ID: 1084696260

View in Genome Browser
Species Human (GRCh38)
Location 11:70757386-70757408
Sequence CCGCAGGGCTGGCCCCTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 221}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084696253_1084696260 -7 Left 1084696253 11:70757370-70757392 CCTGAGAAAGTCCTGCCCGCAGG 0: 1
1: 0
2: 1
3: 22
4: 147
Right 1084696260 11:70757386-70757408 CCGCAGGGCTGGCCCCTAGCTGG 0: 1
1: 0
2: 1
3: 18
4: 221
1084696251_1084696260 7 Left 1084696251 11:70757356-70757378 CCTGTGGCTGCTGCCCTGAGAAA 0: 2
1: 0
2: 6
3: 35
4: 319
Right 1084696260 11:70757386-70757408 CCGCAGGGCTGGCCCCTAGCTGG 0: 1
1: 0
2: 1
3: 18
4: 221
1084696252_1084696260 -6 Left 1084696252 11:70757369-70757391 CCCTGAGAAAGTCCTGCCCGCAG 0: 1
1: 0
2: 2
3: 13
4: 153
Right 1084696260 11:70757386-70757408 CCGCAGGGCTGGCCCCTAGCTGG 0: 1
1: 0
2: 1
3: 18
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084696260 Original CRISPR CCGCAGGGCTGGCCCCTAGC TGG Intronic
900178720 1:1302168-1302190 CTGCAGGGCTGGCCTCAAGGGGG + Intronic
900334916 1:2157902-2157924 CCGCAAAGCTGGCCCGGAGCTGG - Intronic
900646780 1:3712668-3712690 CCACAGGGCTGTCCCCAAACTGG - Intronic
901007698 1:6179831-6179853 CGGCCGGGCTGGCGCCTCGCAGG - Intronic
901626650 1:10628765-10628787 CCGCAGGGCTGTCCCCCAGCAGG - Intronic
901639533 1:10686389-10686411 CCCCAGGGCTGCCCCATAGTTGG - Intronic
902171893 1:14618417-14618439 CCCCATGGCTGGCCCCATGCTGG + Intronic
902617994 1:17634456-17634478 CCCCATGGCTGGCCCCCAGCGGG + Intronic
902810003 1:18882785-18882807 AGGCAGGGCTGGCCCGGAGCTGG - Intronic
904003548 1:27351456-27351478 GCGCAGGACTGCCCCCGAGCGGG + Exonic
904009972 1:27383771-27383793 CCGCTGGGCCGGGCCCTAGCTGG + Intergenic
906688877 1:47779711-47779733 CCACAGGGCAGGCCCATGGCAGG - Intronic
910448991 1:87328515-87328537 CGGCGGCGCTGGCCTCTAGCCGG - Exonic
910796750 1:91104898-91104920 GAGCATGGTTGGCCCCTAGCTGG + Intergenic
912492329 1:110069306-110069328 CCGCCCGGCTGGCGCCTCGCGGG - Intronic
919743138 1:200992450-200992472 CCTCAGAGCTGGCCCCTCCCTGG - Intronic
921030953 1:211334774-211334796 TCGCAAGGATGGCCCCTGGCTGG - Intronic
922091527 1:222399938-222399960 ATGCAGGGCTGGCTCCTTGCTGG - Intergenic
1063373375 10:5536656-5536678 CCACAGTGCTGGGCCCTAGAAGG - Intergenic
1065019732 10:21494609-21494631 CCGCAGGCCTGTCGCCTAGGCGG - Exonic
1067227697 10:44386307-44386329 CCCCAGGGCAGGCCCCTGGATGG - Intronic
1067946040 10:50688492-50688514 CGGCTGGGGTGGCCCCTGGCAGG + Intergenic
1070272026 10:74965682-74965704 CAGCAGGGCTGGCTCCTCTCTGG + Intronic
