ID: 1084701410

View in Genome Browser
Species Human (GRCh38)
Location 11:70788609-70788631
Sequence CACCCAATGGGGGTCTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084701400_1084701410 -10 Left 1084701400 11:70788596-70788618 CCCCCATTTCAGGCACCCAATGG 0: 1
1: 0
2: 2
3: 37
4: 269
Right 1084701410 11:70788609-70788631 CACCCAATGGGGGTCTTGGGAGG 0: 1
1: 0
2: 2
3: 22
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084701410 Original CRISPR CACCCAATGGGGGTCTTGGG AGG Intronic
900313727 1:2047137-2047159 CACCCACTAGGGGTCTTAGGAGG + Intergenic
900745479 1:4357810-4357832 CACCCACTGGAGGTCTTGAGAGG + Intergenic
901946934 1:12711789-12711811 GTCCCACTGGGGGTCTCGGGTGG + Intergenic
902894673 1:19470998-19471020 CATCCACTGGGGGTCTTGGAAGG - Intronic
902977406 1:20098866-20098888 GACCCAGTGGGAGTCCTGGGGGG - Intergenic
903759456 1:25687596-25687618 CACACGATGGGGGTGATGGGGGG - Intronic
904462397 1:30687909-30687931 CACCCATGGGGGGTGTTGAGTGG - Intergenic
904617685 1:31758727-31758749 AACTCCATGTGGGTCTTGGGAGG - Intronic
904949812 1:34227679-34227701 CACCCAAATGGGGCCTTGAGAGG + Intergenic
905770903 1:40637209-40637231 CACCCAATGGTGGGCTGGGGAGG + Intronic
907566630 1:55440913-55440935 CACACACTGGGGCTGTTGGGAGG + Intergenic
907982656 1:59499233-59499255 CATCCACTGGGGGTCTTGGAAGG - Intronic
909128962 1:71711088-71711110 CACCCAATGGGAGGCTGAGGCGG + Intronic
910586978 1:88891230-88891252 CACCCTATGTGGGTCCTGGTGGG - Intronic
912127730 1:106560595-106560617 CACACACTGGGGCTTTTGGGGGG + Intergenic
912625241 1:111200722-111200744 CACACCCTGGGGCTCTTGGGAGG - Intronic
912871066 1:113307135-113307157 CAACCACTGGGGGGCTTGGAAGG - Intergenic
917312187 1:173689783-173689805 GTCCCACTGGGGGTCTCGGGTGG + Intergenic
1063086451 10:2822528-2822550 AGCCCCATGAGGGTCTTGGGTGG + Intergenic
1064006433 10:11702833-11702855 CATCAAATGGGGGGTTTGGGGGG + Intergenic
1064281281 10:13953829-13953851 CACCCACTGAGGCTCTTGGAAGG + Intronic
1065412085 10:25440382-25440404 CAATCAATGGGGGTGTTGAGTGG - Intronic
1065473552 10:26109580-26109602 AATCCACTGGAGGTCTTGGGAGG + Intronic
1070992040 10:80741059-80741081 GTCCCACTGAGGGTCTTGGGTGG - Intergenic
1071201805 10:83227935-83227957 CATCCACTGGGGGTTTTGGCAGG + Intergenic
1073917234 10:108419786-108419808 CATCCACTGGGGGGCTTGGAAGG - Intergenic
1076325361 10:129616518-129616540 CGGCCAATGGGGGGCCTGGGAGG - Intronic
1076805599 10:132857100-132857122 CACCCAAAAGGGTTCTAGGGTGG - Intronic
1078184484 11:9040139-9040161 CACCCACTGGGGGTCTTGGATGG - Intronic
1080108273 11:28535750-28535772 CATCCACTGGGGGTCTTGGAAGG - Intergenic
1081489037 11:43553237-43553259 CAGCCAATGGGGGCCCTGAGAGG - Intergenic
1081647817 11:44802202-44802224 CAGCCCCTGGGGGTCTTTGGTGG + Intronic
