ID: 1084694220

View in Genome Browser
Species Human (GRCh38)
Location 11:70744248-70744270
Sequence CAGGAAGCTCCTGCCCTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 226}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084694203_1084694220 27 Left 1084694203 11:70744198-70744220 CCATGGCCGAGGCTTTAGCCCAA 0: 1
1: 0
2: 0
3: 6
4: 50
Right 1084694220 11:70744248-70744270 CAGGAAGCTCCTGCCCTTGTGGG 0: 1
1: 0
2: 1
3: 32
4: 226
1084694200_1084694220 30 Left 1084694200 11:70744195-70744217 CCCCCATGGCCGAGGCTTTAGCC 0: 1
1: 0
2: 1
3: 6
4: 332
Right 1084694220 11:70744248-70744270 CAGGAAGCTCCTGCCCTTGTGGG 0: 1
1: 0
2: 1
3: 32
4: 226
1084694202_1084694220 28 Left 1084694202 11:70744197-70744219 CCCATGGCCGAGGCTTTAGCCCA 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1084694220 11:70744248-70744270 CAGGAAGCTCCTGCCCTTGTGGG 0: 1
1: 0
2: 1
3: 32
4: 226
1084694210_1084694220 9 Left 1084694210 11:70744216-70744238 CCCAAGGCACAGGGTGGGTCTCT 0: 1
1: 0
2: 2
3: 18
4: 233
Right 1084694220 11:70744248-70744270 CAGGAAGCTCCTGCCCTTGTGGG 0: 1
1: 0
2: 1
3: 32
4: 226
1084694211_1084694220 8 Left 1084694211 11:70744217-70744239 CCAAGGCACAGGGTGGGTCTCTG 0: 1
1: 0
2: 3
3: 32
4: 345
Right 1084694220 11:70744248-70744270 CAGGAAGCTCCTGCCCTTGTGGG 0: 1
1: 0
2: 1
3: 32
4: 226
1084694205_1084694220 21 Left 1084694205 11:70744204-70744226 CCGAGGCTTTAGCCCAAGGCACA 0: 1
1: 0
2: 1
3: 6
4: 156
Right 1084694220 11:70744248-70744270 CAGGAAGCTCCTGCCCTTGTGGG 0: 1
1: 0
2: 1
3: 32
4: 226
1084694201_1084694220 29 Left 1084694201 11:70744196-70744218 CCCCATGGCCGAGGCTTTAGCCC 0: 1
1: 0
2: 1
3: 2
4: 78
Right 1084694220 11:70744248-70744270 CAGGAAGCTCCTGCCCTTGTGGG 0: 1
1: 0
2: 1
3: 32
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084694220 Original CRISPR CAGGAAGCTCCTGCCCTTGT GGG Intronic
900458440 1:2788700-2788722 CAGGAAGCGCCGCCACTTGTAGG - Intronic
902148730 1:14425272-14425294 CAGGAAGCTCCTGCCATAGCTGG + Intergenic
903047572 1:20575880-20575902 CAGGCAGGCCATGCCCTTGTAGG - Intergenic
905085595 1:35373272-35373294 CACAAAGTTCCTACCCTTGTGGG - Intronic
905414824 1:37796583-37796605 AAGGCAGCTGCTGCCCTTGAAGG - Intronic
905543653 1:38780314-38780336 CAGGCAGATCCTACCCTCGTGGG - Intergenic
906372659 1:45267627-45267649 CAGGAAGCTCCTGCCAAATTAGG + Intronic
907090099 1:51715681-51715703 CAAGAGCCACCTGCCCTTGTAGG + Intronic
907396655 1:54195437-54195459 CAGCAGGCTCCTGTCCTTGCTGG + Exonic
907887306 1:58605473-58605495 CAGAAAGCTCCATCCCTTGGGGG - Intergenic