1070881352 10:79853492-79853514 CGGCTGGGGTGGCCCCTGGCAGG + Intergenic
1071647928 10:87369808-87369830 CGGCTGGGGTGGCCCCTGGCAGG + Intronic
1072550215 10:96471534-96471556 CCGCAGGGTTGGCCCTTTGCTGG - Intronic
1073012605 10:100373207-100373229 CCGCAGGGCTGAGCCAGAGCTGG - Intergenic
1075781865 10:125022412-125022434 CCACAGGCCTGGCACATAGCAGG + Intronic
1076679612 10:132164978-132165000 TCGCATGGCTGGGCCCTGGCAGG - Intronic
1076842993 10:133055807-133055829 CAGCAAGGCTGGCCCCATGCAGG + Intergenic
1077009433 11:373642-373664 CCTCAGGGCTGGCCCTCAGGAGG - Intronic
1077268013 11:1661535-1661557 CCACAGGGCTGAGCCCTGGCTGG - Intergenic
1077272906 11:1690197-1690219 CCACAGGGCTGAGCCCTGGCTGG + Intergenic
1078101158 11:8331111-8331133 CTCCAGGACTGGCCCCTATCAGG + Intergenic
1078663283 11:13304252-13304274 CAGAAGGGCTGGCCCTGAGCCGG + Intronic
1080578510 11:33622357-33622379 CCACAGGGCTGGCCCTGAGGAGG + Intronic
1083271416 11:61574764-61574786 CAGCATGGCTGGCACATAGCAGG - Intronic
1083551037 11:63590423-63590445 GCTCAGAGCTGGCCCCCAGCCGG + Intronic
1084556677 11:69879885-69879907 CCCCAGGCCTGGCCCCTTCCTGG + Intergenic
1084696260 11:70757386-70757408 CCGCAGGGCTGGCCCCTAGCTGG + Intronic
1085527898 11:77174695-77174717 CAGCAGGGCTGCCTCCCAGCAGG + Intronic
1087162734 11:94965508-94965530 TTGCAAGGCTGGCCCCTGGCTGG + Intronic
1089578000 11:119460288-119460310 CCGAAGGGCTGGGGCCTTGCAGG + Intergenic
1090653189 11:128824528-128824550 CCCCAGGGCTGAGCCCGAGCCGG - Intergenic
1091629246 12:2146865-2146887 AAGCAGGGCTGGACCCAAGCAGG + Intronic
1092098162 12:5861375-5861397 CCGCACTCCAGGCCCCTAGCAGG + Intronic
1096789174 12:54034509-54034531 CCGCAGAGCGCGCCCCTAGCCGG + Exonic
1098051253 12:66455690-66455712 CCTGAGAGCTGGCCTCTAGCTGG - Intronic
1100617302 12:96240811-96240833 CCACAGGCCTGGCTCCTCGCGGG + Intronic
1102260023 12:111437905-111437927 CCCCAGGGCTGGGCCTCAGCTGG + Intronic
1102461100 12:113100054-113100076 CCTCAGGACAGGCCCCTAGGAGG + Exonic
1103623271 12:122201375-122201397 CCCCAGGGCTGGCCCTCAGCAGG - Intronic
1104721134 12:131045782-131045804 CCGCAGGGCAGCTCCCTCGCTGG - Intronic
1105443989 13:20436880-20436902 CTGCAGGGTGGGCTCCTAGCTGG + Intronic
1106104033 13:26718347-26718369 CAGCAGGGCAGGCACCCAGCAGG + Intergenic
1106228244 13:27801219-27801241 CCCCAGAGATGGCCTCTAGCTGG + Intergenic
1108601243 13:51997008-51997030 CCACAGTGCTGGCCTCTGGCAGG - Intronic
1113708751 13:112450572-112450594 CTGCAGGCTTGGCCTCTAGCCGG + Intergenic
1113937438 13:114001868-114001890 CAGCAGGGCTGGCCCTGAGGGGG - Intronic
