ID: 1084697103

View in Genome Browser
Species Human (GRCh38)
Location 11:70762353-70762375
Sequence GCTGTCGGTTAGTGGCATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 36}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084697091_1084697103 28 Left 1084697091 11:70762302-70762324 CCCAAGTGTCCTGGCTGGAGACA 0: 1
1: 0
2: 3
3: 22
4: 203
Right 1084697103 11:70762353-70762375 GCTGTCGGTTAGTGGCATCCAGG 0: 1
1: 0
2: 0
3: 1
4: 36
1084697092_1084697103 27 Left 1084697092 11:70762303-70762325 CCAAGTGTCCTGGCTGGAGACAG 0: 1
1: 0
2: 5
3: 28
4: 294
Right 1084697103 11:70762353-70762375 GCTGTCGGTTAGTGGCATCCAGG 0: 1
1: 0
2: 0
3: 1
4: 36
1084697100_1084697103 -4 Left 1084697100 11:70762334-70762356 CCTGGGTGGGTACTGTCAGGCTG 0: 1
1: 0
2: 2
3: 13
4: 159
Right 1084697103 11:70762353-70762375 GCTGTCGGTTAGTGGCATCCAGG 0: 1
1: 0
2: 0
3: 1
4: 36
1084697099_1084697103 -3 Left 1084697099 11:70762333-70762355 CCCTGGGTGGGTACTGTCAGGCT 0: 1
1: 0
2: 1
3: 18
4: 153
Right 1084697103 11:70762353-70762375 GCTGTCGGTTAGTGGCATCCAGG 0: 1
1: 0
2: 0
3: 1
4: 36
1084697093_1084697103 19 Left 1084697093 11:70762311-70762333 CCTGGCTGGAGACAGAAGTTCTC 0: 1
1: 0
2: 0
3: 20
4: 236
Right 1084697103 11:70762353-70762375 GCTGTCGGTTAGTGGCATCCAGG 0: 1
1: 0
2: 0
3: 1
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084697103 Original CRISPR GCTGTCGGTTAGTGGCATCC AGG Intronic
910590340 1:88923392-88923414 GCTGTCGGGGGGTGGCTTCCTGG - Intergenic
915191760 1:154156634-154156656 GCTTTGGGTTTGTGGCACCCTGG - Intronic
920052621 1:203172843-203172865 GCAGTTGGTTGGTGGCATGCAGG + Intronic
921511368 1:216034669-216034691 TCTGTCAGTCAGTGGTATCCTGG - Intronic
1076995627 11:296263-296285 GCTGTGGGTCAGGGGCAGCCTGG + Intergenic
1081835400 11:46149461-46149483 GCTGACCGCTAGTGGCACCCTGG + Intergenic
1082131093 11:48490510-48490532 GTGGTCAGTTAGTTGCATCCAGG + Intergenic
1082564591 11:54661374-54661396 GTGGTCAGTTAGTTGCATCCAGG + Intergenic
1084697103 11:70762353-70762375 GCTGTCGGTTAGTGGCATCCAGG + Intronic
1095184592 12:39186953-39186975 TCTGTCGGTCAGTGGCCTGCCGG - Intergenic
1102026042 12:109714732-109714754 GCTGTCGGTGAGGGCTATCCTGG - Exonic
1119756953 14:77126079-77126101 TCAGTCAGTAAGTGGCATCCTGG - Intronic
1120589455 14:86358065-86358087 GCTGTGGGTTCCTGGCAGCCCGG - Intergenic
1125678125 15:41513253-41513275 GGAGTCGGGTAGTGGCTTCCAGG - Intronic
1140066817 16:71618464-71618486 GCTGTCAGTCAGTGTCATCGTGG - Intergenic
1142203590 16:88772380-88772402 GCTGTTGGTTATTGGCACCTGGG - Intronic
1149683052 17:58518781-58518803 TCTGTCGGTTGGTGGTATCGCGG - Intergenic
1150705847 17:67486738-67486760 GCAGACAGTTAGGGGCATCCAGG + Intronic
1154334763 18:13456503-13456525 GATGTGGGTTAGAGGAATCCAGG - Intronic
1156747362 18:40408301-40408323 GCTATTGGTTAGTGGCATGCTGG + Intergenic
1157147666 18:45181135-45181157 GCAATCGGTTGGTGGCATCTGGG - Intergenic
1163698071 19:18774042-18774064 GCTGTGGGGCAGTGGCTTCCTGG + Intronic
935580921 2:104755329-104755351 GCTGTGGGACAGTTGCATCCTGG - Intergenic
946786510 2:223251086-223251108 GCTGTCAGTTGGTGGGATCAGGG - Intergenic
947491893 2:230602650-230602672 GCTGGGGGTTGGTGGCCTCCTGG - Intergenic
1173225937 20:41162530-41162552 GCTGACGGTAAGTGCCACCCAGG + Exonic
955475365 3:59330552-59330574 GCTGTCTGTTGGTGGGACCCAGG + Intergenic
981601605 4:146495216-146495238 GTGGAAGGTTAGTGGCATCCTGG - Intronic
1008506512 6:52236108-52236130 GCTCTGAGTTAGTGGCATGCTGG + Intergenic
1019213265 6:170423169-170423191 GCTGTCGGTGAAAGGCAGCCCGG + Intergenic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1035143173 7:156784922-156784944 GATGTCTGTTAGTGGAGTCCTGG - Intronic
1059739162 9:117132855-117132877 GCTGTAGATTTGTTGCATCCTGG - Intronic
1061618696 9:131796756-131796778 GCTGTCGGTGGGGGGCCTCCTGG - Intergenic
1190594222 X:52037031-52037053 GATGTAGGTTATTGGCATGCAGG - Intergenic
1192214485 X:69149211-69149233 CCTCTCGGTTAGTGGCAGCAGGG + Intergenic
1201786329 Y:17785557-17785579 GCTGTTGTTTCATGGCATCCAGG - Intergenic
1201815224 Y:18120431-18120453 GCTGTTGTTTCATGGCATCCAGG + Intergenic