1084701410 11:70788609-70788631 CACCCAATGGGGGTCTTGGGAGG + Intronic
1085615498 11:77994919-77994941 AACCCAATGGGAGCTTTGGGAGG + Intergenic
1085742425 11:79088564-79088586 TACCCAATAGGGTTGTTGGGGGG + Intronic
1086987046 11:93261853-93261875 ATCCCACCGGGGGTCTTGGGTGG - Intergenic
1088107588 11:106223952-106223974 GTCCCACTGGGGGTCTTGGGTGG - Intergenic
1093756596 12:22859799-22859821 TATCCACTGGGGGTCTTGGAAGG + Intergenic
1095095299 12:38144521-38144543 CACCCATGGGGAGTCATGGGCGG + Intergenic
1095221339 12:39619849-39619871 CAGCCAATGAGGGGCCTGGGAGG - Intergenic
1097450531 12:59732978-59733000 CACCCAAAAGGGCTCTTGGGAGG + Intronic
1097678711 12:62629505-62629527 CACCCACTGGGTGGCCTGGGAGG + Intergenic
1097756870 12:63416363-63416385 GTCCCACTGGGGATCTTGGGTGG - Intergenic
1100162917 12:91881915-91881937 CATCCACTGGGGGTCTTGAAAGG + Intergenic
1102040205 12:109796161-109796183 TATCCCATGGGGTTCTTGGGAGG - Intronic
1102734364 12:115145244-115145266 CAGACACTGGGGGTTTTGGGTGG - Intergenic
1103737149 12:123067874-123067896 CAGCCAATGGGTCTCTTGGCTGG + Intronic
1104490037 12:129186133-129186155 ATCCCCATGGGGGCCTTGGGTGG - Intronic
1106061787 13:26300209-26300231 CATCCACTGGGGGTCTTGAAAGG - Intronic
1108676191 13:52739525-52739547 CACCGAATGGGTGTGTTGGCGGG - Intronic
1109215300 13:59583070-59583092 CCCCCACTGAGGGCCTTGGGTGG + Intergenic
1110009022 13:70308106-70308128 CAGTCAATGGGGGTTTTGGGCGG + Intergenic
1113766199 13:112882414-112882436 CACCCTATGGAGGGCATGGGTGG - Exonic
1118901028 14:69985986-69986008 CATCCACTGGGGGTCTTGGAAGG + Intronic
1119384132 14:74246554-74246576 CACCCAATTGGGTTCTTGTGAGG + Intronic
1119966856 14:78926155-78926177 CTTCCACTGGGGGTCTTGGAAGG - Intronic
1122705014 14:103615439-103615461 CAGCCACTGGGGGGCTGGGGTGG - Intronic
1202843379 14_GL000009v2_random:144833-144855 CACCCCAGGGGGGTCCTGGTTGG - Intergenic
1202912775 14_GL000194v1_random:135071-135093 CACCCCAGGGGGGTCCTGGTTGG - Intergenic
1202879867 14_KI270722v1_random:47609-47631 CACCCCAGGGGGGTCCTGGTTGG + Intergenic
1123804210 15:23854680-23854702 CAGCCAATGGGGGCCTCTGGTGG - Intergenic
1124557845 15:30744663-30744685 CACCCAATGGGCTTAATGGGAGG - Intronic
1125894591 15:43291946-43291968 TACCCAATGTGGGCCTGGGGTGG - Intronic
1127237083 15:57065628-57065650 CACTCAAGGGGGGTGGTGGGGGG - Intronic
1132063033 15:98708259-98708281 TTCCCAGTGGGGGTCTTGGTTGG + Intronic
1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG + Intronic
1133960343 16:10487492-10487514 GTCCCACTGGGGGTCTTCGGTGG - Intergenic
1135132910 16:19867582-19867604 CACCTTTTGGGGGTCATGGGTGG + Intronic
1141437295 16:84007488-84007510 GACCCTGTGGGGGTATTGGGAGG - Intergenic
