ID: 1084699015

View in Genome Browser
Species Human (GRCh38)
Location 11:70774183-70774205
Sequence ATGACCAGCTTCTTTTAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084699015_1084699017 -7 Left 1084699015 11:70774183-70774205 CCTAACTAAAAGAAGCTGGTCAT 0: 1
1: 0
2: 1
3: 13
4: 115
Right 1084699017 11:70774199-70774221 TGGTCATAAAGGACCCCACATGG 0: 1
1: 0
2: 1
3: 8
4: 85
1084699015_1084699024 25 Left 1084699015 11:70774183-70774205 CCTAACTAAAAGAAGCTGGTCAT 0: 1
1: 0
2: 1
3: 13
4: 115
Right 1084699024 11:70774231-70774253 TTACATGAAATGGACAGAACAGG 0: 1
1: 0
2: 40
3: 350
4: 1450
1084699015_1084699021 15 Left 1084699015 11:70774183-70774205 CCTAACTAAAAGAAGCTGGTCAT 0: 1
1: 0
2: 1
3: 13
4: 115
Right 1084699021 11:70774221-70774243 GATGATCCCATTACATGAAATGG 0: 1
1: 0
2: 0
3: 14
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084699015 Original CRISPR ATGACCAGCTTCTTTTAGTT AGG (reversed) Intronic
901279698 1:8024793-8024815 GAAACCAGCTTCTTTTATTTTGG + Intronic
901745784 1:11372503-11372525 ATGCCCAGCTAATTTTTGTTTGG + Intergenic
903785472 1:25858622-25858644 ATTTCCAGCTCCTTCTAGTTAGG + Intronic
905135647 1:35797297-35797319 ATGCCCAGCTAATTTTTGTTTGG - Intergenic
905859920 1:41343371-41343393 ATGCCCAGCTCCTTTTATTAAGG - Intergenic
905955094 1:41986257-41986279 CTGAGCAGTTTATTTTAGTTTGG - Intronic
907405374 1:54250706-54250728 ACTTCCAGCTTCCTTTAGTTAGG + Intronic
908875169 1:68665531-68665553 ATGTCTGGCTTCTTTTATTTAGG + Intergenic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
910898909 1:92098021-92098043 ATGCCCAGGTTTTTTTAATTGGG + Intronic
916367741 1:164052055-164052077 ACCACCAGCTTCTCTGAGTTGGG - Intergenic
919304329 1:195810618-195810640 ATTTCCAGCTTCTTGGAGTTCGG + Intergenic
920939526 1:210468565-210468587 CTGAGCACCTTCTTTTAGTGAGG + Intronic
924799178 1:247314902-247314924 ATGACCAGCTACTTTTTTTTTGG + Intronic
1065300014 10:24312622-24312644 ATGCCCACCTTTTTTTTGTTTGG - Intronic
1068779980 10:60909057-60909079 AAGAGCAGCTTATTTTTGTTGGG + Intronic
1072492592 10:95922211-95922233 ATGCCCATCTTGTTTTATTTAGG - Intronic
1073941495 10:108703917-108703939 AAAACCAGCTTCTATTAGGTTGG - Intergenic
1074345653 10:112683451-112683473 ATGACTAACTTGTTTTATTTGGG + Intronic
1075966102 10:126613203-126613225 GTGACCATTTTCTTTTATTTTGG + Intronic
1079638811 11:22778969-22778991 ATGACTTGCATATTTTAGTTTGG + Intronic
1079807112 11:24946081-24946103 GTGACTAGCTTCTTTCACTTAGG + Intronic
1080305719 11:30832926-30832948 AAGATGAGCTTCTTTTAGGTGGG + Intronic
1080872169 11:36246030-36246052 ATGCCCAGCTAATTTTATTTTGG - Intergenic
1084699015 11:70774183-70774205 ATGACCAGCTTCTTTTAGTTAGG - Intronic
1087018612 11:93579454-93579476 GTGACTAGCTTCTTTCACTTAGG - Intergenic
1087897552 11:103603630-103603652 ATGTGTAGCTGCTTTTAGTTTGG - Intergenic
1090275757 11:125418241-125418263 ATGTCTAGCTTCTTTTACTTAGG + Intronic
1090341915 11:126031005-126031027 TTGAGCAGTTTCCTTTAGTTTGG - Intronic
1092125118 12:6069644-6069666 CTGACCATCTTTTTCTAGTTTGG - Intronic
1095498025 12:42806027-42806049 ATGATCAGCTTCTGATGGTTAGG + Intergenic
1096107013 12:49002084-49002106 ATTATCAGCTTTTCTTAGTTGGG - Intergenic
1098075780 12:66729181-66729203 AAGACTAGCATGTTTTAGTTAGG - Intronic
1100590832 12:96027222-96027244 ATAAGAAGCTTCTTTCAGTTTGG - Intronic
1101219506 12:102623153-102623175 CAGACCTGCTTCTTTTAATTGGG - Intergenic
