ID: 1084699611

View in Genome Browser
Species Human (GRCh38)
Location 11:70777789-70777811
Sequence CAGTGATGTGTTTGATGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084699611_1084699617 28 Left 1084699611 11:70777789-70777811 CCAGCTCATCAAACACATCACTG 0: 1
1: 0
2: 0
3: 12
4: 157
Right 1084699617 11:70777840-70777862 AGGTCCCACCCCAGACATTCAGG 0: 1
1: 1
2: 3
3: 48
4: 507
1084699611_1084699614 8 Left 1084699611 11:70777789-70777811 CCAGCTCATCAAACACATCACTG 0: 1
1: 0
2: 0
3: 12
4: 157
Right 1084699614 11:70777820-70777842 GCTTAAAAATACAGATTCCCAGG 0: 1
1: 4
2: 29
3: 154
4: 879

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084699611 Original CRISPR CAGTGATGTGTTTGATGAGC TGG (reversed) Intronic
902703069 1:18186060-18186082 CAGTGAGGTGAGTGATGAGCTGG + Intronic
909578160 1:77200158-77200180 CAGTTATGTGTAGGATGAGTTGG + Intronic
915308133 1:154992892-154992914 CAGTGATGTGTATCTGGAGCAGG - Exonic
915635773 1:157185527-157185549 CACTGCTGTGTGTGGTGAGCAGG - Intergenic
915662358 1:157414903-157414925 CACTGCTGTGTGTGGTGAGCAGG - Intergenic
917633677 1:176915343-176915365 AAGTCATCTGTTTGATGATCAGG + Intronic
917679988 1:177355775-177355797 CAGTGATGTTATTGACGACCAGG - Intergenic
918043894 1:180929580-180929602 CAGTCATGTGTGTGATGTGCTGG - Intronic
918045645 1:180939419-180939441 CAGTGATGTGTTTGCCGGGAAGG - Intronic
919425212 1:197421412-197421434 CAGGGATGTGTTTGTGAAGCTGG + Exonic
1067987076 10:51162064-51162086 CAGTGATTTCTTTGTGGAGCTGG + Intronic
1068648316 10:59493536-59493558 CAGTGATGGCATTGACGAGCTGG - Intergenic
1068689821 10:59904566-59904588 CAGAGATGTCTTTGCTGAGTGGG - Intronic
1072111851 10:92329585-92329607 CAATGATATATTTTATGAGCAGG - Intronic
1073796230 10:106991309-106991331 CAGTGACATGTTTGACAAGCTGG + Intronic
1076322538 10:129593996-129594018 CAGTGTGGGGTTTTATGAGCTGG + Intronic
1076380132 10:130019293-130019315 CACTGTTGTGTTTGGTGACCAGG + Intergenic
1076450787 10:130555652-130555674 CAGTGAAGTCTTGGATGGGCAGG + Intergenic
1079394710 11:20051565-20051587 CAGGGATGTTTTTCATGAGATGG - Intronic
1080416366 11:32073167-32073189 CAGTGATGTGCAGGATGAGGTGG - Intronic
1081595821 11:44458710-44458732 CAGAGATGATCTTGATGAGCTGG + Intergenic
1081986914 11:47311812-47311834 CAATGAGGTGCTTGATCAGCTGG + Exonic
1082750706 11:57012478-57012500 CAGTGATTTGATTTTTGAGCAGG - Intergenic
1084699611 11:70777789-70777811 CAGTGATGTGTTTGATGAGCTGG - Intronic
1085406399 11:76265631-76265653 CACTGAAGTGTTTGATGACTGGG + Intergenic
1086607814 11:88717568-88717590 CAGTGATGTGTTTCAAAAGATGG - Intronic
1087296588 11:96383425-96383447 CAGTGATGAAGTTGATGAGGAGG - Exonic
1089071262 11:115701375-115701397 CAGTGATGCGTTGGATGGGAGGG + Intergenic
1089858915 11:121571690-121571712 CCCAGATGTGTTTAATGAGCTGG - Intronic
1090295249 11:125581899-125581921 GAAAGATGTGTTTGATGGGCTGG + Intronic
1090656893 11:128852989-128853011 CAGTGGTGTGTATAATGACCTGG + Intronic
1092311315 12:7357553-7357575 AAGTGCAGTGTTTGATCAGCTGG + Intronic
1095670156 12:44849216-44849238 CATGGATTTCTTTGATGAGCAGG - Intronic
1096776542 12:53967720-53967742 TAGTGAGGTGGTTTATGAGCTGG + Intergenic
1097267249 12:57753166-57753188 CAGAGAAGTTATTGATGAGCAGG + Intronic
