118065-159118087 CAGTCTGTGGCCCAGGGGTTGGG - Intronic
982767849 4:159368622-159368644 CAGTCTGTGGCCCAGGGGTTGGG - Intergenic
983079893 4:163372239-163372261 TCTTCAGAGGAGGAGGGGTTGGG - Intergenic
983796525 4:171870611-171870633 CATTCTGAGGCACCAGGGTTAGG - Intronic
983953246 4:173667143-173667165 CATTCTGAGATACAGGGGGTAGG - Intergenic
984754571 4:183313468-183313490 AATGCTGGGGAGCAGGGGTGTGG + Intronic
985785668 5:1892662-1892684 CATTCTGATGAAATGGGGTTAGG + Intergenic
986074208 5:4318012-4318034 CATTCTGAGGTACTGGGGTCAGG - Intergenic
986783881 5:11092553-11092575 CACTCTGTGGAGCAGGAGATGGG - Intronic
986875736 5:12106329-12106351 CGTTCTGAGGACTGGGGGTTAGG + Intergenic
987877441 5:23696894-23696916 CATTCGGAGGTGCTTGGGTTTGG - Intergenic
988189557 5:27910818-27910840 CATTCTGAGGTACTGGTGTTAGG + Intergenic
988485872 5:31667747-31667769 CCTTCTGGTGAGCAGGGGTCAGG - Intronic
990144701 5:52745795-52745817 CATTCTGAGGTACTGGGGTTAGG + Intergenic
990491258 5:56305098-56305120 CATTCTGAGGCCCTGGGGGTGGG + Intergenic
990495002 5:56338426-56338448 CATTCTGAGGTACCGGGGTTAGG + Intergenic
990965817 5:61446571-61446593 TATTTTGAGGTGCTGGGGTTTGG - Intronic
991346392 5:65673350-65673372 CAGTCTGTGGCCCAGGGGTTGGG - Intronic
991607870 5:68421513-68421535 CATTCTGAGGTACAGGGGGTTGG - Intergenic
992111374 5:73497883-73497905 CATTCTGAGGAGTGGGGCTCGGG + Intergenic
992347020 5:75889653-75889675 CATTCTGAGGCACTGGGGTCAGG + Intergenic
992716978 5:79520647-79520669 CAGTCTGTGGCCCAGGGGTTGGG + Intergenic
993332182 5:86614721-86614743 CATTACCAGGGGCAGGGGTTGGG - Intergenic
993467560 5:88267944-88267966 TATTCTGAGGAGGAGCTGTTAGG - Intronic
995212916 5:109560909-109560931 CATTCTGAGGTACTGGGATTAGG + Intergenic
996004600 5:118405321-118405343 GAACCTGGGGAGCAGGGGTTGGG - Intergenic
996371481 5:122757796-122757818 CATTGTGAGGAACTGGGGTTAGG - Intergenic
996861646 5:128073644-128073666 CATTCTGTGGCCCAGGGGTTGGG + Intergenic
997437455 5:133885530-133885552 CATTGTGAGGAGGAGGAGCTGGG + Intergenic
997988765 5:138526538-138526560 CATCCTGGGGGGCAGGGGGTAGG - Intronic
998072320 5:139207734-139207756 GTTCCTGAGGAGCAGGTGTTAGG - Intronic
999115275 5:149157514-149157536 CATTCTCAGGGGCGGGGGGTGGG - Intronic
999508037 5:152218697-152218719 CATTCTGAGGTACCGGGGTTAGG + Intergenic
999707964 5:154291325-154291347 CACTTTGAGTAGCAAGGGTTAGG - Intronic
1001759717 5:174197343-174197365 CATTCTGAGGTGTGGGGGTTAGG - Intronic
1001955791 5:175847335-175847357 CAATCTGAGAAGCAGGGGCTGGG + Intronic
