ID: 1084701350

View in Genome Browser
Species Human (GRCh38)
Location 11:70788186-70788208
Sequence CATCCACAATGGCCCTGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084701350_1084701357 13 Left 1084701350 11:70788186-70788208 CCCCACCAGGGCCATTGTGGATG 0: 1
1: 1
2: 0
3: 11
4: 160
Right 1084701357 11:70788222-70788244 TTGTGTCGTCTTCTTATCAATGG 0: 1
1: 0
2: 0
3: 7
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084701350 Original CRISPR CATCCACAATGGCCCTGGTG GGG (reversed) Intronic
900250377 1:1665693-1665715 CCTCCTCCATGGCCCTGCTGGGG - Exonic
900987454 1:6081446-6081468 CATCCACAGAGCCCCTGCTGGGG + Intronic
901068796 1:6507199-6507221 AAGCCACAATGACCCTGCTGGGG - Intronic
902437051 1:16405063-16405085 GATCTTCAATGGTCCTGGTGAGG - Exonic
902447434 1:16476133-16476155 CAGCCACAATAGCCCAGGGGAGG + Intergenic
903064751 1:20693121-20693143 CATCAGCAATGGGCCTGGAGAGG - Intronic
903679868 1:25089544-25089566 CAAACACACTGGCCCTGGTGTGG - Intergenic
903790348 1:25888634-25888656 AAGCCACAATGGGCCAGGTGTGG + Intronic
907900736 1:58739093-58739115 CTTACACAATAGTCCTGGTGTGG + Intergenic
909784821 1:79597981-79598003 CATTCACAATAGCCATGATGTGG + Intergenic
909987134 1:82174802-82174824 TATTCACAATAGCCATGGTGTGG + Intergenic
911084133 1:93962557-93962579 CATTTGCAATGCCCCTGGTGTGG + Intergenic
911319944 1:96401563-96401585 CATCAAGATTGGCTCTGGTGAGG - Intergenic
912633232 1:111267410-111267432 GATCCTCTATGGCCCTGGGGAGG + Intergenic
915063081 1:153202885-153202907 CAACCACAAAGACCCTGGTCAGG + Intergenic
920209035 1:204314754-204314776 CCTCCACAATGGCGCAGGGGCGG + Intronic
923409205 1:233690754-233690776 CATGAACAATGGCCCTGTAGTGG + Intergenic
924624010 1:245685482-245685504 GGTCCACCGTGGCCCTGGTGTGG - Exonic
1062872560 10:918784-918806 TAACCACAATGGGCCAGGTGCGG + Intronic
1063565637 10:7170695-7170717 CCCCCACCATGGCACTGGTGGGG + Intronic
1064266091 10:13826630-13826652 CATCCACAAGAGCCATGGGGAGG - Intronic
1065167987 10:23000740-23000762 CAAACACAGGGGCCCTGGTGGGG - Intronic
1070733210 10:78845896-78845918 CCTCCACATTGGCCGTGGTGGGG + Intergenic
1071296252 10:84222233-84222255 GCTACACACTGGCCCTGGTGTGG + Exonic
1073072842 10:100805756-100805778 CATCCACAGGGGCCCTTCTGTGG + Intronic
1076595142 10:131620496-131620518 CAGCCAGAAAGGGCCTGGTGGGG + Intergenic
1077503978 11:2921829-2921851 CATCCCCGGTGTCCCTGGTGTGG + Intronic
1078269409 11:9780979-9781001 CATCCTCTATGGCCCTGCTCAGG - Intronic
1078662420 11:13298080-13298102 CATACACCATGGCCTTGGGGTGG - Intronic
1080075920 11:28149440-28149462 CTGCAAGAATGGCCCTGGTGTGG - Intronic
1084031719 11:66485070-66485092 CACCCACACTGGCTCTGCTGGGG + Intronic
1084043477 11:66555881-66555903 CAGCCACTGTGGCCCTCGTGAGG - Intronic
1084701350 11:70788186-70788208 CATCCACAATGGCCCTGGTGGGG - Intronic
1087546818 11:99594815-99594837 CATTCAGAAAGACCCTGGTGTGG + Intronic
1088053639 11:105549986-105550008 CATCCACAGAGGGCCTGTTGGGG - Intergenic
1089610420 11:119665551-119665573 CATCCCCACTGTCCTTGGTGTGG + Intronic
1091895408 12:4099034-4099056 CATCCTCAATGTCTCTGCTGTGG + Intergenic
1095603328 12:44038445-44038467 CATGCACACTGGCTGTGGTGGGG - Intronic
