ID: 1084696312

View in Genome Browser
Species Human (GRCh38)
Location 11:70757650-70757672
Sequence GTCCCCTCAAGGAGAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 261}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084696308_1084696312 1 Left 1084696308 11:70757626-70757648 CCTAGTGGGTGGGGAATGTGCTG 0: 1
1: 0
2: 1
3: 19
4: 183
Right 1084696312 11:70757650-70757672 GTCCCCTCAAGGAGAGAGGGAGG 0: 1
1: 0
2: 3
3: 13
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084696312 Original CRISPR GTCCCCTCAAGGAGAGAGGG AGG Intronic
900367037 1:2315538-2315560 GTGGGCTCACGGAGAGAGGGCGG - Intergenic
900595145 1:3477082-3477104 GGCCCATCCAGGAGGGAGGGTGG + Intronic
900918830 1:5658130-5658152 TTCCCCTGAAGGGCAGAGGGCGG - Intergenic
902545060 1:17184929-17184951 GTCCCCACAAGGACAGCTGGAGG + Intergenic
904040709 1:27583213-27583235 GTGGCCTCAAGGACATAGGGAGG - Intronic
904565494 1:31425924-31425946 GTCCCCACACGGAGGCAGGGTGG - Intronic
904676198 1:32200717-32200739 GCCCCCTGAGGGAGTGAGGGCGG + Intronic
905734796 1:40317435-40317457 CGCCCCTCGAGGACAGAGGGTGG - Intronic
907617278 1:55938037-55938059 GTTCCCACAAGGACAGAGGGTGG + Intergenic
910008084 1:82424816-82424838 CTCCACTGAAGGACAGAGGGTGG - Intergenic
912302946 1:108536114-108536136 GCCCCGTCAGGGAGAGAGGTGGG - Intergenic
915250271 1:154583129-154583151 GTCATCTAAAGGAGAGAGGCAGG + Exonic
915334724 1:155134433-155134455 GCCCCCTCCAGGAGAGAGCCAGG + Exonic
915554258 1:156652678-156652700 GGTCCCTCGAGGAGAGAGCGAGG + Exonic
915737667 1:158094980-158095002 GTCCGCTCCAGGCCAGAGGGTGG - Exonic
916773421 1:167936076-167936098 GCCCCCGGCAGGAGAGAGGGAGG + Intronic
918493210 1:185105233-185105255 ATACCCTCAAGGATAAAGGGGGG + Intergenic
919574259 1:199287259-199287281 GTACCTCAAAGGAGAGAGGGAGG - Intergenic
919938281 1:202269279-202269301 GCAGCTTCAAGGAGAGAGGGAGG + Intronic
920948346 1:210550552-210550574 TTCCCCTGCAGGAGAGAAGGGGG - Intronic
923054971 1:230419399-230419421 GACTCCTAAAGGAGGGAGGGAGG + Intronic
1069157796 10:65052277-65052299 GCCCCATCCAGGAGAGAGGTGGG + Intergenic
1070146285 10:73775867-73775889 CTCTCCTCAAGGAGAGATGGAGG + Exonic
1071594419 10:86908855-86908877 ATGCCCACAAGGAGAGAGGAAGG + Intronic
1074768729 10:116719423-116719445 ACCCCCTCAAGGACGGAGGGAGG - Intronic
1075207162 10:120457528-120457550 GTCCCAGGAAGGAGAGAGGAAGG - Intronic
1075280944 10:121137799-121137821 GTCACCTCAGGGAGACAGGCAGG - Intergenic
1076038423 10:127221457-127221479 GGCCTCTCCAGGTGAGAGGGTGG + Intronic
