ID: 1084704180

View in Genome Browser
Species Human (GRCh38)
Location 11:70806371-70806393
Sequence AAGTAGGGTTGGAGGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1066
Summary {0: 1, 1: 0, 2: 5, 3: 55, 4: 1005}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084704180_1084704188 19 Left 1084704180 11:70806371-70806393 CCAACTTCCCTCCAACCCTACTT 0: 1
1: 0
2: 5
3: 55
4: 1005
Right 1084704188 11:70806413-70806435 CACACACCTGACTTCCCCCTGGG 0: 1
1: 0
2: 0
3: 14
4: 219
1084704180_1084704187 18 Left 1084704180 11:70806371-70806393 CCAACTTCCCTCCAACCCTACTT 0: 1
1: 0
2: 5
3: 55
4: 1005
Right 1084704187 11:70806412-70806434 TCACACACCTGACTTCCCCCTGG 0: 1
1: 0
2: 0
3: 14
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084704180 Original CRISPR AAGTAGGGTTGGAGGGAAGT TGG (reversed) Intronic
900255739 1:1697576-1697598 AAGTCTGGTTGGGGGGTAGTAGG - Intronic
900562667 1:3315168-3315190 AGGGAGGGTGGGAGGGAAGCAGG - Intronic
900605901 1:3523418-3523440 AGGGAGGGTTAGAGGGAAGCAGG - Intronic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
900993178 1:6107155-6107177 ATGGAGGGATGGAGGGAAGGTGG + Intronic
901467791 1:9433916-9433938 AGGTAGAGTTGAAGGGAGGTGGG - Intergenic
901884103 1:12210740-12210762 AAGTAGGGGTGGGGGGAAGTGGG - Intergenic
901895793 1:12310864-12310886 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
901895796 1:12310872-12310894 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
901895799 1:12310880-12310902 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
901895802 1:12310888-12310910 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
902166642 1:14577490-14577512 AAGTAGCTTTGGAGGGCTGTCGG + Intergenic
902464429 1:16607237-16607259 AAAGAGAGTTGGAGGGAAGTAGG + Intronic
902665639 1:17935772-17935794 AAGAAGGGAGGGAGGGAAGAAGG - Intergenic
902688922 1:18097423-18097445 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
902699744 1:18163661-18163683 CAATGGGGTTGCAGGGAAGTTGG - Intronic
903156390 1:21446494-21446516 AAAGAGAGTTGGAGGGAAGTAGG - Intronic
903294050 1:22332473-22332495 CAGTAGGCTTTGAGGAAAGTAGG - Intergenic
903995067 1:27300518-27300540 AAGCATGGATGAAGGGAAGTGGG - Intronic
904422268 1:30402000-30402022 AGGAAGGGATGGAGGGAAGGAGG - Intergenic
904615386 1:31746717-31746739 GAGAAGGGCTGCAGGGAAGTTGG - Intronic
904727189 1:32558144-32558166 AAGGAGGGAAGTAGGGAAGTAGG + Intronic
905094404 1:35456841-35456863 AAGGAGAGATGGAGGGAAGGAGG + Intronic
905481931 1:38267810-38267832 AAGAAGGGATGGAGGGAGGAAGG - Intergenic
905537054 1:38730280-38730302 AAGGTGGATTGGAGGGCAGTGGG + Intergenic
905885523 1:41489773-41489795 AAGGTGGGTTGGAGGAAAGGTGG - Intergenic
906558917 1:46739566-46739588 AAGGAGGGAAGGAGGGAAGAAGG - Intergenic
906764785 1:48418798-48418820 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
906827907 1:49001560-49001582 AATTAGGGTTGGAGTCAAGGAGG - Intronic
907014618 1:50999793-50999815 AGCGGGGGTTGGAGGGAAGTGGG + Intergenic
907193201 1:52665702-52665724 AAGAAGGATGGGAGGGAGGTGGG - Intronic
907325901 1:53638532-53638554 CAGTGGGGTTGGGGGGCAGTGGG - Intronic
908149543 1:61285660-61285682 AAATAGGGGTGGAGGGTAGGGGG + Intronic
908715317 1:67063638-67063660 ACGTGGGGTGGGAGGGGAGTAGG + Intergenic
909556130 1:76956511-76956533 AGCTAGGGGAGGAGGGAAGTTGG - Intronic
909897716 1:81094010-81094032 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
910521261 1:88124725-88124747 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
910820060 1:91336398-91336420 AAGAAGGGATGGAGGTAAGGAGG - Intronic
911189519 1:94933648-94933670 AAGTAGGTGTGGAGGTAAGTTGG + Intergenic
912016124 1:105038840-105038862 AAGAAGGGTAGGAGAGAAGCTGG + Intergenic
912308479 1:108595431-108595453 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
912316145 1:108668984-108669006 AAGAAGGGAGGGAGGGAAGAAGG + Intergenic
913993173 1:143634220-143634242 AGAGAGAGTTGGAGGGAAGTAGG + Intergenic
914191912 1:145419221-145419243 AAGTAGGGAAGGAGAGAAGTAGG + Intergenic
914342416 1:146771362-146771384 AAGTAGAGTAGGGGGAAAGTGGG - Intergenic
914362178 1:146944823-146944845 AAAGAGAGTGGGAGGGAAGTAGG - Intronic
914489447 1:148142130-148142152 AAAGAGAGTGGGAGGGAAGTAGG + Intronic
915113019 1:153576669-153576691 AAAGAGGGTGGGAGGGAAGGAGG + Intergenic
915566360 1:156715604-156715626 AAGTGGGGAAGGAGAGAAGTGGG - Intergenic
915570626 1:156743461-156743483 AGGGAGGGTTGGAGGGGAGAAGG + Intronic
915716573 1:157950168-157950190 AGGTAGGGAGGGAGGGAAGGAGG + Intergenic
915927392 1:160033104-160033126 AAGTAGGGTTGGAGTGGGGTGGG - Intergenic
916434069 1:164760368-164760390 AAGAAGGGTGGGAGGGAGGAAGG - Intronic
916482244 1:165225010-165225032 AATTAGGGATGGAGAGAAGGAGG + Intronic
916779534 1:168009514-168009536 AAGAAGGGATGGAGGAAAGAAGG - Intronic