1117201234 14:53392087-53392109 CTGCAGGCCTGGCCCCTTGCTGG + Intergenic
1118772612 14:68952247-68952269 GCCCAGGGCTGGCCTCCAGCAGG - Intronic
1119396116 14:74327458-74327480 CCGCAGGGATGGCCCCACCCAGG + Intronic
1119619019 14:76117889-76117911 CCGCATGGCTGGCAGCCAGCCGG - Intergenic
1121328076 14:93033447-93033469 CAGCAGGGCTGGCCCAGAGGAGG - Intronic
1121405433 14:93716753-93716775 ACACTGGGCTGGCCCCTAGGAGG + Intergenic
1121761150 14:96446172-96446194 CAGCAGGACCGGCCCCCAGCAGG - Intronic
1122027079 14:98885965-98885987 CCGCAAGCCTGGCCCTTGGCTGG - Intergenic
1122202013 14:100128459-100128481 CAGCAGGCTTGGCCCCCAGCTGG + Intronic
1122716893 14:103701273-103701295 CGGCAGGGAGGGCCCCTGGCCGG + Intronic
1122952699 14:105054379-105054401 CCGCAGGGCTGACCCCGTTCGGG - Intronic
1123411928 15:20067826-20067848 CTGCAGGGCTCCCCCCGAGCAGG + Intergenic
1123521272 15:21074945-21074967 CTGCAGGGCTCCCCCCGAGCAGG + Intergenic
1123578357 15:21695027-21695049 CTGCAGGGCTCCCCCCGAGCAGG + Intergenic
1123614982 15:22137509-22137531 CTGCAGGGCTCCCCCCGAGCAGG + Intergenic
1124410186 15:29430448-29430470 GCACAGGCCTGGCCCATAGCAGG + Intronic
1124983084 15:34582660-34582682 CCGCAGGACAGGCCCCTCGGCGG + Intronic
1126525020 15:49644316-49644338 CAGCAGAGATGGCCACTAGCAGG - Exonic
1128229296 15:66023825-66023847 CGGCAGGGCTGTGCCCCAGCTGG - Intronic
1129468151 15:75735569-75735591 CCGTAGGGCTGGACCCTACATGG + Intergenic
1129540059 15:76341592-76341614 CCGCAGGGCTTGCTCTCAGCTGG + Intronic
1129607270 15:77031006-77031028 CCTCAGGGCTGGCCCGGAGTCGG + Intronic
1132287088 15:100671130-100671152 CGGCAGGGCTCGCCCCTTTCTGG - Intergenic
1132391953 15:101445820-101445842 CAGCAGTGCTGACCCTTAGCAGG + Intronic
1202987227 15_KI270727v1_random:429272-429294 CTGCAGGGCTCCCCCCGAGCAGG + Intergenic
1132659455 16:1054953-1054975 CGGCCGGGCTGGCCACTCGCCGG + Intergenic
1132731322 16:1363674-1363696 CCTCAGGGATGGCTCCTAGGTGG - Exonic
1132829279 16:1919517-1919539 CCACAGGGCTGGCGCCAGGCAGG + Intergenic
1132832009 16:1933035-1933057 CCTCAGTTCTGGCCCCCAGCAGG + Intergenic
1133218821 16:4309573-4309595 GCACAGGGCTGGCCCTTAGAAGG - Intergenic
1136348928 16:29694758-29694780 CAGCGGGGCAGGCCCCTCGCAGG + Exonic
1137712262 16:50574597-50574619 TCGCAGGCCTGGCCTCCAGCGGG + Intronic
1138582862 16:57952952-57952974 CCCCAGGGCAGGCCCCCAGGAGG + Intronic
1139515419 16:67449801-67449823 CCCCAGGCCTGGCCCAGAGCAGG + Intronic
1139750426 16:69106422-69106444 CCGCAGGGCTGGGAGCTGGCCGG - Intronic
1141770726 16:86088175-86088197 CAGCAGGGGTTACCCCTAGCTGG + Intergenic