1097758132 12:63429177-63429199 CAGTGATATTTTTAATGAGTTGG - Intergenic
1097778932 12:63681485-63681507 CTGTGATGTGTTAGACAAGCTGG + Intergenic
1101591061 12:106125820-106125842 CAGTGATGTGCTTGCTGCTCTGG - Intronic
1101737841 12:107476224-107476246 CAGTGAAATGTCAGATGAGCTGG + Intronic
1103697364 12:122827399-122827421 CAGAGATGATTTTCATGAGCGGG + Exonic
1107711484 13:43154523-43154545 CAGTGATCTGGTTGCTGATCTGG - Intergenic
1111899405 13:94182502-94182524 CCATGATGTGTTTTCTGAGCAGG + Intronic
1112161096 13:96868750-96868772 CACTGCTTTATTTGATGAGCTGG + Intergenic
1115754945 14:36520459-36520481 CAGTGCTGTGTTTGCTCGGCCGG - Intronic
1120174460 14:81278296-81278318 CAGTGCTTTCTTTGAGGAGCAGG - Exonic
1120962114 14:90134960-90134982 CAGTCATGTCTACGATGAGCAGG - Intronic
1124261787 15:28199341-28199363 CTGTTATGTTTTTGATGATCAGG - Intronic
1127287454 15:57544047-57544069 CACTCATGTGTTTGATGACGTGG - Intronic
1130548429 15:84873224-84873246 CAGTGAGGGGGTTGATGGGCTGG + Exonic
1131065208 15:89430237-89430259 CTGTGTTGTGTAAGATGAGCTGG - Intergenic
1131376113 15:91924934-91924956 CACTGAAGTGTTTGATAGGCAGG + Intronic
1134008590 16:10834711-10834733 GAGTGATGTGTTGGATGATTGGG - Intergenic
1134387515 16:13787594-13787616 CAATGTTCTGTTTCATGAGCTGG + Intergenic
1134481195 16:14620658-14620680 CAGAGATGTGATTGAAGATCAGG + Intronic
1136028274 16:27484101-27484123 CACTGAGGTGTCTGATGGGCTGG - Intronic
1138405505 16:56789549-56789571 CAGTGATGGATCTGCTGAGCTGG + Intronic
1139842946 16:69896518-69896540 GAGTGATGTGTTACATGAGTGGG + Intronic
1140834927 16:78784707-78784729 CAGTCAGGTGGTTGATGAGTTGG + Intronic
1145778641 17:27546912-27546934 CAGCAGTGTGTTTGATTAGCAGG + Intronic
1149801777 17:59575607-59575629 CACTGATTTGTTTCATGATCTGG - Intronic
1149844712 17:59999873-59999895 CACTGATTTGTTTCATGATCTGG + Intergenic
1152060546 17:78071129-78071151 CTGTGAGTTGTTTGATCAGCCGG - Exonic
1152130871 17:78475660-78475682 CAGTCATGAATTTGGTGAGCAGG - Exonic
1153695605 18:7637867-7637889 CAGTGATGTGATTCATGTGTGGG - Intronic
1153726340 18:7959733-7959755 CAGTGGTGTTTTTGAAGATCAGG + Intronic
1157270957 18:46275818-46275840 CAGAGATGTTTATCATGAGCTGG + Intergenic
1157598773 18:48879799-48879821 CTGTGATGTGAGTGGTGAGCAGG + Intergenic
1162103706 19:8356710-8356732 CAGCCATGTTTTTTATGAGCAGG - Intronic
1164473797 19:28556822-28556844 GTATGATGTGTTTGATAAGCAGG - Intergenic
1164866347 19:31607407-31607429 CACTGATGGCTTGGATGAGCTGG + Intergenic
1165326476 19:35117120-35117142 AACTGATGTGGTTGGTGAGCAGG - Intronic
1165352079 19:35281044-35281066 CAGGGATGTTTTTGGGGAGCCGG - Intronic
1165421298 19:35723264-35723286 CAGTGCTGTGTGTGAGTAGCTGG + Exonic
1165623566 19:37267885-37267907 CAGTGATGTGGATGAAGGGCAGG + Intergenic
1165635444 19:37336070-37336092 CAGTGATGTGGATGAAGGGCAGG + Intronic
1166310027 19:41957657-41957679 AAGTTATGTGCTTGATGGGCTGG - Intronic
1168726276 19:58583790-58583812 CAGAGATGTGTATGGGGAGCAGG - Intergenic
926817746 2:16816795-16816817 CAGTGGTCTTTTTAATGAGCAGG - Intergenic
928110676 2:28506402-28506424 CAATGATGGGTTTGAGGAACAGG + Intronic
933508594 2:83210875-83210897 CAGTGTAGTGTTTTCTGAGCAGG - Intergenic