908155047 1:61344589-61344611 TAGAAAACCCCTGCCCTTGTGGG - Intronic
912641942 1:111354555-111354577 CAAGAAACTCCTGCCCTTCGTGG - Intergenic
913031014 1:114902569-114902591 CAGGAAGCTCCTGCCGTTTGCGG - Intronic
914930957 1:151932494-151932516 CATGAGGGTTCTGCCCTTGTGGG - Intergenic
915149410 1:153818116-153818138 CAGCCATCTCCTGCCCATGTGGG - Exonic
915586690 1:156847614-156847636 CGGGAAGTGCCTGCCTTTGTTGG + Intronic
916889813 1:169104829-169104851 CAGGAAGATGCTGCACTTGCGGG - Intergenic
917494842 1:175530994-175531016 CAAGAAGCTCCTGTCTTTGAGGG + Intronic
918062388 1:181073183-181073205 CATGAAGCTCATCTCCTTGTAGG - Intergenic
920089437 1:203441776-203441798 CAGGAGGCTCATGCCCTAGAAGG - Intergenic
920273823 1:204788774-204788796 CAGGAAGCTCATGTCCTAGTTGG + Intergenic
920443874 1:206001054-206001076 CAGCAAACTCCTGCCCTTCTAGG - Intronic
922766189 1:228157763-228157785 CAGGAAGCTCCAGCTCATGTTGG - Exonic
923686074 1:236154639-236154661 CTGGGAACTCCTGCCCTTGCTGG - Intronic
924386849 1:243507152-243507174 CAGGCAGCTCCTGCCCTTCCTGG - Intronic
1065126317 10:22577497-22577519 CAGGAAGCTTCTACTCATGTTGG - Intronic
1066442498 10:35451664-35451686 CAGGAGGCTCCTGGGCTTGTGGG - Intronic
1067059100 10:43068660-43068682 AAGGAAGCCCCTCCCCTTGCTGG + Intergenic
1070808452 10:79285005-79285027 CAGGAAGATGCAGCCCTTCTTGG + Intronic
1070941298 10:80350458-80350480 CAGGAAGCACCTGGCCTGTTTGG + Intronic
1073038317 10:100579849-100579871 CAGGAAACTCTTGCCCTCTTTGG - Intergenic
1073323236 10:102628173-102628195 CTGGAAGCTCCAGCCCTGGCTGG - Intronic
1073499106 10:103919771-103919793 CAGGAAGCACCTGTCCTACTGGG - Intergenic
1074284078 10:112081369-112081391 CAGAAATATCCTGCCATTGTCGG + Intergenic
1075151242 10:119934671-119934693 AAGGAAGTTCCTGCCATTTTTGG + Intronic
1076813190 10:132899600-132899622 CATGATGCTCCTGCCCTGGATGG + Exonic
1080874857 11:36266081-36266103 CAGGAAGCGTCTCCCCTTGCGGG + Intergenic
1082009622 11:47441477-47441499 CAGGAATGTCCTGGCCTCGTAGG + Intronic
1083877257 11:65530886-65530908 CAGGAAGCTCCTGCTCATATGGG - Intronic
1084356376 11:68641450-68641472 CAAGAAGCACCTGCCCACGTCGG - Intergenic
1084694220 11:70744248-70744270 CAGGAAGCTCCTGCCCTTGTGGG + Intronic
1086508382 11:87529053-87529075 CAGGAAGCCCCTGCCCCTGCAGG - Intergenic
1088365046 11:109031770-109031792 CAGTCAGCTCGTGCCCTAGTTGG - Intergenic
1089378755 11:118012991-118013013 CAGGAAGCCCCTGAGCCTGTAGG - Intergenic
1090393847 11:126406474-126406496 CTGGAAGCTCCTGGCCATGTTGG + Exonic