1101381790 12:104219835-104219857 TTGACCAGCTTCTTCTAGTAAGG + Intronic
1105540221 13:21309782-21309804 ATGACCAGCTCAGTTGAGTTGGG + Intergenic
1109401330 13:61832825-61832847 ATGGGCATCTTTTTTTAGTTGGG + Intergenic
1110167600 13:72461862-72461884 ATGAATAGCTTCTTTTAATGAGG + Intergenic
1111876738 13:93906373-93906395 CTGAACAGCTTATTATAGTTGGG + Intronic
1117548973 14:56815121-56815143 ATGAAAAGCTTCTTTTATATGGG + Intergenic
1122725901 14:103751995-103752017 GTGACCGGCTTCTTTCACTTAGG - Intronic
1129311523 15:74714981-74715003 ATGTTCAGCATCTTTCAGTTGGG - Intergenic
1133648125 16:7783508-7783530 ATGTCCTGCTTCTTTCACTTAGG - Intergenic
1133891276 16:9881592-9881614 ATGAGGAGCATCTTTTAGTATGG - Intronic
1144327540 17:14196415-14196437 ATGACCAGTTTCTTTGAGGAGGG + Intronic
1159339506 18:67117515-67117537 ATGAACACCTTTTTCTAGTTTGG + Intergenic
1159771305 18:72548512-72548534 ATAACCAGGTATTTTTAGTTTGG - Intronic
1165812788 19:38622061-38622083 ATGCCCAGCTAATTTTACTTGGG + Intronic
926429221 2:12768757-12768779 AAGACCAGCTTGCTTTATTTCGG + Intergenic
927733960 2:25501535-25501557 ATGCCCAGCTAATTTTTGTTGGG + Intronic
928020882 2:27703834-27703856 AGGACCAGCTGCATTTAGCTGGG + Intergenic
928563555 2:32517729-32517751 ATGCCCAGCTTATTTTTTTTTGG + Intronic
928767818 2:34669611-34669633 ATGTCCAGCAGCTTTTATTTTGG - Intergenic
929723673 2:44399812-44399834 CAGACCAGGTTCTTTTAGTTAGG + Intronic
935365609 2:102287088-102287110 TTCACCTGCTTCTTTTACTTTGG - Intergenic
942782439 2:179661076-179661098 ATGACTAGTTACTTTTATTTTGG + Intronic
944537692 2:200727467-200727489 ATGACCAGTTACTTTTAGGATGG + Intergenic
947028312 2:225763850-225763872 ACAACCAGCTTCTTTTACTTTGG + Intergenic
948606643 2:239139919-239139941 ATGGCCATGTTCTTTTTGTTGGG - Intronic
1173295854 20:41755890-41755912 GTGACTGGCTTCTTTTATTTAGG + Intergenic
1173340684 20:42150103-42150125 ATGGCAAGCTTCTGTTGGTTTGG - Intronic
1175362557 20:58425030-58425052 ATGTCCAGCTTCTTTGCTTTAGG + Intronic
1180592513 22:16953378-16953400 ATGTCTACCTTCTATTAGTTTGG - Intergenic
1182834959 22:33334438-33334460 ATGCCCTGTTTCTTTTTGTTTGG - Intronic
949176657 3:1071587-1071609 ATGACCAATTTCTTTTAGTTAGG - Intergenic
952135020 3:30409094-30409116 ATGACAAACTTCTCTTAGTCAGG - Intergenic
953124933 3:40082967-40082989 ATGCTCAGCTTCTTTAAATTTGG - Intronic
955277996 3:57566260-57566282 GTGACTGGCTTCTTTTACTTAGG + Exonic
959558263 3:107748780-107748802 ATGACATGCATTTTTTAGTTGGG - Intronic
962010597 3:131387065-131387087 AGGTCCAGCATCTTTTACTTTGG - Intronic
963215866 3:142746854-142746876 ATGACCAGTTTTTTTTTTTTTGG - Intronic
963840857 3:150104678-150104700 AAGTCCAGCTTCATTTAGATAGG - Intergenic
964891319 3:161539321-161539343 ATGACTAGCTTATTTCACTTAGG + Intergenic
965164778 3:165182863-165182885 ATGGCCATCTTCTTTTATTTTGG - Intergenic
968944230 4:3655164-3655186 ATGACCAGCTTCTCTGAGTCGGG + Intergenic
971896318 4:32600954-32600976 ATAAACAGCCTTTTTTAGTTAGG + Intergenic
972314034 4:37908702-37908724 ATTACCAGATTCTTTTAGCAGGG - Intronic
973023949 4:45242575-45242597 ATGATCAGCTTATTTCACTTAGG - Intergenic
988842953 5:35100963-35100985 ATGGCTAGCTTTATTTAGTTGGG + Intronic
989078510 5:37590386-37590408 GTGTCTAGCTTCTTTTAGTTGGG + Intronic
990734291 5:58842955-58842977 ATGTCCATCTTCTTATATTTTGG - Intronic
993339090 5:86700364-86700386 ATAACCAGCTTCTCTAAGTTGGG - Intergenic