1002780301 6:359877-359899 CCTTCTGAGGAGCCAGGGTTGGG + Intergenic
1003136109 6:3435738-3435760 CATTTTGAGGTTCTGGGGTTTGG - Intronic
1003466007 6:6380732-6380754 CATTCTGAGGTACTGGGGGTTGG - Intergenic
1003499171 6:6690160-6690182 CATTCTGAGGTTTGGGGGTTTGG + Intergenic
1003521601 6:6862981-6863003 CATTCTGAGGTGCTTGGGTTAGG + Intergenic
1003998767 6:11572220-11572242 CATTCACAGGAGCAGTGTTTGGG + Intronic
1004163700 6:13236743-13236765 CATTCTGAGGTACTGGGATTAGG + Intronic
1004235692 6:13872970-13872992 CATTCTGAGATACAGGGGTTGGG - Intergenic
1004255724 6:14062190-14062212 CATTCTGAGGTTTTGGGGTTAGG - Intergenic
1004299835 6:14447188-14447210 CATTTTGAGGCACTGGGGTTAGG + Intergenic
1004893807 6:20127390-20127412 CAGTCTGAGCCCCAGGGGTTGGG - Intronic
1006031293 6:31178469-31178491 CATTCTGAGAAGCAGGAGGCAGG + Intronic
1006507568 6:34499388-34499410 CAATCTGTGGCCCAGGGGTTGGG + Intronic
1006759771 6:36449790-36449812 CATTCTGAGGACTAGGGGTTAGG + Intronic
1007104915 6:39276994-39277016 CACTCTGGGGAGGAAGGGTTTGG + Intergenic
1007694838 6:43725480-43725502 GATACTGTGGAGGAGGGGTTGGG + Intergenic
1008323754 6:50150835-50150857 AATTGTGTGGTGCAGGGGTTTGG + Intergenic
1008331341 6:50248081-50248103 CATTCTGAGGTATTGGGGTTAGG - Intergenic
1010121566 6:72381341-72381363 CATTCTGAGGTACAGTGGTTAGG + Intronic
1010451111 6:76004341-76004363 CATTCTGAGAATCAGGCTTTAGG - Intronic
1010794216 6:80100719-80100741 AATTCTGAGGGCCAGGGGTTAGG - Intergenic
1011066376 6:83331181-83331203 CATTCTGAGGTACTGGGATTAGG - Intronic
1012617130 6:101291115-101291137 CATTCTGGGTACTAGGGGTTGGG - Intergenic
1013547528 6:111173448-111173470 CAGTCTGTGGCACAGGGGTTGGG - Intronic
1014172015 6:118289011-118289033 GATTTTGAGGAGCTGGGGGTGGG - Intronic
1014303371 6:119711258-119711280 CAAGCTGAGGAGGAGGGGTTTGG - Intergenic
1014839891 6:126206438-126206460 CACTTTGAGTAGCAAGGGTTAGG + Intergenic
1015188281 6:130444170-130444192 TATTCTGAGGGGCAGGGGTTTGG + Intergenic
1015286592 6:131492337-131492359 CATTCTGAGGAACTGGGTTTAGG - Intergenic
1015704560 6:136073671-136073693 CATTCTGAGGTGCTTGGGTTAGG + Intronic
1016758005 6:147708099-147708121 CATTCTGAGGTTCTGGGGTTAGG - Intronic
1016787778 6:148031742-148031764 CATTCTGAGGCACTGGGGGTAGG + Intergenic
1017424639 6:154307510-154307532 CATTCTGATGTACTGGGGTTAGG + Intronic
1017433217 6:154391573-154391595 CATTCTGAGGTACTGGGGTTAGG + Exonic
1018008242 6:159643212-159643234 CTTTCTGAGGAGTCGTGGTTTGG - Intergenic
1018063956 6:160112724-160112746 CATTCTGAAGTACTGGGGTTAGG - Intronic