1090792620 11:130104895-130104917 AAGGAAGCACCAACCCTTGTTGG - Intronic
1091033246 11:132210481-132210503 CAGAAAGCTCATGGCCTAGTGGG + Intronic
1093828441 12:23724928-23724950 CAGTAAGCTCCTAACCATGTTGG - Intronic
1097237979 12:57552654-57552676 TAGGAATTTCCTTCCCTTGTTGG - Intronic
1097357801 12:58621237-58621259 CAGGGAGCCCCAGCCCCTGTTGG + Intronic
1099928338 12:89044688-89044710 CAGGACCCTCCTTCCCCTGTTGG - Intergenic
1101982866 12:109422635-109422657 CAGGGAGCTTCAGCCCTGGTGGG - Intronic
1102116146 12:110404370-110404392 CAGGCAGTTTCTTCCCTTGTGGG - Intergenic
1104109407 12:125690611-125690633 CAGGAAGCCCCTGGCCATGATGG + Intergenic
1104800862 12:131554531-131554553 CAGGGAGCTCCTGCCCATCAGGG - Intergenic
1104846471 12:131849737-131849759 CAGGAGCCTCCTGCCCTTCGGGG + Intronic
1105781063 13:23705590-23705612 CAGAGACCTCCTGCCCTTGTGGG - Intergenic
1106547593 13:30744096-30744118 CTGGAAGCTCCTCCCATTCTGGG - Exonic
1107354836 13:39556054-39556076 CAGGAAGCTCCTAATCTTGGTGG - Intronic
1114590987 14:23864498-23864520 GAGGAAGCTCCTGCCCTTTCTGG + Intergenic
1115556322 14:34547361-34547383 CAGGCAGCTGCTGGGCTTGTTGG + Intergenic
1115557586 14:34555720-34555742 CAGGCAGCTGCTGGGCTTGTTGG - Intergenic
1117575259 14:57091362-57091384 CAGGAAGCGCCTGGGCTTCTGGG - Intergenic
1118378827 14:65201226-65201248 CAGCAAGCCCCAGACCTTGTGGG + Intergenic
1118610292 14:67533976-67533998 AAGGAAACTCCTCTCCTTGTGGG + Intronic
1118823201 14:69358383-69358405 GGGGCAGCCCCTGCCCTTGTGGG - Intergenic
1119294545 14:73522442-73522464 CAGGAAGCTCTGCCACTTGTTGG + Exonic
1120921436 14:89759312-89759334 CAGGAAGCACATTCCCTTGGTGG - Intergenic
1122102056 14:99420541-99420563 CAGAAAGCTCCAGCCCATGTGGG + Intronic
1122231462 14:100308062-100308084 CAGCCAGCTCCTGCCCTTTTGGG - Intergenic
1123025855 14:105423608-105423630 CAGAAAGCCCCTGCCCCTGCAGG + Intronic
1123809815 15:23912486-23912508 CAGGGAGCAGCTGCCCTTGCCGG - Intergenic
1124143089 15:27094606-27094628 CAGGGAGAGCCTTCCCTTGTTGG + Intronic
1126179784 15:45773914-45773936 CAGGAAGCTTCTGATCTTGGTGG + Intergenic
1127829726 15:62739682-62739704 TAGGAAGCTCATGCCCTCATGGG + Intronic
1128328107 15:66738218-66738240 TGGGAAGCTCCTACGCTTGTGGG + Intronic
1131140415 15:89972559-89972581 CAGGAATCTACTGCCCTGTTAGG - Intergenic
1131237630 15:90710698-90710720 CAGGAAACTCATGCCAATGTGGG - Intergenic
1132228858 15:100166905-100166927 CAGGAAGCCCATGGCCTGGTGGG + Intronic
1132546210 16:534535-534557 CAGGAAGCTCCTGCATGAGTCGG - Intronic
1132710206 16:1263028-1263050 CTGGAAGCTCCTGGCATTGCAGG - Intergenic