1076063626 10:127431360-127431382 CTCCCGTCAAGGAGAGACAGAGG - Intronic
1076912711 10:133399684-133399706 GTCCCCTCCAAGAAAGATGGTGG - Intronic
1077355590 11:2115310-2115332 GATCCCTCAAGGAAGGAGGGCGG - Intergenic
1078517105 11:12032054-12032076 GTCCCCTGAAGGACACAGAGTGG - Intergenic
1080750238 11:35144144-35144166 GTCCCCTGATGGAGAGGAGGTGG + Intronic
1081627461 11:44663978-44664000 GCCCCCTCCAGGAGGGAGGTGGG + Intergenic
1082115055 11:48319211-48319233 CTCCTATGAAGGAGAGAGGGAGG + Intergenic
1082258608 11:50060089-50060111 CTCCTATGAAGGAGAGAGGGAGG - Intergenic
1083225257 11:61280935-61280957 TCCCCCTGAAGGAGTGAGGGGGG + Exonic
1083741188 11:64712540-64712562 GGCCCCTGAAGGACAGTGGGTGG - Intronic
1084696312 11:70757650-70757672 GTCCCCTCAAGGAGAGAGGGAGG + Intronic
1087740266 11:101879456-101879478 GTATCCTTAAGGACAGAGGGAGG + Intergenic
1088368943 11:109067516-109067538 GTCCCCTCAAGCAGAGTTGTGGG - Intergenic
1089098123 11:115936740-115936762 CTCCCCTCTAGGAGAGAAGGAGG + Intergenic
1090789898 11:130082802-130082824 ATCCCCAGAAAGAGAGAGGGGGG + Intronic
1091027999 11:132159178-132159200 AGCCCCTCAAGGAGAGAGGGGGG - Intronic
1091727308 12:2855080-2855102 GCCCCATCCAGGAGGGAGGGGGG + Intronic
1091969223 12:4771950-4771972 GTCCCCTCAATAGGAGAGGCGGG + Intronic
1093894553 12:24562146-24562168 GTTTCCTCAAGTACAGAGGGAGG - Intergenic
1093936590 12:25008244-25008266 GTGTCCTGAAGGAGAGAGGCAGG + Intergenic
1096616102 12:52834389-52834411 ATCGCCCCAAGGGGAGAGGGAGG + Intergenic
1096752673 12:53771996-53772018 GTCCCCTCTGGGAGAGGAGGAGG - Intergenic
1097072487 12:56365392-56365414 CTCCCCTCAAGAAGATACGGAGG - Intergenic
1098221579 12:68275409-68275431 GTCCTTTCTAGGAGAGAAGGGGG + Intronic
1099255305 12:80307622-80307644 GTCCCATCCAGGAGGGAGGTGGG - Intronic
1102635048 12:114315990-114316012 GTCCCCACAAGAAGACAGTGAGG - Intergenic
1103261589 12:119593643-119593665 CTCCCCACAAGGAGGAAGGGAGG - Exonic
1104222280 12:126796590-126796612 GTCCTTACAAGGAGAAAGGGAGG - Intergenic
1104241056 12:126990041-126990063 GTCCCATAAGGCAGAGAGGGTGG + Intergenic
1104957256 12:132472931-132472953 GTCCCCTCCTGGAGAGGGCGTGG + Intergenic
1104957301 12:132473095-132473117 GTCCCCTCCTGGAGAGCGCGTGG + Intergenic
1104957338 12:132473215-132473237 GTCCCCTCCTGGAGAGGGCGTGG + Intergenic
1104957532 12:132473864-132473886 GTCCCCTCCTGGAGAGGGCGTGG + Intergenic
1104957590 12:132474068-132474090 GTCCCCTCCTGGAGAGGGCGTGG + Intergenic
1107968186 13:45615856-45615878 TTCCCCGCCAGGAGAGAGGCTGG - Intergenic