1141895001 16:86953712-86953734 ACACAGGGCTGGCCCCTGTCGGG - Intergenic
1142110285 16:88327505-88327527 GCACAGGCCTGGCCCCTAGCTGG - Intergenic
1142758982 17:2032272-2032294 CCGCAGGGCTGTTCTCTATCAGG + Intronic
1142805081 17:2367287-2367309 CCGCGCGGCTGGCCGCTAGGTGG - Exonic
1142902105 17:3018476-3018498 CTGCAGGGCTGGCCCCGAGGAGG - Intronic
1144960848 17:19043142-19043164 CCTCAGGCCTGGGCCCTAGGAGG - Intronic
1144974312 17:19131382-19131404 CCTCAGGCCTGGGCCCTAGGAGG + Intronic
1145981709 17:29016477-29016499 CAGCAGGGCTGGCCTCTATGAGG - Intronic
1146256917 17:31397040-31397062 CCCCAGGGCTGGCTCCTGGCCGG - Intronic
1146904173 17:36607679-36607701 CAGCAGGGCTGGCTCGTGGCCGG + Exonic
1147934712 17:44004996-44005018 CCCCAGGGCTGGCCCCGCACTGG - Exonic
1148327016 17:46789240-46789262 CACCAGGGCTGGCACCTACCTGG + Intronic
1148351077 17:46942689-46942711 CCTCAGGCCTTGCCCCTAGGGGG + Intronic
1148821242 17:50360861-50360883 CTGCAGAGCTGGGCTCTAGCAGG + Exonic
1149630171 17:58115804-58115826 CCCCTGGGCTGGCCCCTGGGTGG + Intergenic
1151356167 17:73559880-73559902 CCCCAGGGCTGGGCACCAGCTGG + Intronic
1151469179 17:74307269-74307291 TCGCAGGGCTGGTTCCTAGAGGG + Intronic
1151611164 17:75176279-75176301 CCGCCTGGCTGGCCACTAACAGG + Intergenic
1152119965 17:78412531-78412553 CCTCAGCGCTGGCCTCTAGGTGG + Intronic
1152404655 17:80089913-80089935 CCCAAGGGCTGGCACCCAGCAGG - Intronic
1152562800 17:81086928-81086950 CTGCAGGGCTGGCCACTCGAGGG + Intronic
1152639342 17:81443146-81443168 GCGCAAGGCTGGCGCCTACCTGG + Exonic
1152751691 17:82065370-82065392 CCGCGGGCCTGGCCCTGAGCAGG + Exonic
1157556531 18:48616339-48616361 CCGGAGAGCTGGCCCCAAGCAGG - Intronic
1158283286 18:55851069-55851091 CTGCTGGGCTGGGCCCTGGCTGG - Intergenic
1160144242 18:76350637-76350659 CCGCAGAGCAGGCCCCTTGACGG + Intergenic
1160673763 19:377837-377859 CCGGAGGGCCGGCCCCACGCTGG - Intergenic
1160946212 19:1645166-1645188 CCCCAGGGGTGGGCCCTGGCTGG - Intronic
1161583039 19:5091151-5091173 CGGCCGGGCTGGCCCCGAGGTGG + Intronic
1161618040 19:5283169-5283191 CCGTGGGGCTGGCCCCGGGCAGG - Intronic
1163035432 19:14566593-14566615 ACCCAGGCCTGGCCCCTGGCAGG - Intronic
1163113254 19:15174280-15174302 CAGCAGGGCCGGCACCTCGCTGG + Exonic
1166329199 19:42069099-42069121 GCGCAGAGCAGGCCCCTAGTGGG + Intronic
1166514709 19:43437740-43437762 CCGTAGGGCTGGCCCCTACAAGG + Intergenic
1166920913 19:46228630-46228652 CACCATGGCTGGCTCCTAGCAGG - Intergenic
1167717930 19:51155819-51155841 CCATGGGGCTGGCCCCTAGTAGG - Intergenic
925076271 2:1018857-1018879 CAGCAGGGTTGGCTCCCAGCAGG + Intronic
