ID: 1084697735

View in Genome Browser
Species Human (GRCh38)
Location 11:70765830-70765852
Sequence ATGTCATTCAAGAAAAGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 264}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084697735_1084697737 12 Left 1084697735 11:70765830-70765852 CCAACACTTTTCTTGAATGACAT 0: 1
1: 0
2: 0
3: 20
4: 264
Right 1084697737 11:70765865-70765887 ATCCTGAACTGCTCTGAAATTGG 0: 1
1: 0
2: 0
3: 12
4: 140
1084697735_1084697741 25 Left 1084697735 11:70765830-70765852 CCAACACTTTTCTTGAATGACAT 0: 1
1: 0
2: 0
3: 20
4: 264
Right 1084697741 11:70765878-70765900 CTGAAATTGGGAGGAAGTAGAGG 0: 1
1: 0
2: 4
3: 28
4: 410
1084697735_1084697740 16 Left 1084697735 11:70765830-70765852 CCAACACTTTTCTTGAATGACAT 0: 1
1: 0
2: 0
3: 20
4: 264
Right 1084697740 11:70765869-70765891 TGAACTGCTCTGAAATTGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 129
1084697735_1084697738 13 Left 1084697735 11:70765830-70765852 CCAACACTTTTCTTGAATGACAT 0: 1
1: 0
2: 0
3: 20
4: 264
Right 1084697738 11:70765866-70765888 TCCTGAACTGCTCTGAAATTGGG 0: 1
1: 0
2: 1
3: 13
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084697735 Original CRISPR ATGTCATTCAAGAAAAGTGT TGG (reversed) Intronic
902128483 1:14238012-14238034 ATGTCATTGAAAAAAATTGGAGG - Intergenic
902900666 1:19513555-19513577 ATGTTATTGAAGAACAGTGGAGG - Intergenic
904837286 1:33347546-33347568 ATGTCAGTAAAGAACAGTTTGGG + Intronic
909005406 1:70270274-70270296 ATTTCACACAAGAAAAGTGTGGG - Intronic
909531542 1:76687482-76687504 CTGCCATTCAAGGAAAGTGGTGG - Intergenic
909735802 1:78960455-78960477 AAGTCACTCAATAAGAGTGTCGG - Intronic
909912511 1:81278338-81278360 ATGCCAGTCAAGAAATGGGTTGG + Intergenic
910611466 1:89147775-89147797 GTGTCCTGCCAGAAAAGTGTAGG + Exonic
913407477 1:118511667-118511689 AAGACAATCAATAAAAGTGTTGG - Intergenic
916242054 1:162650164-162650186 TTGGCATTCAAGAGAAGGGTTGG - Intronic
916365321 1:164020638-164020660 AAGTCATCAAAGAAAAGTGCAGG + Intergenic
916909750 1:169334282-169334304 ATGTCATTCAAGGTGAATGTGGG - Intronic
917059663 1:171023067-171023089 ATGTCAGTCTTGGAAAGTGTTGG - Intronic
917255517 1:173111737-173111759 ATGTTCTACAAGAAAAGTATGGG + Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
919676604 1:200389765-200389787 ATGTCAGCCAAGAGAAGTGGTGG - Intergenic
920190011 1:204187714-204187736 AAATCATTCAGGAAAAGGGTTGG + Intergenic
921615319 1:217259583-217259605 AGATCATTCAAGGAAGGTGTGGG - Intergenic
922759018 1:228113558-228113580 ATGTCCTTTTAGAAAAGTGAAGG + Intergenic
1064041530 10:11969468-11969490 ATGTCATTAAAAAAAAGTTCTGG - Intronic
1065251541 10:23820323-23820345 ATGGCATTAAACAAAATTGTTGG - Intronic
1065672713 10:28138666-28138688 AGGTTATACAAGAAAAGTGTTGG + Intronic
1068545405 10:58339033-58339055 ATGTCAGTCTAGAAAACTTTAGG + Intronic
1070685554 10:78477720-78477742 TTGTCATTCAAGATAAGGGCTGG + Intergenic
1070928451 10:80242111-80242133 ATGTAATTCAAGAAAGAAGTGGG + Intergenic