1108696207 13:52904623-52904645 GTGGCCTCAAGGCGAGAAGGAGG + Intergenic
1109426088 13:62167855-62167877 GTCCCCTCAAGTGTACAGGGAGG - Intergenic
1110248466 13:73354533-73354555 GACCCCAAAAGGAGGGAGGGAGG - Intergenic
1112314589 13:98350189-98350211 CTCCCCTCAAGCAGAGAGTCTGG + Intronic
1112314640 13:98350646-98350668 GTGCTCACGAGGAGAGAGGGAGG - Intronic
1113512576 13:110867840-110867862 GTGCCCTCATGGAGTGAGTGCGG - Intergenic
1114493846 14:23119330-23119352 GTCACCCCAAGGGGAGAGAGGGG - Exonic
1114650469 14:24281328-24281350 CTCCCCTCAGGGAGGAAGGGTGG + Intergenic
1115096044 14:29636770-29636792 GTCCCTTCAAGGTTGGAGGGTGG - Intronic
1115159833 14:30381217-30381239 GTCCCCTCAACAGCAGAGGGAGG - Intergenic
1115979246 14:39030800-39030822 GTCCTCACATGGAGAAAGGGAGG - Intergenic
1116845610 14:49862524-49862546 GTACCCTTAATGAGGGAGGGGGG + Intergenic
1119492636 14:75050276-75050298 GTCACCTCAGGGAAAGAGGCTGG + Intronic
1119637175 14:76283366-76283388 GTCCTTTTAAGGAGGGAGGGAGG + Intergenic
1119668324 14:76500008-76500030 CCCCCCTCAATGAGAGAGGCAGG + Exonic
1120071420 14:80107772-80107794 GTCCCTTCAAGGTGAGTGTGTGG + Intergenic
1121910098 14:97782212-97782234 TTCCCAGCAAGGAGTGAGGGAGG - Intergenic
1122342893 14:101039900-101039922 GTCTCCTCAAGGCGGGTGGGTGG - Intergenic
1122361076 14:101164565-101164587 GTGCCCTCAAGGAGGTAGAGCGG - Intergenic
1122546163 14:102524019-102524041 GTCCCCTCCAGGCCAGAGAGAGG - Intergenic
1122692232 14:103536831-103536853 GTCCGCACATGGAGAGCGGGAGG + Exonic
1122986169 14:105212667-105212689 GTCCCCCCAGGGAGACAGGGGGG + Intronic
1123121251 14:105918081-105918103 TTCCCCTGAAGGAGGGAGGAGGG + Intronic
1123880811 15:24676291-24676313 GTCTCCTCCAGGAGAGTGGCTGG - Exonic
1124054625 15:26230937-26230959 GTTCCCTCAGGGAGAGATGCGGG + Intergenic
1124104068 15:26721069-26721091 GTCCCCTCAGGGAGAGCTTGTGG - Intronic
1124161268 15:27271975-27271997 CTCCCCTCAAGGAGAGTCAGAGG - Intronic
1125688508 15:41578209-41578231 GTCCCCTCAATGAGACACAGAGG + Exonic
1127760892 15:62138083-62138105 GTCACCTCAAGGAAGGAGGCTGG - Intergenic
1129322517 15:74782745-74782767 GTCCCCTGGAGGGAAGAGGGTGG + Intronic
1129530164 15:76259031-76259053 GTCCCCTCAATGAGACACAGAGG - Intronic
1129839384 15:78734410-78734432 GTCCCCATAAGCAAAGAGGGAGG + Intergenic
1130342647 15:83012285-83012307 GCCCCCTAAATGGGAGAGGGTGG + Intergenic
1131132324 15:89908242-89908264 GGGCCCTGAGGGAGAGAGGGAGG + Intronic
1132099948 15:99015738-99015760 GTCCCCACAAGGAGAAGGGAAGG - Intergenic
1132637558 16:959787-959809 GTTCCCACTAGCAGAGAGGGAGG + Intronic