1096257759 12:50073416-50073438 CTGCCACAGAGGCCCTGGTGAGG + Intronic
1096413801 12:51395549-51395571 CTTCCACACGGTCCCTGGTGAGG + Intronic
1097352263 12:58561937-58561959 CAAGCACAAAGGCCCTGGGGTGG + Intronic
1097953296 12:65456831-65456853 CATCCACAAGGGCAAGGGTGTGG - Intronic
1098777660 12:74641739-74641761 CATCCACAGTGGTGTTGGTGTGG - Intergenic
1099321778 12:81160022-81160044 CTTCCACAATGACAGTGGTGTGG + Intronic
1102682968 12:114702961-114702983 CTACCACAAAGGCCCTGCTGGGG - Intergenic
1103484549 12:121273979-121274001 CTTCCACAGAGGCCCTGCTGGGG + Intronic
1104067893 12:125320188-125320210 TATCAACAATGGCCCAGCTGGGG + Intronic
1107623730 13:42260740-42260762 CATACACAATGGTCATGATGAGG + Intergenic
1108450704 13:50559831-50559853 AAGCCACAAAGGCCCTGTTGGGG - Intronic
1112571944 13:100601245-100601267 CATCTGCAAAGGCCCTGCTGCGG - Intergenic
1114614760 14:24062507-24062529 CATCCACTATGGAGCTGGTTAGG - Exonic
1120312603 14:82849963-82849985 CATTCACAATGGTCATGATGTGG + Intergenic
1121820187 14:96959598-96959620 GATCCCCAAGGGCCCTGATGGGG - Intergenic
1123948501 15:25250389-25250411 CATGCCCCATGGTCCTGGTGTGG + Intergenic
1126416669 15:48425079-48425101 CAGCTTCAATGGCTCTGGTGGGG - Intronic
1129858267 15:78840696-78840718 CCTCCCCCATGGCCTTGGTGTGG + Intronic
1130684724 15:86026823-86026845 CATCCACGCTGGTCCAGGTGAGG + Intergenic
1133060570 16:3171860-3171882 CATCCACACTGGGCTTGGTAGGG - Intergenic
1135326064 16:21526571-21526593 CAGCCACAAGAGCCCTGGGGTGG + Intergenic
1135328780 16:21544478-21544500 CATCCACAGTAGCCCGGGCGCGG - Intergenic
1136339130 16:29630452-29630474 CATCCACAGTAGCCCGGGCGCGG - Intergenic
1137247828 16:46719885-46719907 CATATACAATGGGCCTGATGTGG + Intronic
1137511892 16:49107900-49107922 CATCCTCTGTGGCCCTGGAGTGG - Intergenic
1139426754 16:66885313-66885335 CATCCCCAAAGGCCCTGCAGGGG - Exonic
1140860411 16:79013111-79013133 CCTCCAGAATTGCCCTGTTGAGG + Intronic
1142039102 16:87881296-87881318 CAGCCACAAGAGCCCTGGGGTGG + Intergenic
1142041800 16:87899023-87899045 CATCCACAGTAGCCCAGGTATGG - Intronic
1143336855 17:6178051-6178073 CATACACCATGGCCCTGATTAGG - Intergenic
1146729973 17:35184864-35184886 CATCCAACATGGCCATGGGGTGG - Intronic
1147624808 17:41893127-41893149 CCCACACAATGGCCTTGGTGTGG + Exonic
1150226545 17:63527651-63527673 CCTCCTCCAGGGCCCTGGTGAGG + Intronic
1151914173 17:77105254-77105276 CAGTCACCATGGCCCTGGAGTGG - Intronic
1152805534 17:82354104-82354126 CATCCACAGTGGCAAGGGTGGGG - Intergenic
1163080415 19:14936157-14936179 CTTCCAAAAATGCCCTGGTGAGG - Intergenic
1163125259 19:15241009-15241031 AAACCACAATGCCCCAGGTGTGG + Intronic
1163783053 19:19260643-19260665 CATCGCCAATGTCCCTGGGGAGG + Intronic
1165935858 19:39388663-39388685 CATCCATCATGCCCCTGGTTGGG + Exonic
1167011709 19:46813136-46813158 CATCCTCAAAGGCCCACGTGGGG - Intergenic
1167012258 19:46816366-46816388 CATCCTCAAAGGCCCATGTGGGG + Intergenic
1167455838 19:49596447-49596469 CATCCAGGCTGGCACTGGTGCGG - Exonic
1167569500 19:50278074-50278096 CATGCACCTTTGCCCTGGTGTGG - Exonic
1168147571 19:54428656-54428678 CATTCTCTCTGGCCCTGGTGGGG + Intronic
1168224320 19:54983279-54983301 CGTCCCCAATGTCCCAGGTGTGG - Exonic