1075186435 10:120263284-120263306 AGGCCATTCTAGAAAACTGTGGG + Intergenic
1075833628 10:125433198-125433220 TTGTCTTTCAAGAAACTTGTAGG - Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078568850 11:12440291-12440313 ATGTCATCACAGATAAGTGTAGG + Intronic
1078975113 11:16465161-16465183 AAGTCAGACATGAAAAGTGTGGG - Intronic
1080372386 11:31666256-31666278 ATCTCAGCCTAGAAAAGTGTTGG + Intronic
1080526104 11:33121065-33121087 TTTTCATTCAAGAAAAGTAATGG - Intronic
1081004744 11:37721577-37721599 GTTTCATTCAAGAGAATTGTAGG - Intergenic
1081114958 11:39189160-39189182 AGGTCATTGAAGAAAACTTTGGG - Intergenic
1081161113 11:39749585-39749607 AAATGATTCAAGAAAAATGTAGG + Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1082818428 11:57526446-57526468 ATTTCATTCAACAATATTGTTGG - Intergenic
1084697735 11:70765830-70765852 ATGTCATTCAAGAAAAGTGTTGG - Intronic
1085364952 11:75932084-75932106 ATGTCATTCAAAAAGAAGGTTGG - Intronic
1085914110 11:80863972-80863994 TTGTAATTCAAGAAAAGAGATGG - Intergenic
1086829077 11:91536811-91536833 AAGTAATTCAAGAAAAGTAAGGG + Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087589359 11:100166455-100166477 ATATTATTCAAGGTAAGTGTTGG + Intronic
1088128110 11:106452891-106452913 GTGTTATTGAAGAAACGTGTAGG - Intergenic
1088145860 11:106676948-106676970 CTGTCAGTCAAGAGAAATGTGGG - Intronic
1088544479 11:110945929-110945951 ATGTCACCTAAGAAAAGTGGGGG - Intergenic
1089051215 11:115547758-115547780 ATGTCATTCAGAAAAAGTCCAGG + Intergenic
1089902255 11:121999384-121999406 ATGCCTTTCAAGAAAAGAGAAGG + Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1093006357 12:14055447-14055469 ATTTCATTCAGGAGAAGTCTGGG + Intergenic
1093611003 12:21157224-21157246 ATGTGATACAATAAAAGTGAAGG - Intronic
1094152118 12:27296473-27296495 ATGTCAAGCAAGTCAAGTGTAGG - Intronic
1095305251 12:40630956-40630978 ATGCTATTCGAGACAAGTGTTGG + Intergenic
1095455933 12:42385774-42385796 AAGTCCTTCAAGAAAAGGGTAGG - Intronic
1096023962 12:48345361-48345383 ATGTCATGCAGGAAAACTGTGGG - Exonic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097551834 12:61081547-61081569 TTTTCATTCGAAAAAAGTGTGGG + Intergenic
1097685414 12:62686505-62686527 ATGGCATTCAAAAAGAGAGTTGG + Intronic
1098443795 12:70545808-70545830 ATGTCACTCAAGAGAACAGTGGG + Intronic
1099375615 12:81893705-81893727 AGGTCATTCAATAAATGGGTGGG - Intergenic
1100456953 12:94761228-94761250 ATGTTATTAAAGAAAAAGGTAGG + Intergenic
1100957037 12:99920360-99920382 ACGACATTCAAGACAAGTGAAGG + Intronic
1101065631 12:101017390-101017412 CTATGATTCAAGAAGAGTGTGGG + Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101852933 12:108418732-108418754 CTGTCATTCGATAAAAGTGTTGG + Intergenic
1102690420 12:114756208-114756230 ATGTCATCTGATAAAAGTGTTGG - Intergenic
1103493070 12:121338287-121338309 ATGTCATTATAGAAAATTATTGG + Intronic
1104339953 12:127939139-127939161 ACGTCTTCCATGAAAAGTGTTGG + Intergenic
1107162281 13:37244715-37244737 AGGTCATTCGAGATTAGTGTGGG - Intergenic