1141684407 16:85562062-85562084 CGCCCAGAGTGGGTCTTGGGTGG - Intergenic
1141723199 16:85768254-85768276 CACCCACTGGAGGCCTTGGGAGG - Intergenic
1143995865 17:11005980-11006002 GACTCAAAGGGGGTCTTGAGGGG - Intergenic
1144753795 17:17667703-17667725 CAACAGGTGGGGGTCTTGGGAGG + Intergenic
1146968939 17:37056681-37056703 CACCCAGTGGGCGCCTTGGCTGG + Exonic
1147331173 17:39700304-39700326 CACCCAAGGTGGGTCTGGTGTGG + Exonic
1150308705 17:64109470-64109492 CAAACAATGGGGGTCCTGGCTGG - Intronic
1152390389 17:80000807-80000829 CACCCCCTGCGGGTCTTGAGTGG + Intronic
1153129443 18:1837832-1837854 CACCCAATGGTGGTAGTGGTAGG - Intergenic
1155958929 18:31977642-31977664 GTCCCACTGGGGGTCTTAGGCGG + Intergenic
1156710966 18:39945099-39945121 ATCCCACTGGGGGACTTGGGGGG + Intergenic
1160778581 19:867908-867930 CACCAAATCGAGGTCGTGGGTGG + Intronic
1160959776 19:1715152-1715174 CAAACAATGCGTGTCTTGGGTGG - Intergenic
1161319383 19:3633935-3633957 CTCTCTATGGGGGTCCTGGGAGG + Intronic
1162268412 19:9594934-9594956 GTCCCACCGGGGGTCTTGGGTGG + Intergenic
1163439414 19:17314170-17314192 CCCCCGATTGGGGTCTTGGCTGG + Intronic
1168449811 19:56457531-56457553 CACCTTATGGGGTTGTTGGGAGG + Intronic
1202655485 1_KI270708v1_random:16629-16651 CACCCCAGGGGGGTCCTGGTTGG + Intergenic
925139069 2:1537579-1537601 CACACAATGGGGGGATTTGGGGG - Intronic
925869579 2:8257672-8257694 GACCCCATGGGGGCGTTGGGAGG - Intergenic
927786437 2:25978297-25978319 CACCCCTTGGGGTTGTTGGGAGG + Intronic
928471798 2:31582226-31582248 CACTGAATGGGGCTCCTGGGAGG - Intergenic
931643559 2:64401842-64401864 CAACTACTGGGGGGCTTGGGGGG + Intergenic
934879668 2:97964975-97964997 CACCCACTGGGAGCCATGGGCGG + Intronic
937237146 2:120437790-120437812 CACCCAATGGGGATCCAGGGTGG - Intergenic
937283208 2:120734905-120734927 CACCCGAAGAGGGTCTTGGGGGG - Intergenic
937790155 2:125951906-125951928 CATTCACTGGGGGTCTTGGAAGG + Intergenic
947843330 2:233223634-233223656 CACTCAAAGGGGATTTTGGGGGG + Intronic
948886846 2:240888918-240888940 CCCCCAAGGGAGGTCCTGGGGGG - Intronic
1169082365 20:2805243-2805265 GATCCAAAGGGGGTCTTGGAGGG - Intergenic
1169952596 20:11062481-11062503 CCCCCCAGGGTGGTCTTGGGCGG + Intergenic
1170485010 20:16807212-16807234 CTCCCCATGGAGGTCTTGGCTGG - Intergenic
1172625369 20:36343622-36343644 CACCCAACGGGGGGTTGGGGGGG - Intronic
1173421083 20:42901679-42901701 CAGCCCATGGGGGTCTTGTGGGG - Intronic
1176632135 21:9149751-9149773 CACCCCAGGGGGGTCCTGGTTGG - Intergenic
1176641172 21:9305072-9305094 CACCCCAGGGGGGTCCTGGTTGG + Intergenic
1179180057 21:39037358-39037380 CACGCAATGGGGAGCCTGGGAGG - Intergenic
1183216862 22:36486334-36486356 GTCCCACTGGGGGTCTTGGGTGG + Intergenic
1184064977 22:42113382-42113404 GTCCCACCGGGGGTCTTGGGTGG + Intergenic