1018752838 6:166822233-166822255 CATTCTGAGGCGCTGGGAGTCGG - Intronic
1019090713 6:169530490-169530512 CATACTGAGGAGCAGAGGTGGGG - Intronic
1019392858 7:799148-799170 CATTCTGTGGCCCGGGGGTTGGG - Intergenic
1020891569 7:13884810-13884832 CATTCTGAGGTACTGGGGTTAGG - Intergenic
1021699073 7:23299940-23299962 GATTCTGAGGAGCCAGGGTCTGG + Intronic
1022705104 7:32794970-32794992 CATTCTCAGGTACCGGGGTTAGG - Intergenic
1022908933 7:34881545-34881567 CATTCTGAGGTACTGGAGTTAGG + Intergenic
1022998854 7:35786834-35786856 CATTTTGAGGACTAGGGGTTAGG - Intergenic
1023086351 7:36573362-36573384 GATTCTCTGGTGCAGGGGTTAGG - Intronic
1023134137 7:37034145-37034167 CATTCTGAGGTACTGGGGTTAGG - Intronic
1023221580 7:37924415-37924437 CATTCTGAGTGGAAGGGGTCAGG - Intronic
1023277532 7:38535902-38535924 CAGTCTGAGGCCCAGGGTTTGGG + Intronic
1024031086 7:45460307-45460329 CATTCTGAGGTGCCAGGGGTTGG + Intergenic
1024561876 7:50651562-50651584 CATTCTGAGGAACTGGGGCTAGG + Intronic
1024658815 7:51474132-51474154 CATTCTGAGGCGCTGGGGTTAGG + Intergenic
1024758852 7:52569456-52569478 CATCCTCAGGAGCAGGGGCTGGG + Intergenic
1024792497 7:52982930-52982952 CTTTATGAGGAGGAGGAGTTGGG + Intergenic
1025108146 7:56190288-56190310 CAGTCTGTGGACCAAGGGTTGGG + Intergenic
1028809301 7:95066059-95066081 CATTCTGAGGTGCTGGGGTTTGG - Intronic
1028835806 7:95373828-95373850 CAGTCTGTGGCACAGGGGTTGGG - Intronic
1029101084 7:98130526-98130548 CATTCTGAGGCACTGGGGTTAGG - Intronic
1029577142 7:101411180-101411202 CCTTCTGGGATGCAGGGGTTGGG + Intronic
1031339687 7:120583743-120583765 CCTTCTGAGATACAGGGGTTAGG + Intronic
1031872180 7:127099821-127099843 CATTCTGAGGTACTGGGTTTAGG - Intronic
1032945342 7:136845687-136845709 CATTCTGAAGGGCAGGGGTTCGG - Intergenic
1033062170 7:138119667-138119689 CATTCTGAGGTACTGGGGTCTGG - Intergenic
1033285117 7:140034835-140034857 CATCCTGAGGATTTGGGGTTGGG + Intronic
1034593088 7:152160495-152160517 CATTCTGAGAAGCAGGTGTGTGG + Intronic
1034938838 7:155217035-155217057 GATTCTGAGCACCAGGGGCTGGG + Intergenic
1035011276 7:155717481-155717503 CATTCTGAGGTACGGGGGGTTGG + Intronic
1035390703 7:158502523-158502545 CGTCCCGAGGAGCAGGGGTGGGG - Intronic
1035637963 8:1161576-1161598 CATTCTGTGGAGCGGAGTTTGGG - Intergenic
1035745759 8:1961221-1961243 CATTCTGGGGAGCAGTGACTGGG + Intergenic
1036201830 8:6776574-6776596 CCTTCTGAGTATTAGGGGTTAGG - Intergenic
1036766326 8:11551504-11551526 CATTCTCAGGACCGAGGGTTAGG + Intronic
1037027166 8:14053199-14053221 CATTCTGAGGAGCAGTGGGTGGG - Intergenic