1107207714 13:37814663-37814685 ATGTCATTGAAGGAAATTATAGG + Intronic
1107820753 13:44283302-44283324 ATGGCATTTAAGAAAATTTTAGG - Intergenic
1108416043 13:50199184-50199206 AGGTCAATAAAGAAAAGTGAAGG - Intronic
1108432279 13:50366336-50366358 ATTTCATTCAAGCAAACAGTTGG - Intronic
1108863620 13:54894724-54894746 AATTCTTTCAAGAAAAGTTTAGG - Intergenic
1109764478 13:66875923-66875945 CTGTCTTTCAAGAGAAGGGTAGG - Intronic
1109890561 13:68606932-68606954 ATCTTATTTAAGAAAATTGTTGG + Intergenic
1110678743 13:78282890-78282912 GTGTCATTTAAGAAAAGTCTAGG + Intergenic
1112418320 13:99224250-99224272 ATGTCTTTTAAGAAAAGGGAGGG - Intronic
1115181652 14:30633658-30633680 TTCTCATTCAAGGAGAGTGTTGG + Intronic
1116234949 14:42268088-42268110 ATGCCCTTCTAGAAAAGTGAAGG + Intergenic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1118033466 14:61840633-61840655 ATGTCATAAAGCAAAAGTGTAGG + Intergenic
1118158182 14:63262094-63262116 ATGGCTTTCAAGAGAAATGTTGG - Intronic
1118561427 14:67087468-67087490 ATGTCAGACAAGCAAAGTGGTGG - Intronic
1118867740 14:69716689-69716711 ATGTCATTCAAGCCAGGTCTTGG - Intergenic
1120046274 14:79810319-79810341 AGGACATTTAAGAAAAGTGAAGG - Intronic
1120735116 14:88044013-88044035 TTTTTATTAAAGAAAAGTGTTGG + Intergenic
1124138998 15:27060995-27061017 GTGTCACTCAGGAAAATTGTAGG - Intronic
1124901703 15:33829446-33829468 ATGTCATTAAAAAACATTGTGGG + Intronic
1127685374 15:61338391-61338413 CTGTCCTTAAGGAAAAGTGTGGG + Intergenic
1128993986 15:72283285-72283307 ATGTTTGTCAAGAAAAGTATAGG + Intronic
1130863433 15:87910840-87910862 ATGTCATTCAACAATAGTTCAGG + Intronic
1130874411 15:88000064-88000086 GTGATATTCAAGAAATGTGTAGG + Intronic
1133836924 16:9375781-9375803 ATGTCATAAAAGTAAAGAGTAGG - Intergenic
1133954984 16:10434719-10434741 ATGTTATTCAAGAAGAAGGTTGG + Intronic
1134408907 16:13986961-13986983 ATGTCATTAGAAAAAACTGTAGG - Intergenic
1134446257 16:14333536-14333558 ATGTCATGGAAGAAAAGGGTAGG - Intergenic
1135297767 16:21297738-21297760 ATGTAATTACAGAACAGTGTGGG + Intronic
1137477867 16:48826250-48826272 CTGTCTTTGATGAAAAGTGTTGG - Intergenic
1138292654 16:55861224-55861246 AGGTAATTTAAGAAAATTGTTGG - Intronic
1140745116 16:77974345-77974367 ATGGCTTTCAAGAAAATAGTTGG + Intronic
1140923397 16:79560225-79560247 ATTTCATTTAAGAATACTGTTGG - Intergenic
1142050385 16:87954381-87954403 ATGTCACTTAAAAAAAGTGTTGG + Intronic
1146623797 17:34420758-34420780 ATGGCATTTAAGAGATGTGTGGG - Intergenic
1149355476 17:55834961-55834983 AGGTCATTCTAGAATAGGGTGGG + Intronic
1149415296 17:56453424-56453446 ATTTAATTCAAGAATAGTTTGGG - Intronic
1150605155 17:66684527-66684549 ATGTCATTGAAGCAAATAGTGGG - Intronic
1152353011 17:79793707-79793729 TTGTTTTGCAAGAAAAGTGTTGG - Exonic
1154039850 18:10844116-10844138 CTGTCATTTAATAAAGGTGTGGG + Intronic
1154178699 18:12109915-12109937 TTGTCATTCAATAAAAGAATAGG + Intronic
1155504743 18:26522209-26522231 AGGTCATACAAGAATAGGGTGGG + Intronic
1155995140 18:32323296-32323318 ATGTTGGTCAAGAAATGTGTGGG + Intronic