917104278 1:171476736-171476758 CAGTAGGGGTTGAGAGAAGTAGG - Intergenic
917139077 1:171816564-171816586 AAGAAGGGAAGGAGGGAAGGAGG - Intergenic
917739725 1:177950930-177950952 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
917916597 1:179708614-179708636 AGGTAGGGTTGGTGAGAAGCCGG - Intergenic
918018192 1:180659119-180659141 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
918264758 1:182831453-182831475 AAGTAGGGTTGGGGGGCAGTGGG + Intergenic
918482925 1:184998754-184998776 AAGGAAGGAAGGAGGGAAGTAGG + Intergenic
918665566 1:187146704-187146726 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
918857754 1:189780666-189780688 AGGGAGGGATGGAGGGAAGAAGG + Intergenic
918895360 1:190336819-190336841 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
919221132 1:194629906-194629928 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
919392978 1:197010589-197010611 AAGAAGGATGGGAGGGAAGGAGG + Intergenic
919856268 1:201708413-201708435 AAGTAGGGTTTGAGGGGGGAAGG - Intronic
920154542 1:203937669-203937691 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
920634482 1:207686180-207686202 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
920748038 1:208647326-208647348 AAGGAGGGAGGGAGGGAAGGGGG - Intergenic
920984133 1:210868702-210868724 AAGGAAAGTTGGAAGGAAGTGGG - Intronic
922265588 1:223980773-223980795 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
922265595 1:223980789-223980811 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
922271966 1:224043321-224043343 AGGTAGTGTTGGAGGGGAGGGGG - Intergenic
922308655 1:224367297-224367319 AAGTAGGGTTTGGAGGAAGATGG + Intronic
923073544 1:230588725-230588747 AAGTAGGTGTGCAGGTAAGTAGG + Intergenic
923129668 1:231064613-231064635 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
923437967 1:233986293-233986315 AACTTGGGGTGGAGAGAAGTTGG - Intronic
923608171 1:235464417-235464439 AGGGAGGGGTGGAGGGAAGAAGG - Intronic
923688786 1:236173420-236173442 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
923784457 1:237054172-237054194 AAGAAGGGAGGGAGGGAAGGAGG - Intronic
924005138 1:239600732-239600754 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
924091605 1:240507312-240507334 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
924116522 1:240753161-240753183 AAGGAGGGATGGAGGGAGGGAGG - Intergenic
924176179 1:241393539-241393561 AAGTTGGGTTGGATGGATGTAGG + Intergenic
924602573 1:245504375-245504397 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1063156291 10:3382179-3382201 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1063156298 10:3382195-3382217 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1063193326 10:3718064-3718086 AGGGAGGGAAGGAGGGAAGTGGG + Intergenic
1063235998 10:4117299-4117321 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1063576299 10:7265147-7265169 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1064075920 10:12268762-12268784 AAGTAGGGTGGGTGGGGAGTGGG - Intergenic
1064235577 10:13571095-13571117 AAGGAGGGTGGGAGGGCGGTGGG + Intergenic
1065077644 10:22097583-22097605 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1065639802 10:27770302-27770324 AAGAAGGGAGGGAGGGAAGGAGG - Intergenic
1065874328 10:29983844-29983866 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1066066079 10:31761810-31761832 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1066156316 10:32681692-32681714 AAGCAGGGTTGGCCTGAAGTTGG + Intronic
1066261382 10:33732955-33732977 AAGCAGGGAGGGATGGAAGTAGG + Intergenic
1067914669 10:50384473-50384495 AAGCAGGGATGGAGGGAAGGAGG - Intronic
1068250728 10:54436080-54436102 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1068600385 10:58950702-58950724 AAGTAGGGTATGATGGTAGTGGG - Intergenic
1068742865 10:60493918-60493940 TAGTAAGGTGGAAGGGAAGTTGG - Intronic
1068808140 10:61223864-61223886 TAGTAGGATTGGAGGGCAGGGGG + Intergenic
1068810273 10:61247874-61247896 ATGGATGGATGGAGGGAAGTTGG - Intergenic
1069169838 10:65212862-65212884 AAGTAAGGAGGGAGGGAAGAAGG + Intergenic
1069414424 10:68185163-68185185 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1069414427 10:68185171-68185193 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1069668717 10:70183477-70183499 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1069785285 10:70983900-70983922 AAGCTGGGATGGACGGAAGTGGG + Intergenic
1069875730 10:71561856-71561878 AAGGAGGGGAGGAGGGAAGCAGG + Intronic
1069946234 10:71987748-71987770 AAGTAGGGTTGGAAGAAAACAGG + Intronic
1070365598 10:75733785-75733807 AAGTAGGGTTGGAGTGGGTTGGG + Intronic
1070490500 10:76971446-76971468 AAGCAGGTTTGGAGGGTAGTTGG - Intronic
1070567643 10:77615727-77615749 AAGTAGGGTTGGAGGAAAATGGG - Intronic
1070577356 10:77689282-77689304 AAGGAGGGAGGGAGGGAGGTGGG - Intergenic