1037204844 8:16304387-16304409 CATTCTGAGCAACTGGGGTTGGG - Intronic
1037783385 8:21886576-21886598 TATTCTGAGTATTAGGGGTTAGG - Intergenic
1038202735 8:25430262-25430284 CAGTCTGTGGCCCAGGGGTTGGG - Intronic
1038368279 8:26960552-26960574 CATTCTGAGGTGCTAGGGTTAGG - Intergenic
1039492853 8:37960812-37960834 CAGTCTGCGGCCCAGGGGTTGGG + Intergenic
1039504586 8:38042734-38042756 CATTCCGAGGTACTGGGGTTGGG + Intronic
1039923515 8:41909151-41909173 CATTCTGACGGGTAGGGGTGAGG + Intergenic
1040887282 8:52278564-52278586 CTTCCCAAGGAGCAGGGGTTGGG - Intronic
1041003891 8:53480935-53480957 CATTTTGAGGCACTGGGGTTTGG - Intergenic
1041118830 8:54566150-54566172 CATTCTGAGGAGCTGAGGGTTGG + Intergenic
1041391897 8:57354271-57354293 CATTCTGAGGTACTGGGGGTAGG + Intergenic
1041516151 8:58700782-58700804 CATTCTGAGGCATAGGGGGTTGG - Intergenic
1041662217 8:60411532-60411554 CATTCTGAGGTACTGGGGTTAGG + Intergenic
1041860044 8:62502959-62502981 CAGTCTGTGGCCCAGGGGTTGGG - Intronic
1043106294 8:76115982-76116004 CTTTCTTGGGAGCAGGGGTTTGG - Intergenic
1043365634 8:79530253-79530275 CATTCTGAGGTAAAGGGGTTAGG + Intergenic
1043450294 8:80359728-80359750 CATTCTGAGGTCCTGGGTTTAGG - Intergenic
1044853203 8:96449005-96449027 CATTTTGAGGAGTATGGCTTAGG - Intergenic
1045113270 8:98953478-98953500 CTTCCTGAGGAGTAGGGGTAGGG + Intergenic
1045487225 8:102640838-102640860 CATTCTGAGGTACTGGGGTTAGG - Intergenic
1045554463 8:103202212-103202234 CATTCTGAGGCGCTGGGGAAAGG - Intronic
1046258173 8:111728604-111728626 CATCCTGAGGTACACGGGTTAGG - Intergenic
1046487870 8:114909880-114909902 CTTTGTGAAGGGCAGGGGTTTGG - Intergenic
1046507297 8:115152556-115152578 CATTCTGAGATACAAGGGTTAGG - Intergenic
1046526725 8:115390146-115390168 CAGTCTGTGGCCCAGGGGTTGGG + Intergenic
1046984306 8:120370450-120370472 CATTGTTAGGGGCAGGGGCTTGG - Intronic
1047002239 8:120584687-120584709 CATTCTGAGGTACTGGGGTCAGG - Intronic
1047200266 8:122759419-122759441 CACTGTTAGGAGCAGGGCTTTGG - Intergenic
1047387801 8:124425942-124425964 CTTCCTGGGGAGCTGGGGTTGGG + Intergenic
1047459299 8:125047043-125047065 CAGTCTGCAGCGCAGGGGTTAGG + Intronic
1049736372 8:144208595-144208617 CATTCCGAGGTACAGGGGTTGGG + Intronic
1050074242 9:1847116-1847138 CAGTCTGTGGCCCAGGGGTTGGG + Intergenic
1050366868 9:4880865-4880887 CATTCTGAGGTTCTGGGATTAGG + Intronic
1050974457 9:11919575-11919597 CATTGTGAGGTGCTGGGGTTAGG - Intergenic
1051202409 9:14642486-14642508 TATTCTAAGGTACAGGGGTTAGG - Intronic
1052269469 9:26612912-26612934 CATTCTGAGGAACTGGGGTTAGG - Intergenic