1156339005 18:36194516-36194538 AGGTCATTCCACAAAAGTGTGGG + Intronic
1156773179 18:40755107-40755129 ATTTCAATCAAGAACACTGTAGG + Intergenic
1157337146 18:46749428-46749450 ATAATATTCAATAAAAGTGTCGG - Intronic
1159378023 18:67619472-67619494 AGGTCATTCTAGAAACATGTTGG + Intergenic
1159497898 18:69229681-69229703 AATTCATCCAGGAAAAGTGTGGG + Intergenic
1159555418 18:69940456-69940478 ATGTCATTCAACAAATTTCTAGG - Intronic
1162686804 19:12393518-12393540 ATGTCATTGAATAAAATGGTTGG - Intronic
1162691156 19:12433292-12433314 ATGTCATTGAATAAAATGGTTGG - Intronic
1165263497 19:34640710-34640732 TTGCCATTCATGAAAAGTTTTGG - Intronic
1166235637 19:41453868-41453890 ATGTCTTTAAAGAAAAGTCCAGG + Intergenic
1166437918 19:42785281-42785303 CTCTCATTGGAGAAAAGTGTGGG + Intronic
926214887 2:10899467-10899489 AGCTCATTCAAGAAAAATATAGG - Intergenic
926594718 2:14777675-14777697 ATGACACTAAAGAAAAATGTGGG + Intergenic
927624189 2:24696094-24696116 TTGTCATTTAAGAACAGTTTGGG - Intronic
928535861 2:32240607-32240629 ATGTGAATCAAGAAAACTTTGGG - Intronic
929428940 2:41870659-41870681 ATGTCCTTCAAGAAGAGTTTAGG + Intergenic
930912602 2:56647615-56647637 ATGGCGTTAAAGAAAACTGTGGG + Intergenic
935028608 2:99301329-99301351 ATGTGAATAAAGACAAGTGTTGG - Intronic
935029379 2:99307178-99307200 ATGTGAATAAAGACAAGTGTTGG + Intronic
935833700 2:107026663-107026685 ATTTCATTCAGGCAAAGTGAAGG + Intergenic
936472054 2:112807935-112807957 ATGAAATTCAATAAAAGAGTTGG - Intergenic
939053986 2:137340154-137340176 ATTTGATTAAAGGAAAGTGTGGG - Intronic
939339774 2:140879472-140879494 ATGTTATTTATAAAAAGTGTTGG - Intronic
939453661 2:142404533-142404555 ATGTCCTCCAAGAAAATTTTAGG - Intergenic
941504618 2:166326852-166326874 ATGTTATTTAAGCAAAGTGCAGG - Intronic
941946463 2:171103758-171103780 ATGTAATTCAACAAAAGAGAAGG - Intronic
944091854 2:195920476-195920498 ATGCTATTCAACAAATGTGTTGG + Intronic
944874767 2:203951139-203951161 ATGCCATTCAAGAAAAATTGAGG + Intronic
948397690 2:237659405-237659427 ATGTTATTAAAGAACAGTTTGGG + Intronic
1170170028 20:13399982-13400004 GTGTCATTCGAGTAAAGTCTTGG - Intronic
1170358225 20:15516289-15516311 ATGCCCTTCAAAAAAAATGTTGG + Intronic
1170779855 20:19415310-19415332 ATGTTATTCCAGAACTGTGTAGG + Intronic
1171562608 20:26138557-26138579 AGGTCATGCAATAAATGTGTAGG + Intergenic
1173435080 20:43025026-43025048 CTGTCAGTCAAGGAAGGTGTTGG - Intronic
1175169978 20:57073501-57073523 ATGTTTTTTAAAAAAAGTGTTGG - Intergenic
1176890087 21:14305471-14305493 ATGTCTTACAAGAAAAGCGCTGG + Intergenic
1177001162 21:15614959-15614981 ATGTTATTCAGGAACACTGTAGG - Intergenic
1177768483 21:25487186-25487208 ATGTGCTTCAAGATAAGTCTTGG - Intergenic
1178250709 21:31000753-31000775 ATTTCATTCAAGAAGAGCATTGG - Intergenic
1178284434 21:31313517-31313539 ATGTCATTCATGATATGTGGGGG + Intronic
1179321226 21:40293081-40293103 ATGACATTCAACAATAGTGTTGG + Intronic
1182856787 22:33524566-33524588 ATGTAATTTCAGAAAAGGGTGGG - Intronic