1071444772 10:85735806-85735828 AAGGAGGGATGGAGGGATGCAGG + Intronic
1071444827 10:85736008-85736030 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1071444829 10:85736016-85736038 AGGGAGGGAAGGAGGGAAGTAGG + Intronic
1071450181 10:85786578-85786600 CAGCAGGGTGGGAGGGATGTCGG - Intronic
1071583480 10:86795646-86795668 TAGTAGGGAGGGAGGGAATTAGG + Intronic
1073161026 10:101395211-101395233 AGGTAGGGTTGGAGAGAGATGGG + Intronic
1073464886 10:103688842-103688864 AAGGAGGGAGGGAGGGAAGAAGG - Intronic
1074326405 10:112455373-112455395 AAGGAGGGAAGGAGGGAAGAAGG - Intronic
1074326431 10:112455428-112455450 AAGGAGGGAAGGAGGGAAGAAGG - Intronic
1074326433 10:112455436-112455458 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1074326436 10:112455444-112455466 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1074326439 10:112455452-112455474 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1074409221 10:113211069-113211091 AAGAAGGGAGGGAGGGAAGAAGG - Intergenic
1074448443 10:113539415-113539437 AAGCAGAGTGGGAGGGAACTTGG - Intergenic
1074827994 10:117228483-117228505 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
1075421972 10:122308603-122308625 AAGCAGGGAAGGAGGGAGGTTGG - Intronic
1076008318 10:126966013-126966035 AAGAAGGGTAGGGGGGAAGTGGG - Intronic
1076563556 10:131382735-131382757 AAGTTGGGTTCCACGGAAGTGGG - Intergenic
1077455927 11:2680714-2680736 GGGTAGGGTGGGAGGGAATTGGG - Intronic
1077457966 11:2692291-2692313 CAATAGGGATGGAGGGAAGCAGG - Intronic
1077779272 11:5307666-5307688 AAGGAGGGAAGGAGGGAAGGGGG - Intronic
1077852039 11:6082446-6082468 ATGTGGGGTTGGGGGGAAGGTGG + Intergenic
1078108189 11:8371818-8371840 AGGAAGGGTGGGAGGGAAGGAGG - Intergenic
1079141586 11:17814059-17814081 AAGGAGGGAGGAAGGGAAGTTGG + Intronic
1079388848 11:20003573-20003595 ACTTAGAGATGGAGGGAAGTGGG - Intronic
1079394602 11:20050885-20050907 AGTTAGGGGTGCAGGGAAGTGGG + Intronic
1079662919 11:23064227-23064249 GAGTAGAGTGGGAGGGAAGCAGG - Intergenic
1079761600 11:24336021-24336043 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1080389846 11:31834790-31834812 AAGTAGGGAGGGAGGGAGGGAGG - Intronic
1080545098 11:33309269-33309291 AAGGAGGGAAGGAGGGAAGAAGG - Intronic
1080828390 11:35867456-35867478 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1080944619 11:36957620-36957642 AAGTGTGTTGGGAGGGAAGTGGG + Intergenic
1081181959 11:39994766-39994788 AAGTTGGGTTGGAGACAAGCAGG - Intergenic
1081591721 11:44427742-44427764 AAGGAGGGTTGGAGGAAACGTGG - Intergenic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1083041053 11:59687901-59687923 ACGTGGGGTTGGAGGGAAGGTGG + Intergenic
1083301664 11:61742787-61742809 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1083577288 11:63801234-63801256 AAGGAGGGAGGGAGGGAGGTTGG + Intergenic
1083683381 11:64361548-64361570 AGGTAGGTTGGCAGGGAAGTGGG + Exonic
1083956215 11:65984297-65984319 TAGTAGGGTGGGATGGGAGTGGG - Intergenic
1084344872 11:68540057-68540079 AGGGAGGGTTGGAGTGAAGGTGG + Intronic
1084512801 11:69616580-69616602 AAGGATGGTTGGAGGGCAGCTGG - Intergenic
1084704180 11:70806371-70806393 AAGTAGGGTTGGAGGGAAGTTGG - Intronic
1084928662 11:72535898-72535920 AAGGAGGGATGGAGGGAGGGAGG + Intergenic
1084949727 11:72657967-72657989 GAGGAGGGGTGGAGGGAAGAGGG + Intronic
1085329698 11:75637814-75637836 AGGGAGGGAGGGAGGGAAGTAGG + Intronic
1085414876 11:76313234-76313256 ATGGGGGGTTGGAGGGATGTGGG + Intergenic
1085446354 11:76603639-76603661 AAGGAGGGATGGAGGGAGGGAGG + Intergenic
1085498916 11:76999604-76999626 AGGTGGGGCAGGAGGGAAGTAGG - Intronic
1085523874 11:77153339-77153361 GAGCAGGGTTGGAGGGAAGGGGG + Intronic
1085632278 11:78128428-78128450 AAGAAGGGTTGGCTGGAGGTAGG - Intronic
1086393269 11:86388169-86388191 AAGGAGGGAGGGAGGGAGGTTGG - Intronic
1086393278 11:86388193-86388215 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1086646751 11:89231642-89231664 GGGGTGGGTTGGAGGGAAGTTGG + Intronic
1086700801 11:89898575-89898597 AAGTTGGTGTGGTGGGAAGTTGG - Intergenic
1086705368 11:89945952-89945974 AAGTTGGTGTGGTGGGAAGTTGG + Intergenic
1087237172 11:95733044-95733066 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1087400480 11:97659337-97659359 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1087513027 11:99122128-99122150 AAGTGGAGTTGGGGGGAGGTTGG - Intronic
1087857470 11:103109549-103109571 TGGAAGGGGTGGAGGGAAGTTGG - Intronic
1087906094 11:103699691-103699713 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1088090493 11:106033165-106033187 AAGAGGGGTTGAAGGGAGGTAGG + Intergenic
1088510254 11:110566324-110566346 GAGAAGGGTTGCAGGGAAGTGGG + Intergenic
1088634039 11:111802114-111802136 AAGTTGGTAAGGAGGGAAGTTGG - Intronic
1088640894 11:111871718-111871740 AAAGAGGGTTGGAGGGAGGTAGG - Intergenic