1184279477 22:43428819-43428841 AACCCTATGGGGGTCTCAGGAGG + Intronic
1184751303 22:46488004-46488026 CAGCTAATGGGGGTGTGGGGAGG + Intronic
951279501 3:20731328-20731350 CACCCACTGTGGGTCTATGGTGG - Intergenic
952125120 3:30290961-30290983 CACCTAAGGGGGGTCATGGGAGG - Intergenic
952958353 3:38574606-38574628 CACCCAATCAGGGTGATGGGAGG - Intronic
953576049 3:44114009-44114031 CATCCCATAGGGGTCATGGGTGG - Intergenic
953621216 3:44534543-44534565 CACCCAAGGGGAGCCATGGGCGG + Intergenic
954582291 3:51709446-51709468 CACCCAAATGGGGGCTAGGGAGG + Intronic
954889861 3:53915682-53915704 CATCCACTGGGTGTCTTGGAAGG + Intergenic
957354816 3:79068165-79068187 CACCATATGGGGATCTTTGGAGG + Intronic
958809825 3:98848131-98848153 CACACACTGGGGCTTTTGGGAGG - Intronic
961446841 3:126984970-126984992 CCCACAACGGGGGTCATGGGAGG - Intergenic
961582301 3:127892697-127892719 GTCCCACTGGGGGTCTCGGGTGG - Intergenic
964199725 3:154105557-154105579 CACGCAAAGGGGATGTTGGGGGG - Intergenic
964446745 3:156767146-156767168 CATCCACTGGGGTTCTTGGAAGG - Intergenic
964542823 3:157798683-157798705 CACACACTGGGGGTGTTGGGGGG - Intergenic
966221918 3:177559822-177559844 CATCCATGGGGGGTCTTGGAAGG + Intergenic
967792249 3:193561826-193561848 GTCCCAATGGAGGTCTTTGGGGG + Intronic
1202745724 3_GL000221v1_random:99954-99976 CACCCCAGGGGGGTCCTGGTTGG - Intergenic
968513448 4:1005221-1005243 CAGCCAAGGGTGGCCTTGGGAGG - Intergenic
969470453 4:7384639-7384661 CTCCCAAGAAGGGTCTTGGGTGG - Intronic
969900490 4:10344747-10344769 CAACCCATGTGAGTCTTGGGTGG - Intergenic
970889963 4:21032300-21032322 TACCCAATGGGGGTGTTGTCTGG + Intronic
974071928 4:57131744-57131766 CATCAAATGGTGGGCTTGGGGGG + Intergenic
978310653 4:107381958-107381980 GTCCCAATGGGGGTCTTGAGTGG - Intergenic
984671532 4:182494525-182494547 TATCCACTGGGGGTCTTGGAAGG + Intronic
984907299 4:184640512-184640534 CATCTACTGGGGGACTTGGGAGG - Intronic
1202756060 4_GL000008v2_random:63339-63361 CACCCCAGGGGGGTCCTGGTTGG + Intergenic
985627569 5:997821-997843 CTCCCAGTGGGGGTCTGAGGTGG + Intergenic
998404990 5:141869245-141869267 CTCCCAATGAGGGTGTTGGGTGG + Exonic
998413504 5:141928820-141928842 CACCCCATAGGTTTCTTGGGAGG + Intronic
1002182787 5:177440215-177440237 CTCCCAGTGTGGGTCTGGGGAGG + Intronic
1004743536 6:18487398-18487420 TACCCAAGGGGGTTCATGGGAGG + Intergenic
1006019411 6:31109002-31109024 CACCCAATGGGGTTGTTGTGAGG + Intergenic
1006076028 6:31532999-31533021 CACCCCATGGGGGGATGGGGAGG + Intronic
1007712210 6:43831594-43831616 CAGCCATTGAGGGTCGTGGGAGG - Intergenic
1016195096 6:141326205-141326227 CATCCACTGGCGGTCTTGGCAGG - Intergenic
1016371027 6:143374269-143374291 GACTCAAAGGGGGTCTTGAGAGG + Intergenic
1019292480 7:257470-257492 CTGCCACGGGGGGTCTTGGGCGG + Intronic