926130832 2:10302539-10302561 GCGCAGGGCTGGCCCCTCCCGGG + Intergenic
929922482 2:46182435-46182457 CAGGAGGGCTGGCCCCCGGCAGG - Intronic
934079154 2:88452614-88452636 CCGCAGGGTTGGCCCCCAAAGGG - Exonic
935585951 2:104800555-104800577 CAACAGGGCTGGCTCATAGCAGG - Intergenic
936804889 2:116319117-116319139 CCTCAGGGCTTCCCCCAAGCTGG - Intergenic
937330588 2:121025883-121025905 GCTCAGGGCAGGCCCCAAGCAGG + Intergenic
938117756 2:128613371-128613393 CTGCAGGGCTGGCCCTTTCCTGG + Intergenic
938207984 2:129439947-129439969 CAGAAGGCCAGGCCCCTAGCAGG - Intergenic
938305740 2:130253030-130253052 CCGCAGGGCTGAGCTCCAGCTGG - Intergenic
938583690 2:132669778-132669800 GCGCAGGGCTGGCCCCGAGGTGG + Intronic
938727286 2:134120129-134120151 CCGCAGGGCCGCCGCCGAGCGGG - Intronic
944933648 2:204545584-204545606 TGGCAGGGCCGGCCCCAAGCCGG - Intergenic
945318934 2:208399325-208399347 CCTCAGGACTGGCCCTTGGCTGG + Intronic
948785567 2:240350694-240350716 CTGCAGGGCTGGCTCCTCTCAGG - Intergenic
948801556 2:240435630-240435652 CCGCCGGCCCGGCCCCTAGGCGG - Intergenic
1171226222 20:23444142-23444164 CCCCAGGGCTGGGCCCCAGCTGG - Intronic
1172764549 20:37344626-37344648 GCTCAGGGCGGGCCCCCAGCTGG - Intergenic
1173088417 20:39947196-39947218 GAACAGGGCTGGCCACTAGCAGG + Intergenic
1174088142 20:48025023-48025045 AAACAGGGCTGGCCCCTGGCTGG + Intergenic
1174399653 20:50269242-50269264 CGGCTGGGCTGGCCACCAGCTGG + Intergenic
1175357595 20:58381161-58381183 TCACAGGTCTGGCCCCTGGCTGG - Intergenic
1175691475 20:61068647-61068669 CCGCAGGGCTGGCTCCTTCATGG + Intergenic
1175814428 20:61876178-61876200 CCTCTGGGATGGCCCCTTGCAGG + Intronic
1175857878 20:62132467-62132489 CTGCAGCACTGGCCCCTAACTGG - Intronic
1176215105 20:63944264-63944286 ACTCAGGGCTGGCACCTGGCAGG + Intronic
1176238105 20:64063552-64063574 CGGCAGGGCTGGCCCGGGGCAGG - Intronic
1179783362 21:43716575-43716597 CTGGAGGGGTGGCCCCCAGCTGG - Intergenic
1179887614 21:44321078-44321100 CAGCAGGGCTGGCTCGTACCAGG + Intronic
1181050661 22:20236863-20236885 CTCCAGGGCTGGGCCCAAGCAGG + Intergenic
1181980145 22:26760381-26760403 CCTGGGGCCTGGCCCCTAGCAGG + Intergenic
1182226154 22:28800377-28800399 CCTCCGGGCTGGCCCCTCTCTGG + Exonic
1183710847 22:39502391-39502413 CCGCAGGACTCGCCTCTGGCCGG - Exonic
1184159811 22:42691624-42691646 CCGCAGGGCGAGACCCCAGCTGG - Intergenic
1184229804 22:43152318-43152340 CCGTAGCCCTGGCCCCTGGCAGG - Intronic
1184378254 22:44128731-44128753 CTGCAGGGCTGGCTGGTAGCAGG - Intronic
1185314624 22:50173712-50173734 CAGCAGGGCTGGCTCCAAGGGGG + Intronic