1134272526 16:12745664-12745686 GTCCGCTTAAGGCGGGAGGGTGG + Intronic
1136608249 16:31350974-31350996 GTCTCCAGAAGGGGAGAGGGAGG + Intergenic
1136672889 16:31873990-31874012 GTCCCCAGAGGGAGGGAGGGCGG + Intronic
1138203007 16:55104104-55104126 GGCCTCTCAAGGAGAGAGAAAGG - Intergenic
1138477168 16:57278452-57278474 GTCCCCTTAGGGACAGAGGTGGG + Intronic
1138536341 16:57662395-57662417 ATCCCCCCATGGAGAGATGGGGG + Intronic
1139467026 16:67159593-67159615 GGGCCCTGCAGGAGAGAGGGTGG - Intronic
1140250149 16:73288160-73288182 GTCACCCCATGGAGGGAGGGAGG + Intergenic
1140765828 16:78156166-78156188 ATTCTCTAAAGGAGAGAGGGTGG + Intronic
1141849102 16:86631827-86631849 TTCCCGTCAAAGAGAGAGAGAGG - Intergenic
1142260378 16:89040000-89040022 GGCCCCTCGGGGAGACAGGGTGG - Intergenic
1144131838 17:12253902-12253924 TTCCCCTCATGCAGTGAGGGAGG + Intergenic
1145263590 17:21368893-21368915 GGCTCCTCAAGGGCAGAGGGAGG - Intergenic
1147559679 17:41501176-41501198 GTTCCCTGCAGGAGAGAGGAGGG - Exonic
1147794043 17:43030112-43030134 GTCCCTTAAAGGAAAGACGGTGG + Intergenic
1148796388 17:50199324-50199346 GTCCCTGCAGGGGGAGAGGGCGG + Exonic
1149625070 17:58074348-58074370 GCCCCCTCCAGGAGGGAGGTGGG - Intergenic
1151352975 17:73542589-73542611 GTCCCCTCAACGAGGAGGGGTGG + Intronic
1155522886 18:26686775-26686797 GTCCCCTCACAGTAAGAGGGGGG + Intergenic
1155554121 18:26998896-26998918 GTCCCCTGAGGGAAAGAGCGTGG - Intronic
1157786178 18:50485038-50485060 GTCTTCTCCAGTAGAGAGGGAGG + Intergenic
1159241996 18:65753078-65753100 GTCCAATGAAGAAGAGAGGGTGG + Intronic
1160236587 18:77090621-77090643 GTCCCACCAAGGAGAGAGCATGG - Intronic
1160943698 19:1631598-1631620 GGCCCCCCAGGGAAAGAGGGCGG + Intronic
1162292305 19:9789344-9789366 GTCCCCTCACCGAGTGAAGGGGG + Intronic
1164707570 19:30331825-30331847 GTCCCCTGCAGGGGACAGGGAGG - Intronic
1165636596 19:37345477-37345499 ATACCCTCAAGGAGTGATGGAGG + Intronic
1165749967 19:38253517-38253539 GGCCCCTCAAGGTGGGTGGGTGG + Intronic
1166702583 19:44890924-44890946 GCCTCCTCCAGGAGAGAGGCGGG + Intronic
1168634417 19:57984474-57984496 GTCCCCTCCATTAGAGTGGGTGG + Intronic
927877166 2:26665549-26665571 GCCCCATCAGGGAGAGAGGTGGG - Intergenic
928272005 2:29864918-29864940 GTGCCCTTCAGGGGAGAGGGTGG - Intronic
929305471 2:40356205-40356227 ATACCCTCAAGGAGGGAGGCAGG - Intronic
930000539 2:46858685-46858707 GGTCCCTCAAGGCTAGAGGGTGG - Intronic
931173036 2:59824967-59824989 GTCTCCTCCAGGAGAGAGAGGGG - Intergenic
931460196 2:62443596-62443618 GTTCAGTCAAGGAGAGAGAGAGG + Intergenic