1133324994 16:4936935-4936957 CGGGACGCTCTTGCCCCTGTGGG - Intronic
1133965254 16:10526454-10526476 CAGGAAGCCCCTTCCCTGGCGGG - Intergenic
1135324161 16:21515362-21515384 AAGGGAGACCCTGCCCTTGTAGG - Intergenic
1136335642 16:29608634-29608656 AAGGGAGACCCTGCCCTTGTAGG - Intergenic
1136526621 16:30835064-30835086 CAGGAGGCTCCTGCCCAGGAGGG - Exonic
1137248959 16:46729343-46729365 CAAGAAGGTCCTGTCCTTGTTGG - Intronic
1137502042 16:49019206-49019228 CAGGAAGCCAGTGCCCTTGGAGG - Intergenic
1141055185 16:80807198-80807220 CAGGAAGCACCTGCCTTTTCTGG - Intergenic
1141423210 16:83930537-83930559 CAGGAGGCTGCTGGCCTTGTGGG - Intronic
1142354115 16:89594128-89594150 CACGAAGCTCCCGCCCTAGTGGG + Intronic
1146798760 17:35801802-35801824 CAGGAAGCGCCTGCCACTGTTGG + Intronic
1148558160 17:48590905-48590927 CAGGAGGCTCCTGGCCTTTTGGG - Intronic
1151353040 17:73542845-73542867 CGGGAATCTCCTGCCCTTTCCGG - Intronic
1152005024 17:77675366-77675388 CAGCATTCTCCTGCCCTTGGTGG - Intergenic
1152580191 17:81162381-81162403 CAGCAAGCACCTGCCCTGGGAGG - Intronic
1152805407 17:82353581-82353603 CAGGCAGCACCTGCTCCTGTAGG + Intergenic
1155065789 18:22267837-22267859 CAGGAACCTCCTGAACTTCTGGG + Intergenic
1160513692 18:79466814-79466836 CAGGAAGCACCTGCTCCTCTGGG + Intronic
1160696304 19:486257-486279 CAGGAAGGACCTGGGCTTGTAGG - Intergenic
1160744123 19:702688-702710 AGGCAAGTTCCTGCCCTTGTGGG + Intergenic
1161399660 19:4061640-4061662 CAGGAAGCCCCTCCCCATTTAGG - Intronic
1163665688 19:18603175-18603197 CACAAAAGTCCTGCCCTTGTGGG + Intronic
1163812725 19:19444050-19444072 GAGGAAGCTGAGGCCCTTGTGGG + Intronic
1165940141 19:39410726-39410748 CAGGAAACTGCTTCCCTTGTGGG + Intergenic
1166081866 19:40448793-40448815 CAGGAAGCTCCTGCCCTGGCTGG + Intronic
1166356573 19:42230701-42230723 CATCAAGCTCCTGCCCTGGCTGG - Exonic
1166541314 19:43607801-43607823 CAGGAAGCACCAGCCCCTGAAGG - Exonic
1167637959 19:50666436-50666458 CCGGAAGCTGCTGCCCTGGGAGG - Exonic
927217518 2:20676371-20676393 CTGGAACCTCCTGACCATGTAGG + Intergenic
927726065 2:25424278-25424300 CAGGACACTGCTGCCCCTGTAGG - Intronic
928043399 2:27901665-27901687 AAGGAAGCTGCTGCCCTGGGAGG + Intronic
928427594 2:31192031-31192053 CAGGGATCTCCTGCCCTCCTCGG + Exonic
929118586 2:38465422-38465444 AAGGAGGCTCCTGCCCCTGGTGG + Intergenic
929161675 2:38838466-38838488 AAGCAGGCTCCTGCCCCTGTTGG + Intronic
929498615 2:42469837-42469859 CAGGAAGGGCCTGTCCTGGTTGG + Intronic
932373413 2:71212479-71212501 CAGGAAGCCCATGCCCTTAGGGG + Intronic