1088787027 11:113191232-113191254 GAGCAGGGTTGGAGGGAATTCGG + Intronic
1088804308 11:113337905-113337927 ATCTAGGGTTGAAGAGAAGTTGG + Intronic
1088811564 11:113396009-113396031 AGGTAGGGCTGGAGGGGAGCTGG - Intronic
1089495721 11:118907856-118907878 AATTAGGGCTGGAGGGGAGGGGG + Intronic
1090134522 11:124183539-124183561 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1090306204 11:125693367-125693389 AAGGAGGGATGGAGTGAGGTGGG - Intergenic
1090386363 11:126359732-126359754 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1090386366 11:126359740-126359762 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1090461933 11:126898924-126898946 AAGGAGGTTTGGAGGACAGTTGG - Intronic
1090601059 11:128371710-128371732 AAGTAGAGGTTGGGGGAAGTGGG + Intergenic
1090634636 11:128683352-128683374 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1090786895 11:130057346-130057368 AGGGAGCGTTGGAGGGAAATGGG + Intergenic
1090977226 11:131688331-131688353 AAGCAGGGTTGGAAGGAGCTTGG + Intronic
1091007396 11:131965920-131965942 AAGGAGGGAGGGAGGGAAGGGGG + Intronic
1091086187 11:132724165-132724187 AAGAAGGGGTGGTGGGAGGTGGG - Intronic
1091228157 11:133970580-133970602 TGGTAGGGTAGGAGAGAAGTGGG - Intergenic
1091335129 11:134760957-134760979 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1091568406 12:1663737-1663759 AAGGAAGGATGGAGGGAAGGAGG + Intergenic
1091775763 12:3183734-3183756 AAGTAGTTTTAGAGGGAACTCGG + Intronic
1091788810 12:3259408-3259430 AAGGAGGGATGGAGGGAGGGAGG - Intronic
1092518234 12:9238357-9238379 TAGTAGAGATGGAGAGAAGTGGG + Intergenic
1092753202 12:11738233-11738255 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1092882871 12:12901388-12901410 AAGGAGGGTGGGAGGAAAGGTGG + Intronic
1092885772 12:12923350-12923372 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1093066690 12:14665562-14665584 AGGATGGGTTGGATGGAAGTGGG + Intronic
1093141620 12:15516538-15516560 AAGGAGGGAGGGAGGGAAGAAGG + Intronic
1094009552 12:25792826-25792848 TGATAGGGTTGGAGAGAAGTGGG + Intergenic
1094300761 12:28962711-28962733 AAGTTGGGTTGGAATGAACTGGG - Intergenic
1094599744 12:31898169-31898191 AAGAAGGGAGGGAGGGAAGGAGG + Intergenic
1094615076 12:32029232-32029254 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1095491193 12:42735371-42735393 AAGTAAGGTTGGAGGGTGGAGGG + Intergenic
1095700925 12:45190087-45190109 AAGAAGGGAAGGAGGGAAGAAGG - Intergenic
1096003331 12:48147746-48147768 AAGGGGGGTTGGAGAAAAGTAGG + Intergenic
1096072382 12:48782534-48782556 AGGTAGGGATGGAGGGCAGCAGG - Intronic
1096625488 12:52892880-52892902 AAGGCAGGGTGGAGGGAAGTGGG + Intergenic
1096781504 12:53994812-53994834 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1096943190 12:55372469-55372491 AAGGAGGGAAGGAGGGAAGCAGG + Intergenic
1096944176 12:55385965-55385987 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1097627320 12:62016533-62016555 AAGAAGGGTCTGAGGGCAGTTGG - Intronic
1097834117 12:64256577-64256599 AAGGAGGGTGGGACGGAAGAAGG - Intergenic
1097955391 12:65480315-65480337 TAAAAGGGTTGGAGGGAACTAGG - Intronic
1098546779 12:71720187-71720209 AATTAGGGTTTCAAGGAAGTAGG - Intergenic
1098567922 12:71956472-71956494 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1098567935 12:71956508-71956530 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1098567944 12:71956536-71956558 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1099325068 12:81204412-81204434 AAGAAGGGAGGGAGGGAAGAAGG - Intronic
1099834254 12:87887390-87887412 AAGAAGGGTTGGAAGGAGGGAGG - Intergenic
1100137102 12:91566965-91566987 AAGGAAGGTGGGAGGGAAGGAGG - Intergenic
1100141060 12:91619384-91619406 AAGTAGGGTTGGAGGGTTGTGGG + Intergenic
1100234568 12:92647480-92647502 AAGAAGGGTTTGAGAGAGGTTGG + Intergenic
1100370820 12:93967098-93967120 AGGGAGGGATGGAGGGAAGGGGG - Intergenic
1100470478 12:94888400-94888422 GAGAAGGGGTGGAGGTAAGTGGG - Intergenic
1100500461 12:95169132-95169154 AATTAGGGGTGGAGGGTATTGGG + Intronic
1100835731 12:98565237-98565259 AAGAAGGGAAGGAGGGAAGGAGG - Intergenic
1101212741 12:102551012-102551034 AAGGAAGGAGGGAGGGAAGTGGG - Intergenic
1101348191 12:103905355-103905377 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1101348198 12:103905371-103905393 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1101348205 12:103905387-103905409 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1101348232 12:103905469-103905491 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1101348239 12:103905485-103905507 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1101348246 12:103905501-103905523 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1101348253 12:103905517-103905539 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1101761324 12:107661193-107661215 AGGTGGGGGTGGAGGGAGGTGGG - Intergenic