931794993 2:65700478-65700500 GCCCCCTCAAGGAGAGGAAGGGG - Intergenic
932318427 2:70801958-70801980 CTCCCCTGAAGGAGAGAAGGGGG + Intergenic
932626399 2:73299701-73299723 TTCTCCTACAGGAGAGAGGGAGG + Intergenic
932880253 2:75494622-75494644 GTCCCCTCAAGACTAGATGGAGG - Intronic
934928921 2:98404439-98404461 CTCTCCTCAAGAAGAGAGAGAGG - Intergenic
934951159 2:98576610-98576632 GATCCCTCAGGGAAAGAGGGCGG - Intronic
936153710 2:110035315-110035337 GTGTGCCCAAGGAGAGAGGGTGG - Intergenic
936190975 2:110336100-110336122 GTGTGCCCAAGGAGAGAGGGTGG + Intergenic
937871478 2:126789275-126789297 GTGGCCTACAGGAGAGAGGGTGG - Intergenic
938757211 2:134391853-134391875 GGCCTCTCCAGGAGGGAGGGTGG + Intronic
939900961 2:147848649-147848671 GTCTACTCAAGGATGGAGGGTGG + Intronic
940013144 2:149075997-149076019 GGCCAATCTAGGAGAGAGGGAGG + Intronic
941067563 2:160920508-160920530 GTCCCCGGAAGGAGAGAGGTGGG + Intergenic
942338982 2:174922987-174923009 GTTACCTCAAGGAAAGTGGGTGG + Intronic
942396968 2:175560455-175560477 GTTCCCTAAAGGAGAGACTGCGG + Intergenic
942425959 2:175861095-175861117 GTTCCCTCTAGAAGAGATGGTGG + Intergenic
942738188 2:179140444-179140466 GTCAAGTCAAGGAGAGAGGCTGG + Intronic
944850455 2:203713991-203714013 GTTTTCTCAAGGAGATAGGGAGG + Intronic
945178098 2:207064023-207064045 GTCCCCTTAGAGAGAGATGGGGG + Intergenic
945330914 2:208538044-208538066 GTCTACTAAAGGAGAGAGAGAGG + Intronic
946240133 2:218348941-218348963 GCCCCATCAGGGAGGGAGGGGGG - Intergenic
947577593 2:231288660-231288682 GTCCCCTGAAGGAGTGACTGCGG + Intronic
947637352 2:231686777-231686799 GTGCCTACAAGGAGAAAGGGAGG - Intergenic
948177838 2:235958231-235958253 GTCCCCTGAGGGAGAGTGGTTGG + Intronic
948236665 2:236396204-236396226 CTCCGCTCTAGGAGAGAGTGGGG - Intronic
948774610 2:240277455-240277477 CTCTCCTCAAGGAGAGAAAGAGG - Intergenic
948872673 2:240811602-240811624 CTCCCCTCAAAGACAGAGAGGGG + Intronic
1169078344 20:2776951-2776973 GTCCCTTTAAGAAGAGAGAGAGG - Intergenic
1170103656 20:12729774-12729796 GTCCCCACAAGGAGGCAGGTGGG - Intergenic
1171861390 20:30405387-30405409 GCCCCCTCCAGGAGGGAGGTGGG + Intergenic
1172092787 20:32445873-32445895 CTCCCCCCAAGGAGGGATGGGGG - Exonic
1172667941 20:36613759-36613781 GTGCACTCAGGGAGGGAGGGTGG - Exonic
1172736034 20:37126509-37126531 GCCCCCTCCAGGAGGGAGGAGGG + Intronic
1174073987 20:47919140-47919162 AGCCTCTCAGGGAGAGAGGGAGG + Intergenic
1174384106 20:50176507-50176529 GACCCCTCAAGAGGAAAGGGTGG - Intergenic