1022325982 7:29332285-29332307 TACCCTGTGGGGTTCTTGGGAGG + Intronic
1023396545 7:39757123-39757145 TTCCCACTGGGGGTCTTTGGTGG - Intergenic
1024023407 7:45391215-45391237 CATCCACCGGGGGTCTTGGAAGG + Intergenic
1024760932 7:52595176-52595198 CAGCCTATGGGGATTTTGGGTGG + Intergenic
1026114122 7:67481852-67481874 CATCCACTGGGGGTCTTGGAAGG - Intergenic
1028586012 7:92452491-92452513 CAGCCATTCTGGGTCTTGGGTGG - Intronic
1028880283 7:95872267-95872289 GACACAATGAGGCTCTTGGGTGG + Intronic
1032450358 7:132025223-132025245 CCCCAAATGGGAGTCTTGGCCGG - Intergenic
1036647767 8:10622855-10622877 GGTCCACTGGGGGTCTTGGGGGG + Exonic
1037663127 8:20944029-20944051 CACCCAAGGGGATTCTAGGGAGG + Intergenic
1044847921 8:96399794-96399816 CACCTCAAGGGGTTCTTGGGAGG - Intergenic
1045665559 8:104480629-104480651 CATCCACTGGGGGTCTTGACAGG - Intergenic
1047334536 8:123922975-123922997 GACAGAATGGGGGTCTGGGGGGG - Intronic
1047898526 8:129394090-129394112 CATCCACTGGGGGTCTTGGGAGG - Intergenic
1049395423 8:142398014-142398036 CAGCCTGTGAGGGTCTTGGGAGG - Intronic
1050480319 9:6081188-6081210 GTCCCACTGGGGGTCTCGGGTGG - Intergenic
1050584001 9:7091062-7091084 CAAGCAATGGAGGTTTTGGGGGG - Intergenic
1055085153 9:72306188-72306210 CATCTAATGGGGGGCTTGGAAGG - Intergenic
1056600319 9:88042058-88042080 GTCCCACTGTGGGTCTTGGGTGG + Intergenic
1056719799 9:89061928-89061950 CATCCACTGGGGGACTTGGATGG + Intronic
1056972301 9:91216379-91216401 CACCAAATGGGAGTATTGTGAGG + Intronic
1058585476 9:106502269-106502291 CACTCAGTGGTGGACTTGGGAGG - Intergenic
1059409020 9:114120450-114120472 CACCTTATGGGATTCTTGGGAGG - Intergenic
1060006817 9:120007859-120007881 CAGCCAAGGGGGGTTTAGGGAGG + Intergenic
1062020117 9:134315455-134315477 CACTCGATGGGAGCCTTGGGGGG - Intergenic
1203754962 Un_GL000218v1:117370-117392 CACCCCAGGGGGGTCCTGGTTGG - Intergenic
1203714343 Un_KI270742v1:129910-129932 CACCCCAGGGGGGTCCTGGTTGG - Intergenic
1203536863 Un_KI270743v1:48176-48198 CACCCCAGGGGGGTCCTGGTTGG + Intergenic
1187240550 X:17509142-17509164 CAGCAAATGGTGGTGTTGGGAGG + Intronic
1187847778 X:23558669-23558691 CATCCACTGGAGGTCTTGGAAGG - Intergenic
1189613194 X:42758964-42758986 CCCCTTATGGGGGTGTTGGGTGG + Intergenic
1190107770 X:47571813-47571835 CACCCCATGTGGATTTTGGGGGG + Exonic
1193775983 X:85642099-85642121 CACCCACTGGGGGCATTGAGGGG - Intergenic
1194214444 X:91110969-91110991 CAGCCACTGTGGGTGTTGGGAGG + Intergenic
1199550500 X:149056645-149056667 CAGCCAATGGTAGTCCTGGGTGG - Intergenic
1199757064 X:150874551-150874573 CACCAAATGGGGGGCGGGGGCGG + Intronic
1200096355 X:153665956-153665978 GACTCAATGGGGGTGGTGGGGGG - Intergenic
1201168585 Y:11234979-11235001 CACCCCAGGGGGGTCCTGGCTGG - Intergenic