934466112 2:94264585-94264607 CAGGATGCACCTGCCCCTGGCGG - Intergenic
934845048 2:97657083-97657105 CTGGATGCTCCTCCCATTGTTGG - Intronic
935815673 2:106843812-106843834 CAGGAGGCTCCTGCCGGTGCAGG - Exonic
936028095 2:109049168-109049190 CAGGAAGGTCCTGGAGTTGTTGG + Intergenic
937596468 2:123681137-123681159 CATGGAGCACCTGCCCTTGAGGG + Intergenic
939817985 2:146920196-146920218 AATGCAGCTTCTGCCCTTGTAGG + Intergenic
940150534 2:150595522-150595544 CAGGAAGCTTCCGCTCTTGATGG - Intergenic
940588267 2:155684976-155684998 CAGGACTCACCTGCCCTCGTTGG - Intergenic
940846365 2:158646839-158646861 CAGGAAGCTCATTACCTGGTGGG + Intronic
942650285 2:178159392-178159414 CAGGAAGCTCCTTACCATGGTGG - Intergenic
946048582 2:216841952-216841974 GAGGAAGCTCGTGACCTTGGGGG + Intergenic
946410098 2:219511460-219511482 CAGGAAGCTCATCCCCTGGGGGG + Intergenic
947139563 2:227008560-227008582 CAGGAAGCTCATGGCCTAGCAGG + Intronic
947825327 2:233102322-233102344 CTGGAAGCTGCTGCCTTTGAAGG + Intronic
948306635 2:236953205-236953227 CAGGAAGCTCTTCCCGCTGTGGG - Intergenic
1170079757 20:12461097-12461119 CAAGAAGCTCTTCCCCTTCTGGG + Intergenic
1170591593 20:17775853-17775875 CAGGCAGCCCCTGCCCTCTTGGG - Intergenic
1172366713 20:34355662-34355684 TAGGAACCTCCTTCCCTTGCTGG + Intergenic
1173228667 20:41177286-41177308 CAGAATGCCCCTGACCTTGTAGG - Intronic
1174668419 20:52282733-52282755 CAGAAAGCTGCTGTGCTTGTAGG - Intergenic
1175178122 20:57125922-57125944 CATGGAGCTCCATCCCTTGTGGG - Intergenic
1175445159 20:59014965-59014987 GAGGAAGCTCCTGCCCTCTGGGG + Intergenic
1175520131 20:59597390-59597412 CAGGAACCTCATGCTTTTGTTGG - Intronic
1176070262 20:63222579-63222601 CAGGTAGATCCAGCCATTGTGGG - Intergenic
1179494395 21:41762500-41762522 TAGGAAGCTCCAGCCCTTCTGGG + Intronic
1179818337 21:43922258-43922280 GAGGAGGCTCCTGTTCTTGTGGG + Intronic
1181623453 22:24106389-24106411 CAGGAAGCCCCTGCTCTGGGAGG - Intronic
1182118020 22:27768557-27768579 CATGGAGCTCCTGAGCTTGTAGG - Intronic
1182294124 22:29303209-29303231 CAGGAAGCTCTGGCACTGGTTGG - Intergenic
1185274800 22:49945723-49945745 CAGGAAACTCCGCCCCTTTTGGG + Intergenic
1185338221 22:50280211-50280233 GTGGCAGCTCCAGCCCTTGTGGG + Intronic
949290593 3:2460991-2461013 TAGGAAGCCCCTGTCCTTCTGGG + Intronic
949864797 3:8538581-8538603 CACCAAGCTCCTGCCCTCCTTGG + Intronic
950225294 3:11228562-11228584 CACAGTGCTCCTGCCCTTGTAGG + Intronic
950665673 3:14493467-14493489 CAGGGAGGTCCTGCCCTAGTTGG - Exonic
952010638 3:28897095-28897117 CAGGAAGCTTCTACTCATGTTGG + Intergenic