1174538500 20:51271164-51271186 CTCCCATCAAGGAGATTGGGGGG + Intergenic
1174592956 20:51660943-51660965 GTCCCCTTATGGAGGGAGGGAGG + Intronic
1175234263 20:57499058-57499080 GTCCCCTGAAGGTGACGGGGGGG + Intronic
1175256668 20:57652141-57652163 GTCCCCTCCAGCAAGGAGGGCGG + Exonic
1175394444 20:58649424-58649446 GTCCCCTAAAGGGGGGAGCGGGG + Intergenic
1175720330 20:61281745-61281767 GTCCCCTCCAGGGGAGGAGGTGG - Intronic
1176202149 20:63865899-63865921 GTTGCCTCATGGAGAGGGGGTGG + Intronic
1176267577 20:64218630-64218652 GTCCCCTAGAGGAGGGTGGGTGG + Intronic
1177942585 21:27429630-27429652 ATCCTCTCAAGGAGAGAGCTGGG - Intergenic
1179534289 21:42041258-42041280 GTCCCTTGAAGGAGAGAGGCAGG + Intergenic
1179664230 21:42899071-42899093 GGCCCGTCAAGGACAGAGGCAGG - Intronic
1179770148 21:43609271-43609293 GACTCCAAAAGGAGAGAGGGAGG + Intronic
1180695392 22:17748703-17748725 GCCCCCTCAGTGAGGGAGGGTGG - Intronic
1182436568 22:30334606-30334628 TGGCCCTCAAGGAGAGAGGCGGG - Exonic
1183073147 22:35410314-35410336 GGCCCCTCAAGGAGGCTGGGGGG + Intronic
1183617807 22:38955694-38955716 GTCCCCACTAGCAGAGAGGGAGG - Intronic
1184092574 22:42300203-42300225 GTTCCCCCAAGGAGAGCGGCAGG + Intronic
1184500349 22:44867852-44867874 TTTCCTTCTAGGAGAGAGGGCGG + Intergenic
1184819012 22:46894655-46894677 GAATCCTCAAGGAGAGAGCGGGG + Intronic
1185159354 22:49213593-49213615 GTCCCATCTAGGGGAGAGGTGGG - Intergenic
949538455 3:5013569-5013591 GTCCACTTATGGAGGGAGGGAGG - Intergenic
950681494 3:14588359-14588381 GTCCAGAGAAGGAGAGAGGGTGG - Intergenic
952328602 3:32343050-32343072 GTCACCTCAGCGAGAGAGGAAGG + Intronic
955429571 3:58828639-58828661 GACTGCTAAAGGAGAGAGGGAGG + Intronic
955615617 3:60803758-60803780 TTCCCCTCAAAGAGGGAGAGGGG + Intronic
961133095 3:124487101-124487123 GCCCCCTCGAGGAGAGAGTATGG + Intronic
961312820 3:126014657-126014679 GTCCCCTAAGGGAGCAAGGGAGG + Intronic
961477584 3:127158308-127158330 GTGACCTCAGGGACAGAGGGCGG - Intergenic
963400477 3:144791150-144791172 TTCCCCTCCTGGAGCGAGGGAGG - Intergenic
972288281 4:37668986-37669008 GCCCCATCCAGGAGAGAGGTGGG + Intronic
972468836 4:39384480-39384502 CTCTCCTCAAGTAGAGAGAGAGG + Intergenic
973744202 4:53947227-53947249 TTCCAGTGAAGGAGAGAGGGTGG - Intronic
974884499 4:67801839-67801861 GTCCACTCAAGGGTGGAGGGTGG + Intergenic
980878929 4:138689787-138689809 GACCCCTGCAGGAGAGAGGCGGG + Intergenic
981007232 4:139888477-139888499 CTACCCTGAAGGAGAGAGTGGGG - Intronic
982192023 4:152866597-152866619 GCCCCGTCCAGGAGAGAGGTGGG - Intronic