926763764 2:16304103-16304125 AATCAACAATGTCCCTGATGCGG - Intergenic
927989149 2:27435211-27435233 CATCAAGATTGGCTCTGGTGAGG + Exonic
929319545 2:40526250-40526272 CCTCCACAATCACCCTAGTGAGG + Intronic
931913969 2:66932908-66932930 CAGCCACAATGGCCCTCCTTTGG - Intergenic
932083780 2:68739304-68739326 GATGCCCAATGGCCCTGGCGTGG + Intronic
932599268 2:73112763-73112785 TCTCCGCCATGGCCCTGGTGCGG - Exonic
933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG + Intronic
936343914 2:111660835-111660857 CTTTCAAAATGGGCCTGGTGTGG - Intergenic
937474954 2:122207075-122207097 CATCTGGAATGGCCCTGCTGGGG - Intergenic
938786792 2:134637189-134637211 CACAGACAGTGGCCCTGGTGGGG - Intronic
939102774 2:137914665-137914687 CATCAAAAATGACCCAGGTGCGG + Intergenic
943063406 2:183061858-183061880 CCTCCACATTGGCTCTGCTGGGG - Intergenic
946083775 2:217150663-217150685 AATCCAGAGTGGCCCAGGTGTGG + Intergenic
947853961 2:233310795-233310817 CAGCCACAATGGGCCAGGTGCGG - Intronic
1170965878 20:21070911-21070933 AATCAACAATGGGCCAGGTGTGG - Intergenic
1175779662 20:61674346-61674368 CTTCCACAAGGGCCCTGGTCTGG - Intronic
1178925117 21:36768319-36768341 CTTCCACAGTGGTCCTGCTGAGG + Intronic
1180830320 22:18902420-18902442 CTGCCTCACTGGCCCTGGTGAGG - Intergenic
1181069392 22:20323113-20323135 CTGCCTCACTGGCCCTGGTGAGG + Intergenic
1181097874 22:20518403-20518425 CATCCAGAAAGGGCATGGTGTGG - Intronic
1181487512 22:23241102-23241124 CATCCACAATGGCCAAGAGGTGG - Intronic
1182577555 22:31283179-31283201 CATCCACAATCTCACAGGTGGGG + Exonic
1183829430 22:40409938-40409960 CATCCCTAAGGACCCTGGTGGGG - Exonic
1184415179 22:44348016-44348038 CATCCTCAAGTCCCCTGGTGGGG - Intergenic
1184714415 22:46272851-46272873 CATCCAGAGTGGCCAGGGTGAGG + Intronic
1185293366 22:50040131-50040153 CATCCACACTGGCACATGTGAGG - Intronic
1203280409 22_KI270734v1_random:127691-127713 CTGCCTCACTGGCCCTGGTGAGG - Intergenic
950398327 3:12751155-12751177 CATTCACAATGGCCCTGCTAAGG - Intronic
953062140 3:39435844-39435866 AATCCACACAGGGCCTGGTGAGG + Intergenic
953569245 3:44058187-44058209 GACCCACAATGCCCCTGGAGAGG - Intergenic
953853042 3:46480389-46480411 CAGGCACAATGGGCATGGTGTGG - Intronic
954496226 3:50966245-50966267 CATCCACAATAGCCAAGGGGTGG - Intronic
962150981 3:132893203-132893225 CATTCTCAATGGTCCTGGGGGGG + Intergenic
962316710 3:134363883-134363905 CAACCTCTAAGGCCCTGGTGGGG + Intronic
962426097 3:135270654-135270676 CAGCAACATGGGCCCTGGTGTGG - Intergenic
962689699 3:137881750-137881772 CATCCTCAATGTCTCTGCTGTGG + Intergenic
968832503 4:2940339-2940361 CATCCACATGGGCCCAGGAGTGG - Intronic
970400362 4:15711634-15711656 AATCCACAAGGAGCCTGGTGAGG - Intronic
972010135 4:34168769-34168791 AATACACAATGGGCCAGGTGTGG + Intergenic
976478903 4:85516035-85516057 CATAGACAATGGCCCTGGCTGGG - Intronic
979552939 4:122011440-122011462 TATGCACAAAGGCCCTGGTCAGG - Intergenic
985632195 5:1019529-1019551 CCTCCACGAGGGCCCTGCTGTGG - Intronic
985883461 5:2658002-2658024 CATTCCCCATGGCCCTGGCGGGG + Intergenic
986266867 5:6198191-6198213 CATCCATAATGGTGCTGCTGTGG - Intergenic
992067906 5:73124166-73124188 CATACACAATGGTGCTGCTGTGG + Intronic