935199338 2:100842697-100842719 CTGGGATGTGTTTGAGGAACTGG + Intronic
936163132 2:110100003-110100025 CAGTGGAGTGTTTGAAGAGAGGG - Intronic
937588642 2:123587499-123587521 CTGTGATTTGTTAGATGAGCTGG - Intergenic
939015813 2:136902760-136902782 CAGTGATGTGTTAGAAGGCCAGG + Intronic
939486485 2:142818717-142818739 CAGTGATTTCTCTGATGACCAGG - Intergenic
940304356 2:152209853-152209875 CAGTGATATATTTGATGAAAAGG + Intergenic
941241064 2:163038507-163038529 GGGTGGTTTGTTTGATGAGCAGG + Intergenic
941610899 2:167661006-167661028 CAGATATGTGTTTGATCAACTGG + Intergenic
943797975 2:192022112-192022134 CAGTGATCAGTGTGATCAGCAGG - Intronic
948881958 2:240863437-240863459 GAGTTATCTTTTTGATGAGCCGG - Intergenic
1171064121 20:21996070-21996092 CTGTGATGGGTTGGATGAACTGG - Intergenic
1173106465 20:40141378-40141400 CAGTGATGTTATTGATGGACAGG + Intergenic
1173518364 20:43681341-43681363 CACTGATGTGTTTGAAGAGTGGG - Intronic
1174161281 20:48552461-48552483 CAGTGAAGTGTTTGAGGATGTGG - Intergenic
1177520922 21:22224380-22224402 CCGTGATGTATTTGGTGATCTGG + Intergenic
1178640182 21:34339263-34339285 CAGAGATCTGTGTGATGAGGGGG - Intergenic
1184364331 22:44040244-44040266 TAGTGATGTGTGTGATTAGAGGG + Intronic
952995664 3:38879738-38879760 AAGTGTAGTGTATGATGAGCGGG + Intronic
955878442 3:63518802-63518824 CAGTGATGGGATTTCTGAGCAGG - Intronic
956925450 3:73982284-73982306 CAGTGATGTGATAAATGGGCTGG - Intergenic
960713741 3:120556171-120556193 CAGTGCTGTGTTCCAGGAGCTGG + Intergenic
961174394 3:124821744-124821766 CAGAGAAGAGTATGATGAGCTGG - Intronic
961965379 3:130895973-130895995 CAGTGATGTTTTTGGTGATAAGG + Intronic
964389335 3:156181503-156181525 CAATGATGTGTTGGATTGGCTGG + Intronic
964422615 3:156520093-156520115 CTGTGATGAGTCAGATGAGCAGG - Intronic
965630625 3:170728821-170728843 CAGAGAAGGCTTTGATGAGCTGG + Intronic
966763329 3:183436361-183436383 CAGTGATGTTTTTGGTGTCCTGG - Intergenic
967194310 3:187013400-187013422 CAGTGATTTGGTTGGAGAGCTGG + Intronic
967219064 3:187234221-187234243 AAGGAGTGTGTTTGATGAGCCGG + Exonic
967408346 3:189142069-189142091 CAGGAATGTCTTTGCTGAGCAGG + Intronic
970263117 4:14250653-14250675 AAGTGATGTGGTTGAGGAGAAGG + Intergenic
971559011 4:28050842-28050864 AGGGGATGTGTTTGAGGAGCTGG + Intergenic
971960369 4:33478694-33478716 CAGTAATGTGTGCGATGAGGAGG + Intergenic
972386047 4:38566803-38566825 CAGAGATGTGGCTGATGAGAGGG - Intergenic
972999031 4:44922295-44922317 GAGTGATGTGATTCATGAGAAGG - Intergenic
975758570 4:77595727-77595749 CAGTGATGCTTTTGATAAGAAGG - Intronic
978594613 4:110363269-110363291 TAGTGCTGTGTTTGTTGATCTGG + Intergenic
981041015 4:140221519-140221541 CAGTGATGTATTTCTTAAGCTGG - Intergenic
982333354 4:154206998-154207020 CAATGATGTGGGAGATGAGCTGG - Intergenic
983262224 4:165469803-165469825 TTGTGATTTGTTTGCTGAGCTGG - Intronic
983679699 4:170339253-170339275 CAATGATGTGTTTTATCTGCTGG + Intergenic
990405932 5:55490916-55490938 TAGTGATGGGTTTGTTGTGCTGG - Intronic
993126775 5:83844997-83845019 CTGCGATGTGTTGGAAGAGCAGG - Intergenic
994612949 5:102068725-102068747 CAGTTATCTGCTTTATGAGCAGG - Intergenic
994681140 5:102889086-102889108 CAGGGATGTATTTTATGTGCTGG + Intronic