993569145 5:89514567-89514589 CTGACCAGCATCATTTATTTGGG + Intergenic
993936101 5:94004928-94004950 ATCACCACCTTCTTGTACTTAGG + Intronic
995082937 5:108075224-108075246 AAGACCAGTTTCATTTAGATAGG - Intronic
996078282 5:119223979-119224001 ATGACCAGCTTCTGCTATTTTGG + Intronic
996846395 5:127903690-127903712 ATGATCAGCTATTTTTTGTTTGG - Intergenic
999948496 5:156623496-156623518 ATGCTCAGCTTCTTTTCTTTGGG - Intronic
1000029780 5:157391551-157391573 GTGACTGGCTTATTTTAGTTAGG + Intronic
1007601103 6:43081829-43081851 CTCCCCAGCTTCTTTGAGTTGGG + Intronic
1007939237 6:45761885-45761907 ATGACCAGTATCTTTTTGTTTGG - Intergenic
1008490697 6:52083793-52083815 AGGAACAGCTTCTATTAGGTTGG - Intronic
1009895955 6:69749340-69749362 GTGCACTGCTTCTTTTAGTTGGG - Exonic
1013701409 6:112774412-112774434 ATGACCATCTTGTTTTTGGTGGG - Intergenic
1014630623 6:123785289-123785311 AAGACCAGCATCTTTTGGTAGGG + Intergenic
1016812028 6:148270503-148270525 ATGCCTAGCTTTTTTTGGTTGGG - Intergenic
1017531609 6:155297885-155297907 ATGACCAGACTCCTTCAGTTGGG - Intronic
1021972052 7:25974976-25974998 ATAGCCAGCTTCCTTTATTTGGG + Intergenic
1029894700 7:103970568-103970590 ATCACAACCTTCTTTTACTTAGG - Intronic
1030264551 7:107606144-107606166 ATGAACAGCTTCTAATATTTAGG - Intronic
1031247262 7:119330481-119330503 ATGTGCAGCTTCTTTTATGTGGG + Intergenic
1032959381 7:137013830-137013852 TTGAGCAGCTTCTCTTAATTAGG - Intronic
1034779379 7:153863840-153863862 ATGACTGGCTTCTTTCATTTAGG + Intergenic
1046292143 8:112176961-112176983 ATATCAAGGTTCTTTTAGTTGGG + Intergenic
1046569139 8:115940645-115940667 ATTAGCTTCTTCTTTTAGTTGGG + Intergenic
1049178341 8:141207395-141207417 ATGACTCTCTTCTATTAGTTGGG - Intronic
1051108450 9:13607679-13607701 TTGACAAGTTTTTTTTAGTTAGG + Intergenic
1052270546 9:26624034-26624056 ATGAGCAGCTTCTTTTCTTTTGG - Intergenic
1055313064 9:75004631-75004653 ATGAAAAGATTCTTTTAGCTAGG - Intronic
1055451024 9:76431576-76431598 ATGACCAGAGTCTTTTATTGGGG + Intronic
1056099597 9:83288012-83288034 ATTCCCAGCCTCTTTAAGTTTGG + Intronic
1056233168 9:84567404-84567426 ATGACCAGATTCTTTAAATTAGG - Intergenic
1056426234 9:86480135-86480157 TTGAACATCTTCTTTTAGCTCGG + Intergenic
1058438019 9:104981775-104981797 GTGAGCAGCATCTATTAGTTAGG + Intergenic
1058474314 9:105316074-105316096 CTGGCCATCTTCTTTGAGTTAGG + Intronic
1058742951 9:107962594-107962616 ATGACTGGCTTCTTTCATTTAGG + Intergenic
1062731118 9:138109901-138109923 AGGCCCAGCTTTTTTTAGTAGGG - Intronic
1188966854 X:36564799-36564821 ATAACCAACTTCCTTTACTTCGG + Intergenic
1190141013 X:47844434-47844456 GTGACCGGCTTCTTTCACTTAGG + Intronic
1193447940 X:81628058-81628080 ATGGGCACCTTCTTTTAGGTAGG + Intergenic
1194377495 X:93153544-93153566 GTGTCCAGCTTCTCTGAGTTTGG + Intergenic
1195434928 X:104831726-104831748 TTGTCCTGCTTCTCTTAGTTGGG + Intronic
1195930197 X:110066724-110066746 AGGACAAGGTTCTTTTTGTTTGG + Intronic
1196319076 X:114267419-114267441 ATAACCAGTTTCTATTACTTAGG - Intergenic
1197128296 X:122973325-122973347 ATTGCTAGCTTCTTTTACTTAGG + Intergenic
1197197683 X:123719629-123719651 ATCACCATTTTCTTTTATTTTGG - Intronic
1198394725 X:136209510-136209532 ATAACCAGTTTCTTTGATTTAGG - Intronic
1199295594 X:146154473-146154495 ATGAGCGGCTTTTATTAGTTGGG + Intergenic
1199295599 X:146154527-146154549 ATGATCGGCTTTTATTAGTTGGG + Intergenic