992286351 5:75239484-75239506 CATACACAGTGGCCCTGGCTGGG + Intergenic
992410216 5:76498129-76498151 CAATCACAATGTCCATGGTGGGG - Intronic
996315238 5:122153742-122153764 TATTCACAATGGCCCAAGTGGGG - Intronic
996554860 5:124768034-124768056 CATCAACATGGGCCCTGGTGAGG - Intergenic
998108998 5:139486781-139486803 CACACACAAAGGCCCTGGAGTGG + Intergenic
1001415523 5:171542666-171542688 CATACACACTGGCCCTGGCATGG + Intergenic
1002486630 5:179542574-179542596 TATCCAGAATGGGCCAGGTGCGG + Intergenic
1017078998 6:150649395-150649417 GATACACAATAGCACTGGTGGGG - Intronic
1019099171 6:169613590-169613612 CATCGCCAATGGCCGTGGTCAGG + Exonic
1019879042 7:3842220-3842242 CATCCCCACTGGCCCAGTTGTGG + Intronic
1021659409 7:22904948-22904970 CATCCACAAGACTCCTGGTGAGG + Intergenic
1024095606 7:45980211-45980233 CATCCCCAAGGCCCCTCGTGAGG + Intergenic
1024215570 7:47245647-47245669 CGTCCCCCATGGCCCTGGTGTGG + Intergenic
1026149988 7:67779778-67779800 AATCCAAAATGGGCCTGGTGTGG + Intergenic
1026336729 7:69400316-69400338 CATACAGAGTGGGCCTGGTGTGG + Intergenic
1026863872 7:73810888-73810910 CATCCTCCCAGGCCCTGGTGGGG + Intronic
1027866886 7:83659476-83659498 CATGCACAAAGGCCCTGAAGTGG - Intergenic
1029605071 7:101593764-101593786 GATCCACATTGGCCCTGGCTCGG + Intergenic
1031702707 7:124945027-124945049 CATGCACAAATGCGCTGGTGGGG - Intergenic
1032475410 7:132208437-132208459 CATCCACCATGGGCCAGGTCTGG - Intronic
1033581853 7:142745295-142745317 CAAACACAGTGGCCCTGGGGTGG + Intergenic
1035315889 7:157997483-157997505 CATCCACACTGGCCCTGCAAGGG + Intronic
1035695432 8:1592067-1592089 TATCCACCATGGCCCTTGTTGGG + Intronic
1037066896 8:14593043-14593065 CAACCACACCTGCCCTGGTGTGG + Intronic
1039580185 8:38659412-38659434 CCTCCAAGATGGCTCTGGTGGGG + Intergenic
1047721557 8:127644877-127644899 CATCCACAATGGCCCTGGGGTGG - Intergenic
1049763249 8:144340254-144340276 ATTCCAAAATGGCTCTGGTGGGG + Intergenic
1050371230 9:4923433-4923455 CATCTAGAATGGCCCTGGCTGGG + Intergenic
1055344037 9:75315153-75315175 TATTCACAATGGCCATGATGTGG - Intergenic
1056116631 9:83447389-83447411 CATCCAGTGTGGCCCTGTTGGGG + Intronic
1057416179 9:94864040-94864062 CATCCAAATTGGCCCATGTGTGG - Intronic
1057762881 9:97890707-97890729 GTTCCACAATGCCCATGGTGTGG + Intergenic
1058548813 9:106091161-106091183 CATCCACAATGGTCCTTGCGAGG + Intergenic
1060037061 9:120264617-120264639 CATCCACTGTGGCCATGGTAGGG - Intergenic
1060510048 9:124225069-124225091 CAGTCACAGTGGCCCTTGTGAGG + Intergenic
1062046504 9:134426877-134426899 TGTCCACACTGGGCCTGGTGTGG + Intronic
1189121493 X:38399932-38399954 TATCCCCACTGACCCTGGTGTGG + Intronic
1190440170 X:50469255-50469277 CATTCCAATTGGCCCTGGTGCGG + Intronic
1190599011 X:52070518-52070540 CATACACAGGGGTCCTGGTGAGG - Intergenic
1190609813 X:52183555-52183577 CATACACAGGGGTCCTGGTGAGG + Intergenic
1190641435 X:52484597-52484619 CATCCACGACGGCCATGGTGGGG + Intergenic
1190646237 X:52528268-52528290 CATCCACGACGGCCATGGTGGGG - Intergenic
1190794967 X:53732267-53732289 CATCAACAAAGGCACTGGAGTGG + Intergenic
1192833220 X:74772346-74772368 CTTCCAGGATAGCCCTGGTGGGG - Intronic
1196354558 X:114775294-114775316 CATCCTCAATGTCTCTGCTGTGG - Intronic