1182954905 22:34414882-34414904 ATGTCCTTCAGGTACAGTGTAGG + Intergenic
950983890 3:17339713-17339735 ATGTCATGCAAAAATACTGTAGG - Intronic
951147957 3:19252126-19252148 AAGGCATTCAAAAAATGTGTTGG - Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951290874 3:20871035-20871057 ATGTCTTTTAAAAAAATTGTAGG - Intergenic
951464527 3:22988009-22988031 AATTAATTCAAGAAAAATGTGGG + Intergenic
951506710 3:23454959-23454981 AAGTCATTGAAGCCAAGTGTGGG + Intronic
953658445 3:44872464-44872486 ATGGCATTTACGAAAAGTCTTGG - Intronic
954274289 3:49532357-49532379 ATGTCATTCAACACCAGTGCCGG - Exonic
957724799 3:84050001-84050023 ATGTCATTTTAGAAAAGCGAAGG - Intergenic
960234106 3:115261498-115261520 ATGTCATGGAAGGAAAGTGAGGG + Intergenic
960932880 3:122872630-122872652 ATGTGTTACAAGAAAAGTTTGGG + Intronic
962912886 3:139870748-139870770 AGGTCATTGACAAAAAGTGTGGG + Intergenic
963101253 3:141606841-141606863 ATGTCATTCAAGCAAAGCTTGGG + Intronic
964253081 3:154742865-154742887 ATGTCATTTAAGTCAAGTCTTGG - Intergenic
964829562 3:160868559-160868581 ATGTATTTCAATAAAAGTTTGGG + Intronic
965172956 3:165292351-165292373 ATGAAATTAAAGAAAATTGTTGG + Intergenic
965977567 3:174643093-174643115 ATTTTAAGCAAGAAAAGTGTTGG + Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
966996609 3:185287529-185287551 ATATCCTACAATAAAAGTGTGGG - Intronic
967114975 3:186328893-186328915 ATTTCCTTCAAGAAAAGTTAGGG + Intronic
967254819 3:187579360-187579382 ATCTCATTTAAAAAAATTGTGGG + Intergenic
968242943 3:197108526-197108548 ATGTCTTTCTAGAAATGTATTGG + Intronic
971999158 4:34007850-34007872 AGGTCATGCAATAAATGTGTAGG - Intergenic
973550890 4:52035066-52035088 ATGTCATTCAACCATAGTCTAGG - Intronic
977082020 4:92542330-92542352 ATCACATTCAAGAAAAGTTTAGG - Intronic
977524912 4:98131857-98131879 ATGGCATTGAAGAATAGAGTTGG - Intronic
978360637 4:107927914-107927936 ATGTCCTTCAACAAAAGAGGGGG - Intergenic
979792037 4:124796467-124796489 ATCTCACTCATGAAATGTGTAGG + Intergenic
982370539 4:154628142-154628164 ATGTTATTGAAGAAAAGTCCTGG + Intronic
982743645 4:159083939-159083961 TTGTGATTTAAGAAAATTGTTGG + Intergenic
982876476 4:160657693-160657715 ATTTCACTCATGAAAAATGTGGG + Intergenic
983104407 4:163668254-163668276 ATTTCATTCAAGAGAACTGCTGG + Intronic
983810540 4:172055380-172055402 ATTTACTTCAAGAAAATTGTTGG - Intronic
988921161 5:35943981-35944003 AGGACATTCAGGAAAATTGTGGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990023527 5:51158555-51158577 AAGTCATGCAATTAAAGTGTTGG - Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
992323338 5:75635938-75635960 ATGGCTTTCAAGAAAAGAGTGGG + Intronic
993282656 5:85946477-85946499 ATGTAATCAAATAAAAGTGTAGG - Intergenic
993382532 5:87224132-87224154 CTGTCATTAAAAAAAAATGTAGG - Intergenic
994210359 5:97081480-97081502 ATACCATTCAAGACAAGTTTTGG + Intergenic
996707207 5:126509539-126509561 ACATCCTTCAAGAAAAGTGTGGG + Intergenic
998682618 5:144487200-144487222 ATGTCATTCTGGAACAGTGGAGG - Intergenic
999018085 5:148131203-148131225 ATGGCATTCAAGAAGAGGGGTGG - Intronic