1101925192 12:108965977-108965999 AGGAAGGGAGGGAGGGAAGTGGG - Intronic
1102544157 12:113642646-113642668 AAGGAGGGATGGAGGGGAGAAGG - Intergenic
1102992137 12:117322814-117322836 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1103223416 12:119266104-119266126 AAGAAGGGAGGGAGGAAAGTAGG - Intergenic
1104300027 12:127556452-127556474 AAGTAGTTTTCTAGGGAAGTGGG + Intergenic
1104481848 12:129114401-129114423 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1104481851 12:129114409-129114431 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1104489443 12:129181325-129181347 AAGTAGAGATGGAGAGAAGGAGG - Intronic
1104546069 12:129714057-129714079 CAGTGTGGTTGGAGGGAGGTAGG - Intronic
1105350148 13:19607613-19607635 AGGCATGGTTGGAAGGAAGTGGG - Intergenic
1106134745 13:26965723-26965745 AAGTGGGGTGTGAGGAAAGTTGG - Intergenic
1106388499 13:29312044-29312066 CAGTGGGGTTGGAGGGATGTGGG - Intronic
1107687558 13:42918936-42918958 AAGAAGGGAGGGAGGGAAGGAGG + Intronic
1108404001 13:50081677-50081699 AAGTAGGGTTAGGGGCAACTTGG - Intergenic
1108427086 13:50313333-50313355 AAGAAGAGAGGGAGGGAAGTGGG + Intronic
1108685667 13:52816784-52816806 AAGCAGGTTTGGAGGGAAAGAGG - Intergenic
1108822334 13:54368646-54368668 AAGGAGGGAAGGAGGGAAGAAGG + Intergenic
1108822340 13:54368662-54368684 AAGAAGGGAAGGAGGGAAGGAGG + Intergenic
1108822342 13:54368670-54368692 AAGGAGGGAAGGAGGGAAGAAGG + Intergenic
1110195530 13:72783922-72783944 AAGGAGGGTTGGGGAGATGTTGG + Intronic
1110229474 13:73153368-73153390 AAGGAGGGAGGGAGGGAAGTAGG - Intergenic
1110552906 13:76828024-76828046 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1110879379 13:80552594-80552616 AAGGAGGGTGGGAGGGAGGGAGG + Intergenic
1111363632 13:87210839-87210861 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1111823049 13:93236376-93236398 AAGTAGGGAGGGTGGGAAGAGGG - Intronic
1111834262 13:93368316-93368338 AAGCAGGGAGGGAGGGAAGGAGG - Intronic
1111856224 13:93640855-93640877 AAGAAGGGTGGGAGGGGAGAAGG - Intronic
1112035707 13:95494903-95494925 GAGTAGGGGTGGAGGGGAGAAGG - Intronic
1112107723 13:96260278-96260300 AAGTAGGGAGGGAGGGAGGGAGG - Intronic
1112109996 13:96285922-96285944 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1112666986 13:101586174-101586196 AAGAGGGGTTGGAGGGGAATAGG - Intronic
1112728715 13:102335028-102335050 AAGTAGGGTTTGATGGAAGAGGG - Intronic
1112743754 13:102504621-102504643 AATAAGGTTTGGAGGGAAGGGGG + Intergenic
1112788094 13:102973751-102973773 AAATACAGCTGGAGGGAAGTTGG - Intergenic
1114050912 14:18919371-18919393 AAAGAGGGTGGGAGGGAAATGGG - Intergenic
1114111647 14:19482551-19482573 AAAGAGGGTGGGAGGGAAATGGG + Intergenic
1114559347 14:23579077-23579099 AAGCAGGGGAGGAGGGAAGAAGG + Intergenic
1114689433 14:24566524-24566546 CAGCATGGTTGTAGGGAAGTGGG - Intergenic
1114813259 14:25926323-25926345 GAGTAGAGTTGGAAGGCAGTTGG + Intergenic
1115054669 14:29108822-29108844 AAAGAGGGAGGGAGGGAAGTAGG + Intergenic
1115091714 14:29584932-29584954 AATTTGGGGTGGAGAGAAGTCGG - Intronic
1115356566 14:32454664-32454686 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1115356590 14:32454728-32454750 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1115356609 14:32454772-32454794 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1115644906 14:35362272-35362294 AAGAAGGGAAGGAGGGAAGAAGG - Intergenic
1115772250 14:36676537-36676559 CAGAAGGGTTGGAGGGCAGGAGG - Exonic
1116659585 14:47692081-47692103 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1117108384 14:52422255-52422277 AATTGGAGTTGGAGGGAAGTGGG + Intergenic
1117247445 14:53900176-53900198 AAGAAGGGAGGGAGGGAAGGAGG + Intergenic
1117378418 14:55136791-55136813 AGGGAGGGTGGGAGGGAGGTGGG - Intronic
1117473206 14:56067552-56067574 AAGTGGGGATGGAGAGAACTGGG + Intergenic
1117514677 14:56488948-56488970 AAGAAGGGTTTAAGGGGAGTTGG + Intronic
1118433563 14:65747754-65747776 GAGGAGGGTGGGAGGGGAGTTGG + Intergenic
1118994329 14:70822678-70822700 AAGTGGGGGTGAAGGGAAGGAGG - Intergenic
1120360185 14:83490609-83490631 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1121039076 14:90730242-90730264 AGATAGGGTTTGAAGGAAGTAGG - Intronic
1121089627 14:91172037-91172059 AAGAAGGGAGGGAGGGAAGAAGG - Intronic
1121575115 14:94978323-94978345 ACTGAGGGTTGGAGGGAAGCAGG - Intergenic
1121612845 14:95293253-95293275 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1121612864 14:95293305-95293327 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1121643079 14:95499380-95499402 AAGTAGAGGAGGTGGGAAGTAGG - Intergenic
1121765873 14:96484935-96484957 AAGGAGGGATGGAGGGAGGGAGG + Intronic
1121826126 14:97010973-97010995 GAGCAGGCTTGGAGGGAAGGGGG + Intergenic