950099628 3:10348839-10348861 GAGCAGGGCTGGCACCTGGCAGG + Intronic
953364236 3:42328542-42328564 CCTCAGGGTTGGCCTCTAGAAGG - Intergenic
954510884 3:51123870-51123892 TTGCAAGGCTGGCCCTTAGCTGG - Intronic
954754137 3:52829891-52829913 CCGCAGGGCACTCCCCTAGCAGG + Intronic
959126455 3:102295249-102295271 CAGCAGGGATGGCCACTACCAGG - Intronic
961537717 3:127580147-127580169 CCCCAGGGCTGGCTGCTGGCGGG - Exonic
962170298 3:133094639-133094661 CTGCTGGCCTGGCCCCTTGCAGG + Intronic
966711919 3:182980434-182980456 CGGCAGCGCCGGCCCCCAGCCGG + Intronic
968669705 4:1842517-1842539 CCACAGTGCTGCCTCCTAGCGGG + Intronic
968869211 4:3232993-3233015 GTGCAAGGCTGGCCCCTGGCTGG - Intronic
969109241 4:4831507-4831529 CAGCAGGGCTGGCTCCTGGTGGG - Intergenic
969272973 4:6115515-6115537 GTGCAGGGCTGGCACCTTGCAGG - Intronic
969284807 4:6196463-6196485 CCCCAGGGCTGGCCACTGGTGGG - Intronic
969321769 4:6417020-6417042 CCCCAGTGCTGGACCCCAGCAGG - Intronic
969504502 4:7576464-7576486 CCACAGGGCTTGGCTCTAGCAGG - Intronic
971470865 4:27025011-27025033 CAGCAGTGCCGGCCCCCAGCTGG - Intronic
973346374 4:49060274-49060296 CCACAGGGCTGGCCTGGAGCTGG + Intronic
992487660 5:77211126-77211148 CCGCAGGGCCCGCACCGAGCTGG + Exonic
997530776 5:134579973-134579995 CCGCTGGGCTGGGCACTGGCAGG - Exonic
997568111 5:134905018-134905040 CTGCGGGGCTGGCCCGGAGCGGG - Intronic
1007727049 6:43922906-43922928 GCGCAGGGCTGGCCCATGGAGGG + Intergenic
1011825756 6:91303433-91303455 CCGCAGAGCTGGCGCCCACCCGG + Intergenic
1012582117 6:100881553-100881575 CGGCAGGCCTGGCCCGTTGCGGG - Intergenic
1013586410 6:111582678-111582700 AAGCAGGGCTGGCCCCTACCTGG - Intronic
1015074667 6:129141328-129141350 CCGCATTTCTGGCACCTAGCAGG - Intronic
1015513354 6:134060986-134061008 CTTCAGGTCTGGGCCCTAGCAGG + Intergenic
1017725669 6:157274716-157274738 CTGCGGGGATGACCCCTAGCTGG - Intergenic
1018947307 6:168356740-168356762 CAGCAGGGGTGGCCCCAGGCAGG + Intergenic
1018947323 6:168356795-168356817 CAGCAGGGGTGGCCCCAGGCAGG + Intergenic
1018947538 6:168357510-168357532 CGGCAGGGGTGGCCCCAGGCAGG + Intergenic
1018947553 6:168357565-168357587 CAGCAGGGGTGGCCCCAGGCAGG + Intergenic
1018947743 6:168358169-168358191 CAGCAGGGGTGGCCCCAGGCAGG + Intergenic
1018947932 6:168358773-168358795 CAGCAGGGGTGGCCCCAGGCAGG + Intergenic
1018947948 6:168358828-168358850 CAGCAGGGGTGGCCCCAGGCAGG + Intergenic
1018953762 6:168394670-168394692 CCACAGGGCTGGCTCCTTGTGGG - Intergenic
1019408997 7:898531-898553 CCACCGTGCTGGCCCCAAGCAGG + Exonic
1019548632 7:1591298-1591320 CCCCGGGGCTGGCAGCTAGCAGG + Intergenic