952424973 3:33166576-33166598 CAGGAAGTTCCTGGGCTAGTGGG - Intronic
953200964 3:40778208-40778230 CTGGAAGTTTCTGCCTTTGTTGG - Intergenic
955194121 3:56788931-56788953 GAGGTAGCTCCTTCCTTTGTAGG - Intronic
955354933 3:58223411-58223433 AAGACAGCTCCTGCCCTTGAGGG + Intergenic
956425625 3:69131601-69131623 CAGGAAGCAACTGCTCTTGTTGG + Intergenic
961543050 3:127613187-127613209 CAGGAAGCTCTTGGCCCTGGAGG + Intronic
961627259 3:128272698-128272720 CAGGCTGCTCCTGGCCTGGTTGG + Intronic
962322402 3:134402724-134402746 GACAAGGCTCCTGCCCTTGTGGG + Intergenic
962624349 3:137210570-137210592 AAAGAAGCTCCTGCCCCTGGGGG - Intergenic
962812459 3:138971350-138971372 CAGAAGGCTCCTTCCCATGTGGG - Intergenic
962876898 3:139542052-139542074 CAGTACGCTCCTGCCCTTCTGGG + Intergenic
964791935 3:160460677-160460699 CAGGCAGGATCTGCCCTTGTGGG - Intronic
965079158 3:164016655-164016677 CAGGTAGTTGCTGCCCTTGTAGG - Intergenic
965139135 3:164813406-164813428 CAGGAAGCTGTTTCCCTTGGTGG - Intergenic
966609143 3:181850848-181850870 GAGGATGCTGCTGCCCTTGTGGG + Intergenic
968573352 4:1353837-1353859 CAGGTAGCACCGGCCCTTGCTGG + Intronic
968623371 4:1614656-1614678 CAGGGAGCTCCTGCTCCTGGGGG + Intergenic
969836457 4:9846324-9846346 CAGGAAGCTCCTCCCCTCACAGG + Intronic
973978121 4:56283403-56283425 CTGAAAGCTCCTTCCCTTTTAGG + Intronic
975811880 4:78178090-78178112 CAGGCAGCTCCTGGCCTCCTAGG + Intronic
976286836 4:83378760-83378782 AGTGAAGCTCCTGACCTTGTAGG + Intergenic
978817814 4:112929459-112929481 AGGGAAGCTCCTGAACTTGTTGG + Intronic
981015425 4:139969135-139969157 CAGGAAGCTCCTTCCTCTGCAGG - Intronic
981061571 4:140430875-140430897 CATGAAGGTCCTGTCCTCGTAGG + Intergenic
984975148 4:185223566-185223588 CAGGATGGTCCTACCCTTCTCGG - Intronic
985704318 5:1391735-1391757 CAGGCAGGTTCAGCCCTTGTAGG + Intergenic
985749973 5:1668098-1668120 CTGCAAGCTCGTGCCCTTGAGGG - Intergenic
985777445 5:1852215-1852237 CAGGGAGCTCCTTCCCTTCTAGG + Intergenic
987203022 5:15596603-15596625 CAGGCAGGCACTGCCCTTGTGGG - Intronic
987899445 5:23992043-23992065 CAGGAAGGTCCTCTCCTAGTTGG + Intronic
988727658 5:33940085-33940107 CTGGCAGCTTCTGCCTTTGTGGG - Intergenic
996346107 5:122490322-122490344 CAGGAAGCTCTTGCCCTAAATGG + Intergenic
997453170 5:133999667-133999689 CAAGAAGCTCCCTCTCTTGTAGG + Intronic
997864607 5:137450061-137450083 AAAGAAGATCCTGCCCTTTTTGG - Intronic
998097348 5:139403769-139403791 CAGGAAGGTCCGCCCCTTTTTGG + Intronic
998784212 5:145691167-145691189 CAGGAACCTCCTGTCTTTTTGGG - Intronic