999038113 5:148376186-148376208 AGGTCAAGCAAGAAATGTGTAGG + Intergenic
999439241 5:151588836-151588858 AGGTAATGCAAGAAATGTGTAGG - Intergenic
1000295509 5:159909888-159909910 AAGGAATTCAGGAAAAGTGTAGG + Intergenic
1001207093 5:169774356-169774378 ATGACATCCATGTAAAGTGTAGG + Intronic
1001921456 5:175603307-175603329 AGTTTATTCAAGAACAGTGTGGG - Intergenic
1004052380 6:12098959-12098981 ATTTTATTTAAGAAAAGCGTTGG + Intronic
1004331358 6:14724872-14724894 AAGTCATTGAAGTAAACTGTAGG - Intergenic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1007724045 6:43903730-43903752 ATGAAATTCAGGAAAAGAGTTGG - Intergenic
1007899981 6:45402041-45402063 AGATAATTCAAGGAAAGTGTTGG + Intronic
1008793527 6:55270461-55270483 ATGTGATTCAAGGACTGTGTTGG - Intronic
1008934028 6:56969991-56970013 ATTTCATTTAAAAAAAGTGCTGG - Intronic
1010227917 6:73508518-73508540 AAGTAATTTAAGAAAACTGTTGG + Intronic
1010566093 6:77416069-77416091 ATGACAATCAAGAAAAGAGGAGG + Intergenic
1010916783 6:81628862-81628884 TTATCATTCTAGAAAAGTATTGG + Intronic
1011874266 6:91937444-91937466 TATTCATACAAGAAAAGTGTTGG - Intergenic
1012470184 6:99563920-99563942 ATATCATTCAGGAAAATAGTAGG - Intronic
1013601930 6:111713199-111713221 GGGGCATTCAAGAAAAGGGTGGG + Intronic
1014242889 6:119037534-119037556 ATCTCATTCAAGAATATTGATGG - Intronic
1014286265 6:119502584-119502606 ATATCATTTAAGCAAAGTGAAGG - Intergenic
1014966943 6:127766318-127766340 ATTTCATTCAACAAAACTGTTGG - Intronic
1016546384 6:145228996-145229018 ATGAGATTCTAGAAAAGTTTAGG + Intergenic
1019140948 6:169942041-169942063 ACGTCCTTCCAGAAAAGTGAGGG - Intergenic
1020908354 7:14095287-14095309 ATCTCATTCCAGAAAACTCTGGG + Intergenic
1021540293 7:21749811-21749833 AGATCTTTCAAGAAATGTGTTGG - Intronic
1022738162 7:33095502-33095524 ATGTCATTCAAAAGCAGTATAGG + Intronic
1023147017 7:37161335-37161357 AGGGGATTCAAGATAAGTGTGGG - Intronic
1025275203 7:57576860-57576882 AGGTCATGCAATAAACGTGTAGG - Intergenic
1026428932 7:70324769-70324791 ATGTTATTGAGGAAAAGTTTGGG + Intronic
1027186410 7:75973616-75973638 TTGTGTTTTAAGAAAAGTGTAGG - Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1032330124 7:130970871-130970893 TTGTCATTGAAGCAAAGAGTGGG + Intergenic
1034523317 7:151637972-151637994 ATGTCATGCAAGCAAAGGGAAGG + Intronic
1034710646 7:153188547-153188569 ATGACAGGTAAGAAAAGTGTGGG + Intergenic
1035104582 7:156431598-156431620 ATGTCATATATTAAAAGTGTTGG + Intergenic
1038049875 8:23798529-23798551 ATGTCATTCAAGAAAGCAGGGGG - Intergenic
1038622025 8:29153446-29153468 ATGGCATTCAACAGAAGTGGTGG + Intronic
1043656968 8:82679821-82679843 TTGTAATTCAAGAAAAGAGTGGG - Intergenic
1044824405 8:96182654-96182676 ATGTCAGGGAAGAAAGGTGTGGG + Intergenic
1044952373 8:97446871-97446893 ATTTCATTCAACAGAAGTTTGGG - Intergenic
1045075296 8:98559512-98559534 AAGTGGTTAAAGAAAAGTGTAGG - Intronic
1045613280 8:103873908-103873930 ATGTCAACAAAGAAAAGTTTAGG + Intronic
1045761187 8:105609742-105609764 ATGTCATTCAAAAATAGTTGAGG + Intronic