1019839910 7:3430782-3430804 CCGGAGGCATGGGCCCTAGCAGG - Intronic
1019983944 7:4641772-4641794 GCGCAGGGCGGGCCGCGAGCAGG - Intergenic
1020107629 7:5429453-5429475 CGGCAGGGCTGGGGCCTAGCGGG - Intergenic
1024689973 7:51789496-51789518 CAGAAGGTCTGGTCCCTAGCAGG + Intergenic
1024902848 7:54341509-54341531 ACGTGGGGCTGGCCCTTAGCAGG + Intergenic
1026788431 7:73316657-73316679 CCGCAGGCCCGGCCCTTAGAAGG - Exonic
1029450792 7:100641006-100641028 ACGGAGGGCTGCCCCCTACCTGG - Exonic
1035391547 7:158507909-158507931 GCGCAGGGCTGTCCCCTGGATGG - Intronic
1036687457 8:10921376-10921398 CAGCAGGTCTGGCCCATGGCGGG + Intronic
1036786773 8:11692954-11692976 CCGCGGGGCCGGCGCCTGGCAGG - Intronic
1038424523 8:27455895-27455917 CCGCAGGGCTGGCTGCTGGGAGG - Intronic
1039844329 8:41315373-41315395 CCCCAGGGCTTGCACCGAGCAGG + Intergenic
1042063269 8:64845080-64845102 CAGCAGGGCTTGCAACTAGCAGG - Intergenic
1048833380 8:138497073-138497095 CCGCTGGGCTGGCGCCTCCCGGG + Intergenic
1049192790 8:141298031-141298053 CCGCAGGGCTGTCGCACAGCAGG - Intronic
1049266623 8:141671118-141671140 CCCCAGGGCAGGCCCACAGCGGG - Intergenic
1049354061 8:142179089-142179111 ACCCAGGCCTGGCCCCTAGCAGG - Intergenic
1049671607 8:143872567-143872589 CAGCAAGGCTAGCCCCGAGCCGG + Exonic
1050377256 9:4985569-4985591 CCGCAGGGGCGGCTCCTACCCGG - Exonic
1051674888 9:19548804-19548826 TCCCAGGGCTGGCCCTTGGCGGG - Intronic
1052864329 9:33455914-33455936 CTGCAGGGCCAGACCCTAGCAGG + Intergenic
1053210514 9:36223647-36223669 CCCCAGGGCTGGCCCAGACCAGG - Intronic
1053908214 9:42867269-42867291 ATGCAAGGCTGGCCCTTAGCTGG - Intergenic
1056090867 9:83204228-83204250 CCACAGGGTTGGCCACTAGATGG + Intergenic
1057305275 9:93908718-93908740 GTGCAGGGCTAGCCCATAGCAGG - Intergenic
1057906547 9:98987824-98987846 ACCCAGGGCTGGCACCCAGCAGG - Intronic
1059386775 9:113970902-113970924 CTGTGGGCCTGGCCCCTAGCAGG + Intronic
1060929409 9:127479518-127479540 CAGCCAGGCTGGACCCTAGCAGG - Intronic
1061782531 9:133004377-133004399 CTGTAGGGCAGGCCCCTGGCAGG + Intergenic
1062038426 9:134392982-134393004 CTGCAGAACTGGCCCCTAACAGG - Intronic
1203746502 Un_GL000218v1:43194-43216 CCGCAGTGCTGGCCCAGACCTGG + Intergenic
1190050408 X:47145158-47145180 GGCCAGGGCTGTCCCCTAGCGGG + Exonic
1191881137 X:65844671-65844693 CTGCAGTGCTGGCTGCTAGCAGG - Intergenic
1198360748 X:135892965-135892987 CCTCAGGGCTGCCACCGAGCAGG + Intronic
1199672656 X:150160044-150160066 CCACAGGGCATGCCCCTACCTGG + Intergenic
1201159832 Y:11158208-11158230 CCGCAGTGCTGGCCCAGACCTGG + Intergenic