985173160 4:187173784-187173806 GTACCCTGGAGGAGAGAGTGAGG - Intergenic
985621364 5:957839-957861 GTGCCCTCAAGAGGAGTGGGTGG - Intergenic
987634347 5:20520292-20520314 GTCCCTTGAAAGAGAAAGGGAGG + Intronic
993452725 5:88092517-88092539 GTCCTCTATAGGACAGAGGGTGG - Intergenic
994044271 5:95290633-95290655 GTGGCCAGAAGGAGAGAGGGAGG + Intergenic
994171315 5:96662332-96662354 GTCCTGCCAGGGAGAGAGGGAGG - Exonic
995036842 5:107543947-107543969 GTCCCCTCACGGAGTTAGGGAGG - Intronic
995117495 5:108498434-108498456 GTCTCCAAAAGGAGAGATGGAGG - Intergenic
997981200 5:138468208-138468230 TTCCACTCCAGTAGAGAGGGAGG - Exonic
998053720 5:139056625-139056647 GCCCCATCAAGGAGGGAGGTGGG + Intronic
998128676 5:139640287-139640309 GTCCCCTCCAGGAAGGTGGGAGG + Intergenic
999895928 5:156033388-156033410 GACGCCAAAAGGAGAGAGGGTGG - Intronic
1000941601 5:167368924-167368946 CCCCCAGCAAGGAGAGAGGGAGG + Intronic
1001154527 5:169261739-169261761 GCCCACTCAAGGAGAGGGGAAGG - Intronic
1001379363 5:171293450-171293472 GGCCCCTCTTGGAGAGAGGGAGG - Intronic
1001665789 5:173432814-173432836 GTCCCCTCAGGGAGAGGGCAAGG - Intergenic
1002639051 5:180621995-180622017 GGCCCCTCCAGGAGAGAGGGAGG - Intronic
1002685495 5:181005990-181006012 GCTCCCTAAAGGAGAGTGGGGGG - Exonic
1005063467 6:21797254-21797276 GCCCCGTCCGGGAGAGAGGGAGG - Intergenic
1005504662 6:26459217-26459239 ATCCCCTCAAGGGCACAGGGTGG + Intronic
1006149034 6:31976270-31976292 GCCCCCTCCAGGAGGGAGGTGGG - Intronic
1006327131 6:33362825-33362847 CTCCCCTCAAAGACAGAGAGAGG - Intergenic
1008405685 6:51116311-51116333 TTCCCATTAAGGAGAGATGGTGG + Intergenic
1011749751 6:90443147-90443169 GTTCCCTCAAAGAGAGTGGCAGG + Intergenic
1019139450 6:169934304-169934326 GTTCCCTAAAGGAGACAGCGCGG - Intergenic
1019701636 7:2477129-2477151 GGGCCCTCAAGGAGGAAGGGAGG + Intergenic
1020567208 7:9812541-9812563 CTCCCCACAAGGAAAGAGGAGGG + Intergenic
1021532787 7:21667560-21667582 ATCCCCACAATGAGAGATGGAGG + Intronic
1022253914 7:28636445-28636467 TTGCCCTCAAGGAGGGAGGCAGG - Intronic
1022813550 7:33892465-33892487 ATCCCCTCAAGGAGACTGAGAGG - Intergenic
1023032378 7:36101780-36101802 GTAGCCTCAAGGAGAGGGAGAGG - Intergenic
1023941250 7:44769460-44769482 GTTCCCTCATCCAGAGAGGGCGG - Exonic
1024047542 7:45595421-45595443 GTCCTCACAGAGAGAGAGGGAGG - Intronic
1024862042 7:53855739-53855761 GACACCTGAATGAGAGAGGGAGG + Intergenic
1025564994 7:62423566-62423588 ATTCCGTCAAGGAGAGAGAGTGG - Intergenic
1026121948 7:67545464-67545486 TTCTCTTGAAGGAGAGAGGGAGG - Intergenic