999476734 5:151906960-151906982 CAGGCAGCTTCTTCCATTGTTGG - Intronic
999902316 5:156098000-156098022 GGGGAAACTCCTGCCCTTGCAGG - Intronic
1000261089 5:159589271-159589293 CTGGAAGATCCTTCCCTTCTAGG + Intergenic
1001490437 5:172150968-172150990 CAGGACGTGCCTGCCCTTGGTGG - Intronic
1002358611 5:178651504-178651526 CATGAATCTTCTGCCCTTTTTGG + Intergenic
1002705348 5:181157497-181157519 GAGGAGGCTCCTTCCCTTGGGGG + Intergenic
1002770349 6:285339-285361 CAGGAAGCTCTCGGCATTGTTGG - Intergenic
1006446062 6:34080417-34080439 GATGAAGCTCCTGGCCTTGTGGG - Intronic
1012171139 6:96017277-96017299 CAAGAAGCTCCTGCACTATTTGG + Intronic
1014674715 6:124349297-124349319 CGGGAAGTTCCCGCCTTTGTAGG - Intronic
1016720835 6:147295637-147295659 CAGGAGGCACTTCCCCTTGTGGG + Intronic
1018226467 6:161634183-161634205 CAGAAAGCACATCCCCTTGTCGG + Intronic
1018325218 6:162660630-162660652 CAGGAGCCTCCTACTCTTGTAGG - Intronic
1019016582 6:168884848-168884870 CAGGCAGCCCCGGCCCTTGGCGG - Intergenic
1024064229 7:45719179-45719201 CAGGAAGCAGCTGCCCTGGCTGG - Exonic
1024821581 7:53337085-53337107 CTGGAAGCCCCTGCCCTGCTTGG + Intergenic
1026296239 7:69054824-69054846 CAGGAAGCCCCTGGCGGTGTGGG - Intergenic
1028669327 7:93383241-93383263 GAGCAATCACCTGCCCTTGTAGG + Intergenic
1032061655 7:128730082-128730104 GAGGAATCCCCTGCCATTGTGGG + Intronic
1032954068 7:136950357-136950379 CAGGATGCTCCTGTCCCTGCGGG + Intronic
1033407461 7:141084182-141084204 CATGAAATTCCTGCCCTCGTAGG + Intronic
1034098987 7:148435785-148435807 CAGGAAGGCCCAGCCCTTCTGGG + Intergenic
1034556307 7:151852512-151852534 CATGAGGCTGCTGCCCTCGTAGG - Intronic
1035017155 7:155776645-155776667 CAGGAAGCCACAGCGCTTGTAGG + Exonic
1035677091 8:1463528-1463550 CAGGACGCTCCTGCCCCGGGTGG + Intergenic
1036694850 8:10967783-10967805 CAGGAGGCTCCTGCTCCTGGCGG + Intronic
1037175237 8:15939356-15939378 GAGGAAGCTCCTGCTCCTGGAGG - Intergenic
1038019043 8:23537537-23537559 CAGGAAGCTGCTGGGCTTGGAGG - Intronic
1039482136 8:37882094-37882116 CCTGAAGCTCCTGCCCTGGGCGG - Intronic
1039844388 8:41315646-41315668 TAGGAAGCCCCTGCCCCTCTGGG + Intergenic
1039893032 8:41697241-41697263 CAACAGACTCCTGCCCTTGTGGG + Intronic
1041429159 8:57759358-57759380 CAGTAGGCTCCTGACCTTGAGGG + Intergenic
1041881857 8:62760917-62760939 CAGGAAGCCTCTGCACCTGTCGG + Intronic
1042950627 8:74197897-74197919 CAGGAAGCTCCTCCCTCTGGGGG - Intergenic
1044607720 8:94061557-94061579 CAGGGAGCTCCTGTTCTAGTGGG - Intergenic
1044866786 8:96578923-96578945 CAGTAAACTCCTGCGGTTGTTGG + Intronic