1121843621 14:97154867-97154889 AGGTGGGGCTGGAAGGAAGTGGG + Intergenic
1121917043 14:97844717-97844739 AAGGAAGGAAGGAGGGAAGTAGG + Intergenic
1122170215 14:99867073-99867095 AAGGAGGGTGGGAGAGAGGTGGG - Intronic
1122363623 14:101181933-101181955 AGGTAGGGTTGGAGGGAGTGGGG - Intergenic
1122874102 14:104655274-104655296 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1122874105 14:104655282-104655304 AAGGAGGGAAGGAGGGAAGGTGG + Intergenic
1123097487 14:105773385-105773407 AAGCAGGGCTGGTGGGAAGCAGG - Intergenic
1123767400 15:23495165-23495187 GGGTAGGGTGGGAGGGAGGTGGG + Intergenic
1123905311 15:24914913-24914935 AAGCAGGGTTGGGGTGTAGTGGG + Intronic
1124172398 15:27387901-27387923 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1124850727 15:33336503-33336525 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1124850730 15:33336511-33336533 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1124850733 15:33336519-33336541 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1124850736 15:33336527-33336549 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1124869757 15:33528898-33528920 AAGAAGAGTTGGAGGAAGGTAGG + Intronic
1125445214 15:39747004-39747026 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1125445217 15:39747012-39747034 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1125445220 15:39747020-39747042 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1127221743 15:56887409-56887431 AGGCAGGGGTGGCGGGAAGTGGG + Intronic
1127374325 15:58369185-58369207 AAGGAGGCGTGGAGAGAAGTGGG - Intronic
1127626958 15:60789075-60789097 AAGAAGGGTTGGAGGGCTATGGG + Intronic
1127660745 15:61098096-61098118 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1127837526 15:62802107-62802129 AAGAAGGGTAGTACGGAAGTGGG - Intronic
1127954302 15:63839642-63839664 AAAGAGGTTTGAAGGGAAGTAGG + Intergenic
1127962265 15:63898672-63898694 AAGGAGGGTGGGAAGGAAGGAGG + Intergenic
1128037887 15:64542750-64542772 AAGTGGGGATGGAGAGAAGGAGG - Intronic
1128452883 15:67817072-67817094 GCCTAGGGCTGGAGGGAAGTAGG + Intergenic
1128619978 15:69140592-69140614 AAGCAGGGCAGGAGGCAAGTGGG - Intergenic
1129180967 15:73875290-73875312 AAGGAGGGAAGGAGGGAAGAAGG + Intronic
1129246403 15:74281647-74281669 CAGGAGGGTGGGAGGGAGGTGGG - Intronic
1129714612 15:77839866-77839888 TAGTGGGGTTGGAGAGAAATGGG - Intergenic
1130000481 15:80042228-80042250 AAAGAGGGAGGGAGGGAAGTAGG - Intergenic
1130839216 15:87682050-87682072 AGGGAGGGATGGAGGGAAGAAGG + Intergenic
1130847158 15:87758177-87758199 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1130924669 15:88375941-88375963 AAGGAGGGATGGAGAGAAGGAGG - Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131288276 15:91081231-91081253 AAGTAGGGAAGGAGGGAGGGAGG - Intergenic
1131449318 15:92525987-92526009 AAGGAGGGATGGAGGGAAAAAGG - Intergenic
1131737070 15:95344936-95344958 AAGGAGGGATGGAGGGAGGGAGG + Intergenic
1131857194 15:96609926-96609948 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1132333446 15:101027935-101027957 AAGAAGGGTGAGAGGGAAGAAGG - Intronic
1133402662 16:5500117-5500139 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1133402665 16:5500125-5500147 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1133559895 16:6941283-6941305 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1133601153 16:7341759-7341781 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1133647148 16:7775132-7775154 AAGGAGGGAGGGAAGGAAGTAGG + Intergenic
1133657390 16:7879039-7879061 TGGTAGGCTTTGAGGGAAGTGGG + Intergenic
1134655279 16:15943565-15943587 AAGAAGGGAGGGAGGGAAGGAGG - Intergenic
1134991255 16:18701566-18701588 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1135887703 16:26326488-26326510 AAGAAGGGAAGGAGGGAAGGAGG + Intergenic
1136107219 16:28038499-28038521 GAGCTGGGGTGGAGGGAAGTGGG + Intronic
1136235297 16:28910198-28910220 CAGGAGGGTAGGAGGGCAGTAGG - Intronic
1136333473 16:29596343-29596365 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1136399434 16:30009841-30009863 AGGTAGGGGAGGAGGGCAGTGGG - Intronic
1137498303 16:48988901-48988923 AAGAAGGAATGGAGGGAAGGAGG - Intergenic
1137505510 16:49050866-49050888 CAGTAGGTCTGGAGGGATGTGGG - Intergenic
1137649885 16:50110664-50110686 AAGTCAGGTTGGAGGGAGTTGGG + Intergenic
1137758773 16:50923844-50923866 AAGGAGGGATGGAGGGAGGAAGG + Intergenic
1137801025 16:51262163-51262185 AAGGAGGGAAGGAGGGAAGGGGG - Intergenic
1138264154 16:55647420-55647442 AAGGAGGGAAGGAGGGAAGACGG + Intergenic
1138498449 16:57423216-57423238 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1138647658 16:58436880-58436902 AAGGAGGGATGGATGGAAGAGGG - Intergenic