1026929390 7:74215466-74215488 GTCACCTCCAGGAGCCAGGGTGG + Intronic
1026982529 7:74535235-74535257 CTCCCCTCAGGCAGGGAGGGAGG + Intronic
1028900367 7:96092668-96092690 GTCCACTCAGGCAGAGAGGAGGG + Intronic
1029351372 7:100015519-100015541 GTCCTCTCTAGGAGCGCGGGAGG - Intergenic
1029522915 7:101075603-101075625 GATCCCTCAAGGAGGGAGTGTGG + Intergenic
1034683495 7:152949101-152949123 GACCCCTCACTGAGAGAGTGAGG - Intergenic
1035363622 7:158330333-158330355 GTCACCTCAGGGTGAGAGTGTGG - Intronic
1036644921 8:10607080-10607102 GACCCCTCATGCAGAGAGGAAGG - Exonic
1039245749 8:35606575-35606597 GTCTACTCGAGGGGAGAGGGTGG - Intronic
1039661747 8:39475863-39475885 GTCCTCTCAAGGGGAGTGGCTGG + Intergenic
1040808670 8:51424943-51424965 GGCCCCACCAGGTGAGAGGGCGG + Intronic
1046744272 8:117860342-117860364 GACTCCTCAAGGTGGGAGGGTGG + Intronic
1047213623 8:122859439-122859461 TTCCCCTCCAGGATTGAGGGAGG - Intronic
1048236169 8:132692805-132692827 CTCCCCTCAGGGAAACAGGGAGG - Intronic
1051090144 9:13397222-13397244 GCTCCCTAAAGGAGAGAGGCAGG - Intergenic
1051346033 9:16152043-16152065 GTCCCCACATTGAGAGAGGATGG - Intergenic
1053307525 9:36995000-36995022 GTCCCCTCATGTAGAGAGGTGGG - Intronic
1054717264 9:68568528-68568550 GTCACCTCATGGAGAGAAGATGG - Intergenic
1057101465 9:92364841-92364863 GTCTACTCTAGGGGAGAGGGAGG + Intronic
1058537301 9:105975364-105975386 GTGCCCTCAAGGACAATGGGTGG + Intergenic
1061791953 9:133063677-133063699 GTTCCGTCAGGGACAGAGGGTGG + Intronic
1062084482 9:134641740-134641762 CTGCCTTCCAGGAGAGAGGGAGG + Intergenic
1185957913 X:4512456-4512478 GACCACTCAGGGATAGAGGGAGG + Intergenic
1186948602 X:14596987-14597009 GCCCACACATGGAGAGAGGGAGG - Intronic
1190217590 X:48490282-48490304 GCGCCCACAGGGAGAGAGGGAGG - Intergenic
1190500873 X:51077244-51077266 GTCACCTCAAGGAGTGAGGGTGG - Intergenic
1190681606 X:52831084-52831106 GTCCCCCCAAGAGGACAGGGAGG - Intergenic
1190763264 X:53454163-53454185 GTCTCCAAAAGGAGAGAGTGAGG - Intergenic
1191637428 X:63393382-63393404 GCCCCCTCCAGGAGGGAGGTTGG + Intergenic
1192552400 X:72064800-72064822 GTTCTATCAAAGAGAGAGGGAGG - Intergenic
1196664262 X:118299774-118299796 GGCCCATTAAGGAGAGAGAGAGG + Intergenic
1199153003 X:144511438-144511460 GACCCCAAAAGGGGAGAGGGTGG + Intergenic
1199595407 X:149502974-149502996 GTACCCTGCAGGGGAGAGGGTGG + Intronic
1199598472 X:149526239-149526261 GTACCCTGCAGGGGAGAGGGTGG - Intronic
1200144703 X:153920638-153920660 GCTCCCTCAAGAAGGGAGGGAGG - Exonic
1202070324 Y:20985464-20985486 TTCCCCTGATGGAGACAGGGAGG - Intergenic