1045029784 8:98124126-98124148 CAGGAAGCTCCAGCTCTCCTGGG + Intronic
1047904219 8:129455492-129455514 CAAGCAGCACCTGCCCTTTTTGG + Intergenic
1048179778 8:132184241-132184263 CAGGAAGCCCCTGTGCATGTTGG - Exonic
1049337178 8:142092638-142092660 GAGGAAGCTCCTGTCTTTCTCGG + Intergenic
1049802645 8:144525305-144525327 CAGGAAGCTCCTGACCTGCTGGG - Intronic
1051195857 9:14562255-14562277 CAGGAGGCCCCTGCCCAGGTGGG + Intergenic
1052115932 9:24648733-24648755 CAGGAAGCCCCTGCCCCTGAAGG + Intergenic
1053696165 9:40641357-40641379 CAGGATGCACCTGCCCCTGGTGG - Intergenic
1054307412 9:63440576-63440598 CAGGATGCACCTGCCCCTGGTGG - Intergenic
1054406144 9:64764587-64764609 CAGGATGCACCTGCCCCTGGTGG - Intergenic
1054439770 9:65250060-65250082 CAGGATGCACCTGCCCCTGGTGG - Intergenic
1054451194 9:65404336-65404358 CAGGAAGCTCCTGGGCTTAGAGG - Intergenic
1054490637 9:65771879-65771901 CAGGATGCACCTGCCCCTGGTGG + Intergenic
1056098899 9:83281708-83281730 CAGGAAGCTCGCTCCCTTCTGGG - Intronic
1058264625 9:102883097-102883119 CAGGAATCCTCTGCCCTAGTGGG - Intergenic
1058648656 9:107154563-107154585 CAGGGAGGTGATGCCCTTGTGGG + Intergenic
1060018854 9:120111110-120111132 CAGGAAGCTGATGATCTTGTGGG - Intergenic
1060294402 9:122333425-122333447 CTGGAAGTCCCTGCCCTTGAGGG - Intergenic
1060452170 9:123753296-123753318 CATGGAGCTCATGCCCTAGTGGG + Intronic
1060511930 9:124240667-124240689 CAGGATCCTCCTTCCCTTTTGGG - Intergenic
1060996244 9:127876212-127876234 CAGGAGGCACCTGCCAGTGTGGG - Intronic
1062498449 9:136842486-136842508 CTGGAAGCTTCTGCCCGTGCCGG + Intronic
1062637815 9:137500717-137500739 CAGGAAGCTGCAGTCCCTGTTGG + Exonic
1202778614 9_KI270717v1_random:15018-15040 CAGGATGCACCTGCCCCTGGTGG - Intergenic
1203585687 Un_KI270747v1:1429-1451 CAGGATGCACCTGCCCCTGGTGG - Intergenic
1186286576 X:8050165-8050187 CAGGAAGCTCCTCCCAATCTGGG + Intergenic
1186477257 X:9867055-9867077 CAGGATGCCCTTGCCCTTATGGG + Intronic
1186845282 X:13524627-13524649 CAGAAAGATCCTGCCCATTTTGG - Intergenic
1189204035 X:39222417-39222439 CAGCAGGCTCCTGCTCTTGGTGG + Intergenic
1191163926 X:57366871-57366893 CAGGCAGCTCTAGCCTTTGTTGG - Intronic
1191701667 X:64048452-64048474 CTGGAAGCTCCATCCCATGTGGG - Intergenic
1192169575 X:68845929-68845951 CAGGAAAATCCAGCCATTGTGGG - Intergenic
1195670242 X:107463601-107463623 CAACATGTTCCTGCCCTTGTGGG - Intergenic
1195709309 X:107761283-107761305 CAGGAAGTTCTAGCCCTTGTGGG - Intronic
1195880387 X:109586728-109586750 CAGGAAGCCCCTGCCCCTGCAGG - Intergenic