1138697769 16:58831786-58831808 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1138697772 16:58831794-58831816 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1138697775 16:58831802-58831824 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1138697778 16:58831810-58831832 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1138697781 16:58831818-58831840 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1138697784 16:58831826-58831848 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1138697787 16:58831834-58831856 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1138697790 16:58831842-58831864 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1138697793 16:58831850-58831872 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1139102138 16:63781062-63781084 AATTTGGCTTGGAGGAAAGTAGG + Intergenic
1139173652 16:64662286-64662308 AAGTAGGGAGGGAGGGAGGGAGG - Intergenic
1139210033 16:65068025-65068047 AAGCAGGGAGGGAGGGAAGAAGG + Intronic
1139398229 16:66658214-66658236 AGGTAGGGAGGGAGGGAAGGAGG + Intronic
1139620116 16:68132870-68132892 AAGTAAGGATGGGGAGAAGTTGG + Intronic
1139991858 16:70946058-70946080 AAGTAGAGTAGGGGGAAAGTGGG + Intronic
1140231016 16:73117203-73117225 AAGAAGGGAAGGAGGGAAGAAGG - Intergenic
1140257524 16:73349796-73349818 AAGGAGGGAGGGAGGGAAGAGGG - Intergenic
1140286704 16:73609658-73609680 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1141090848 16:81129364-81129386 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1141427099 16:83951765-83951787 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1141427154 16:83951927-83951949 AGGCAGGGAGGGAGGGAAGTAGG - Intronic
1141427195 16:83952035-83952057 AGGCAGGGAGGGAGGGAAGTAGG - Intronic
1141464539 16:84197080-84197102 AACTGGGGCTGGAGGGAAGGAGG + Exonic
1141732844 16:85834157-85834179 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1141734683 16:85844310-85844332 AAGAAGGGAGGGAGGGAGGTAGG - Intergenic
1141756782 16:85996746-85996768 AAGGAGGGATGGAGGGAAAGAGG + Intergenic
1141857197 16:86691464-86691486 AAGTAGGGAGGGAGGGAGGGAGG - Intergenic
1141892109 16:86933199-86933221 AAGAAGGGAAGGAGGGAAATGGG + Intergenic
1142134178 16:88444094-88444116 AAGTGGGGTAGGAGAGAAGTGGG + Intergenic
1142679179 17:1535535-1535557 AATTGGGGTTGGAGGGGAGTGGG + Intronic
1142836873 17:2593895-2593917 AAGGAGGGAGGGAGGGAAGGAGG - Exonic
1143374974 17:6462012-6462034 GAGTAGGGGTGGAGGGAAAGAGG - Intronic
1143737356 17:8922134-8922156 AAGGAGGGAAGGAGGGAAGGTGG + Intronic
1143882017 17:10036955-10036977 ACTTAGGGTTGGGAGGAAGTTGG - Intronic
1143943676 17:10570391-10570413 AAGTAGGGATAAAGAGAAGTTGG - Intergenic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144288797 17:13805771-13805793 AAGAAGGGAGGGAGGGAAGGAGG + Intergenic
1144380179 17:14687190-14687212 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1145194391 17:20876504-20876526 TAGAAGGGCTGGAGGGAATTAGG + Intronic
1145262753 17:21364634-21364656 AACCAGGGATGGATGGAAGTGGG - Intergenic
1145297647 17:21604559-21604581 TAGAAGGGCTGGAGGGAATTAGG - Intergenic
1145352606 17:22098843-22098865 CAGAAGGGCTGGAGGGAATTAGG + Intergenic
1146086333 17:29833714-29833736 AAGTAGGGAGGGAGGGAAGGAGG - Intronic
1146086340 17:29833730-29833752 AAGAAGGAAGGGAGGGAAGTAGG - Intronic
1146631028 17:34469385-34469407 CATTAGGGTTGGAGGGAAGCTGG - Intergenic
1146680194 17:34801611-34801633 AACAAGGGTTGGAAGCAAGTTGG - Intergenic
1148664987 17:49367792-49367814 AAGTAGGGCTGGTGGGAGGTGGG - Intergenic
1148850876 17:50554478-50554500 ACCTCGGGTAGGAGGGAAGTTGG + Intronic
1149272406 17:54994658-54994680 ATGTAGGTTGGGAGGGAAATAGG - Intronic
1149784621 17:59424441-59424463 AAGGAGGTTTGGATGGAGGTAGG + Intergenic
1150293246 17:63993477-63993499 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1150553325 17:66231270-66231292 AAGAAGGGAGGGAGGGAAGAAGG - Intronic
1150677773 17:67259563-67259585 AAGGAGGGGTAGAGGGAAGGAGG + Intergenic
1150775122 17:68075125-68075147 AGGGAGGGATGGAGGGAAGCAGG - Intergenic
1150859447 17:68786326-68786348 AAGGAGGGAGGGAGGGAAGAGGG - Intergenic
1151050916 17:70978240-70978262 AAGGAGAGATGGAGGGAAGAAGG + Intergenic
1151286182 17:73113329-73113351 AAGAAGGGTAGGAGGGAGGAAGG - Intergenic
1152369969 17:79880698-79880720 AAGTGAGATTGGAGGGAAGGTGG + Intergenic
1152726931 17:81952173-81952195 CAGAAGGGTTGAAGGGAAGCAGG + Intergenic
1154007561 18:10545621-10545643 AATTAGGGTTTGATGGAATTAGG + Intronic
1154154728 18:11934964-11934986 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1154234185 18:12587976-12587998 GAGTAGGGTTGGAGAAAAATGGG - Intronic
1155078074 18:22380527-22380549 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1155188785 18:23411153-23411175 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1155630595 18:27887702-27887724 AAGAAGGGATGGAAGGAAGGAGG - Intergenic