1055949537 9:81718140-81718162 CTTGCTGAAGGGCAGGGGTTTGG - Intergenic
1056215237 9:84400224-84400246 CAATTTGATGAGCAGGGGCTTGG - Intergenic
1056683574 9:88741237-88741259 TATTCTGAGGTACTGGGGTTAGG - Intergenic
1057571785 9:96209522-96209544 CTTTCTGAGGGTCAGGAGTTTGG - Intergenic
1057607612 9:96511612-96511634 CCTTCTGGGGAGAAGGGGATGGG + Intronic
1058420151 9:104825817-104825839 CTTTTTGAGGAGCAGGGCATTGG - Exonic
1058983376 9:110190415-110190437 CATGGTGGGGAGAAGGGGTTGGG - Intronic
1059662061 9:116411531-116411553 CAGCCTGAGGAGAAGGAGTTTGG - Intergenic
1061247781 9:129409908-129409930 CATTCTGAGGGACTGGAGTTAGG - Intergenic
1061418257 9:130459772-130459794 CATTCGGAGGGACTGGGGTTAGG + Intronic
1061847846 9:133397920-133397942 CTTTCTGAGGACCAGGGCCTCGG - Intronic
1062265914 9:135686404-135686426 CTTTCTGAGGAGCAGGAGCTGGG - Intergenic
1062354535 9:136155526-136155548 CAGTTTGAGGAGCAGGAGCTGGG - Intergenic
1062400008 9:136368281-136368303 CAGTCTGGGCAGAAGGGGTTAGG - Intronic
1062689330 9:137833374-137833396 CAGTGTGCGCAGCAGGGGTTGGG + Intronic
1185521996 X:747387-747409 CAATCTGTGGCGCAAGGGTTGGG + Intergenic
1185655047 X:1677802-1677824 CATTCTGAGGCCCTGGGGTTAGG - Intergenic
1186197753 X:7126722-7126744 CATTCTGAGGTCCTGGGGTTAGG + Intronic
1186442457 X:9597976-9597998 CATTCTGAGATGCAAGGGGTTGG - Intronic
1186633851 X:11380689-11380711 CATTTTGAGTAGCACTGGTTAGG + Intronic
1187604253 X:20866151-20866173 CATTCTGAGTAGTGGGGGATGGG + Intergenic
1188329652 X:28853383-28853405 CATTGTGAGGAGCAGGGCCAAGG + Intronic
1188717410 X:33476927-33476949 CATTGTGAAGAGCAGGGGAGTGG - Intergenic
1189136771 X:38558672-38558694 CATTCTGAGGTACTGGGGTTAGG + Intronic
1190750434 X:53357348-53357370 CATTATGAGGAGGAGGGATTCGG + Intergenic
1190801636 X:53794803-53794825 CATTATGAGGAGGAGGGATTCGG + Intergenic
1191110811 X:56802205-56802227 CATTCTCAGGAGAAGGCCTTAGG - Intergenic
1193751373 X:85349450-85349472 CATTCTGAGTTACTGGGGTTAGG - Intronic
1196352915 X:114754160-114754182 CATTCTGAGGTACTGGGGTTAGG + Intronic
1197840161 X:130737783-130737805 CATTCAGAGGAGTAGGGAGTGGG + Intronic
1199990027 X:152982356-152982378 CATTCTGAGGTACTGGAGTTAGG + Intergenic
1200180687 X:154148701-154148723 CATTCTGAGGTATTGGGGTTAGG + Intronic
1200840182 Y:7773917-7773939 CACTTTGAGTAGCAAGGGTTTGG - Intergenic
1201537013 Y:15060717-15060739 CATTCTGAGAAGCAGAGCCTGGG + Intergenic
1201571373 Y:15418787-15418809 CATTCTGAGGTCCTGGGGTTAGG + Intergenic
1201989668 Y:20009851-20009873 TATTCTGAGGAGCAGGGTCCAGG - Intergenic