996017996 5:118562274-118562296 CAGTTATGTGTATGAGAAGCAGG - Intergenic
996580181 5:125023503-125023525 CAGTCAGGTGCTTGATGAGGTGG + Intergenic
997815982 5:137017677-137017699 CAATGATGTGTTTTGTGAGGTGG - Intronic
999004808 5:147964013-147964035 CAGTGATGTGGGTGATGAAAAGG - Intergenic
1002060751 5:176624449-176624471 CATTGATCTCTTTCATGAGCAGG - Intronic
1002953521 6:1839798-1839820 CAGTGATGAGTGTGAGGAGCAGG + Intronic
1004191736 6:13470244-13470266 GAGGGATGTGCTTCATGAGCCGG - Intronic
1005819398 6:29585138-29585160 CACACATGTGTGTGATGAGCTGG - Intronic
1007930691 6:45687890-45687912 CAGTCATGGGGGTGATGAGCAGG - Intergenic
1010112994 6:72264093-72264115 CAGTGAGGTGTTTGATGTTTAGG + Intronic
1011586258 6:88928475-88928497 CACTGATGTGTTCCACGAGCTGG + Intronic
1017245477 6:152219725-152219747 CAGTGATGATTTTGGTGAGCAGG + Intronic
1018410288 6:163538465-163538487 CAGTGAGGAGCTTAATGAGCCGG + Intronic
1019287044 7:228890-228912 CAGTGCTGAGTTTGAGGAGGAGG - Exonic
1020928509 7:14363118-14363140 CAGTAATCTGGTGGATGAGCTGG - Intronic
1022937854 7:35199101-35199123 CTGTGATGTGTTAGACAAGCTGG + Intergenic
1023347959 7:39290813-39290835 GAGTGAAGTCTTTTATGAGCTGG - Intronic
1029510415 7:100991162-100991184 CAGTGTTGTGTCTGTGGAGCCGG - Exonic
1032234202 7:130105803-130105825 CAGTATTGTGTTTCTTGAGCTGG + Intronic
1033586699 7:142779651-142779673 CAGTGCTGTGATGGAGGAGCAGG - Intergenic
1036469993 8:9044412-9044434 CAGTGATGTGTCTGCTGACCTGG - Intronic
1036683388 8:10892465-10892487 CTGTGTTGTGCTTGATGAGCGGG + Intergenic
1038282821 8:26181312-26181334 CAGTGATGAGTTGGATGAGATGG - Intergenic
1039526631 8:38222260-38222282 CCGTGATATGATTGATGAGAAGG - Intergenic
1039776463 8:40742466-40742488 CAGTGATGTGTCTTAGGAGAGGG + Intronic
1039833861 8:41239782-41239804 AAGTGATGTCTTTGAAGAGCAGG - Intergenic
1040430857 8:47340824-47340846 CACTGATGTGTTTGCTAACCAGG - Intronic
1040674177 8:49728639-49728661 CAATGATGTGGAGGATGAGCTGG + Intergenic
1041201354 8:55453846-55453868 CACGGACCTGTTTGATGAGCTGG - Intronic
1041799482 8:61783835-61783857 CAGTGATGCTTGTGATGAGCTGG + Intergenic
1042484370 8:69334476-69334498 CAGTGAGGGGTGTGATGAGGCGG - Intergenic
1043218249 8:77622630-77622652 TACTGATGTGTTTGATCAGAAGG - Intergenic
1043780961 8:84334259-84334281 CAGTCATGTATTTGATCATCAGG + Intronic
1046413052 8:113874103-113874125 CATAAATGTGTTTGATGAGGAGG + Intergenic
1049529553 8:143147541-143147563 AATTCATGTGTTTGATGAGCGGG - Intergenic
1051467603 9:17398130-17398152 CAGTGATGGGTTTTATCAGGAGG + Intronic
1053189412 9:36049350-36049372 CAGCCATGTGTTTAAAGAGCTGG - Intronic
1055565969 9:77568767-77568789 CAGCTCTGTGGTTGATGAGCAGG - Intronic
1056520445 9:87396278-87396300 CAGTTCTGTGTTTGTTCAGCTGG - Intergenic
1057114823 9:92510943-92510965 CAGTGATTTGTCTGAAGAGTGGG + Intronic
1059490050 9:114659406-114659428 CAGTGGTGTGTTTGGTGTGGCGG - Intergenic
1190196780 X:48326696-48326718 CAGGGATGTGGGGGATGAGCGGG - Intergenic
1194106018 X:89768052-89768074 CAGTGAGGTGGATGATAAGCTGG - Intergenic
1195924993 X:110016108-110016130 CAGTGCTGTGTTTGCTCAGATGG + Intronic
1200457974 Y:3415911-3415933 CAGTGAGGTGGATGATAAGCTGG - Intergenic