1046337438 8:112808447-112808469 AAGTCCTTGAAGAAAAGTGGGGG - Intronic
1046859449 8:119073680-119073702 ATTCCAGTCAATAAAAGTGTAGG + Intronic
1050200231 9:3137546-3137568 TCGTCATTCAAGAAATGTGAGGG + Intergenic
1050503531 9:6323653-6323675 ATGTAATTCAAGGAGAGTGTTGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1050669985 9:7985270-7985292 ATGTCATTCAATAAATTAGTTGG - Intergenic
1050754043 9:8978012-8978034 AAGTAATCCAAGCAAAGTGTTGG + Intronic
1052664262 9:31474211-31474233 ATGTCATTCATGATAATTGATGG + Intergenic
1054831532 9:69630581-69630603 GTGACCTTCAAGAGAAGTGTTGG - Intronic
1055814355 9:80186991-80187013 AGGTCATCCAAGAAATGTGAGGG + Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1057554950 9:96080594-96080616 ATGCCAGCCAAGAAAAGTCTTGG - Intergenic
1057563641 9:96148970-96148992 AAGTCCATCAAGTAAAGTGTTGG + Intergenic
1057895791 9:98907707-98907729 TTGCCATTTAACAAAAGTGTTGG + Intergenic
1058124057 9:101171331-101171353 AAGTCACTTAAGAAAAATGTGGG + Intronic
1058241050 9:102560387-102560409 GTGTTATTCAAGTAAATTGTTGG + Intergenic
1058345925 9:103962209-103962231 AAGTCAATCAAGAGAAGTATAGG + Intergenic
1060928496 9:127472729-127472751 TTGTCTCTCAAGAAAAGTCTTGG + Intronic
1185639542 X:1579723-1579745 ATATCAGTCAAGAAAAGAGGTGG + Intergenic
1186946630 X:14575766-14575788 ATGACATTTATGAAGAGTGTTGG - Intronic
1188563160 X:31493244-31493266 ATGTCCTTCAAGAAGATTTTTGG - Intronic
1188709728 X:33380271-33380293 ATGCCATTTAAGAGAAGTGCAGG + Intergenic
1188918183 X:35937753-35937775 ATGTGATTAAAAAAAACTGTTGG + Intronic
1189187686 X:39068333-39068355 ATGACTTTCTAGAAAACTGTAGG - Intergenic
1190247441 X:48699962-48699984 AAGTCATTCCAGAAAAGGGGTGG + Intronic
1192627414 X:72744709-72744731 AGTGCATTCAAGAAAAGAGTTGG - Intergenic
1192654294 X:72976104-72976126 AGTGCATTCAAGAAAAGAGTTGG + Intergenic
1194312223 X:92325516-92325538 ATGTCATTTAAAATAAGTTTTGG - Intronic
1194427624 X:93759479-93759501 AATTCCTACAAGAAAAGTGTAGG - Intergenic
1194445765 X:93986064-93986086 ATGTCATTCCAGAAAAAAGGGGG - Intergenic
1197462222 X:126756660-126756682 ATGTTATTCAAAAAAAGAGGTGG + Intergenic
1197509230 X:127350418-127350440 AAGGCATTCAAGAGAAGTGCAGG - Intergenic
1198748001 X:139909431-139909453 ATGTTATTTAAAAACAGTGTGGG - Intronic
1200302499 X:154991804-154991826 ATGTGATTCAAAAAAAGGATGGG - Intronic
1200620495 Y:5439631-5439653 ATGTCATTTAAAATAAGTTTTGG - Intronic
1200692744 Y:6323488-6323510 ATCTCATTCAAGATATGTATTGG + Intergenic
1200712691 Y:6502995-6503017 ATCTCATTCAAGATATGTATTGG - Intergenic
1201021223 Y:9659046-9659068 ATCTCATTCAAGATATGTATTGG + Intergenic
1201042528 Y:9851238-9851260 ATCTCATTCAAGATATGTATTGG - Intergenic
1201143801 Y:11050781-11050803 ATATCATTCAAAAAAACTGAGGG + Intergenic
1201590265 Y:15607043-15607065 ATGTCATTAATGCAAAGTGTAGG + Intergenic
1201738075 Y:17292310-17292332 ATGTCATTGATACAAAGTGTGGG - Intergenic
1202058483 Y:20860970-20860992 CTATCATTCAAGAAAAGTCTGGG + Intergenic