1155878665 18:31117507-31117529 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
1155966054 18:32036595-32036617 AAGAAGGGAGGGAGGGAAGGAGG + Intronic
1156346517 18:36261759-36261781 AAGTAAGGATGGAGGGATGAGGG - Intronic
1156415300 18:36881605-36881627 AGGAAGGATTGGTGGGAAGTGGG - Intronic
1158103838 18:53861523-53861545 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1158371991 18:56817394-56817416 ACGGAGGGTGGGAGGGAAGGAGG - Intronic
1159134305 18:64318989-64319011 AAGGAGGGATGGAGGGAGGGAGG - Intergenic
1159310268 18:66698485-66698507 AAGAAGGGAGGGAGGGAAGAAGG + Intergenic
1159633431 18:70777073-70777095 AAGTAGAGTTGGAGGGAAATTGG + Intergenic
1159748301 18:72268032-72268054 AAGTAGGATTAGAGGCAAGAAGG - Intergenic
1160367450 18:78339587-78339609 AAGGAGGGATGGAGAGAATTTGG - Intergenic
1160669175 19:348675-348697 AAGCAGGGCTGGAGGGAGGGAGG - Intergenic
1160888178 19:1362036-1362058 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1161606543 19:5218266-5218288 ATGTAGGGTTGGAGGTATTTGGG + Intronic
1161638081 19:5401835-5401857 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1161675667 19:5647182-5647204 GAGTTGGGTTAGAGGGAAATAGG + Intronic
1161754153 19:6119386-6119408 AAGAAGGAATGGAGGGAAGGAGG - Intronic
1161827849 19:6581046-6581068 AAGGAGGGAAGGAGGGAAGAAGG - Intergenic
1162104713 19:8363493-8363515 AGGTAGGGAGGGAGGGAAGAAGG - Intronic
1162451605 19:10758422-10758444 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1162697362 19:12486467-12486489 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1162697365 19:12486475-12486497 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1162697368 19:12486483-12486505 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1162697371 19:12486491-12486513 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1162826516 19:13255732-13255754 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1162858902 19:13490830-13490852 AAGAAGGGAGGGAGGGAAGGAGG + Intronic
1162878759 19:13641130-13641152 CCGTAGTGGTGGAGGGAAGTAGG - Intergenic
1163072040 19:14851764-14851786 AAGTAGGGTTGGAAATAAGGTGG - Intergenic
1163207212 19:15812491-15812513 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1163374935 19:16924249-16924271 AAGTGGGTTTGGGGGGAAGATGG + Intronic
1163480551 19:17553583-17553605 AGGTGGGGTTGGAGGGAAATAGG - Exonic
1163689527 19:18730962-18730984 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1163763568 19:19150117-19150139 AAGGAGGGATGGAAGGAAGGAGG + Intronic
1163763583 19:19150153-19150175 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1164423023 19:28113937-28113959 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1164441776 19:28284766-28284788 AAGGAGGGTGGGAGGAAAGGAGG + Intergenic
1164655447 19:29917811-29917833 AAGAAGGGATGGAGGGAGGGAGG + Intergenic
1164966194 19:32486904-32486926 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1165527942 19:36371977-36371999 AAGGAGGGATGGAGGGAGGGAGG + Intronic
1166062434 19:40334999-40335021 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1166283305 19:41809226-41809248 AAGTAGGGAGGGAGGGAGGGAGG + Intronic
1166337709 19:42118361-42118383 GAGTAGGGGTGGATGGAGGTGGG + Intronic
1166787358 19:45376394-45376416 AAGTGGGGTTTGCGGGTAGTGGG + Intergenic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1167422382 19:49411897-49411919 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1168083599 19:54028575-54028597 AAGGAGTGTTGGGGGGAAGGGGG + Intergenic
1168109079 19:54181732-54181754 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1168109099 19:54181784-54181806 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1168109119 19:54181836-54181858 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1168109130 19:54181864-54181886 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1168109141 19:54181892-54181914 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1168109179 19:54181988-54182010 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1168220365 19:54956141-54956163 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1168601677 19:57723714-57723736 CAGTAGGGTGGGGGGGAAGCTGG - Intronic
925299480 2:2800293-2800315 AAGGAGGGATGGAGGGAGGGAGG + Intergenic
926117261 2:10221356-10221378 AAGAAGGGTTGGGGGGATGGGGG + Intergenic
926191577 2:10732206-10732228 AGGGAGGGATGGAGGGAAGAAGG - Intronic
926947699 2:18206163-18206185 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
926963156 2:18380780-18380802 ATGTAGGGTGGGTGGGAGGTGGG + Intergenic
927120138 2:19952161-19952183 CAGAAGGGTGGGAGGGTAGTAGG - Intronic
927464292 2:23325441-23325463 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
927832570 2:26365286-26365308 AAGTAGGGATGCTGGGAAGAAGG - Intronic
928430948 2:31218046-31218068 AAGTAGGTTGGGAAGGAAGAGGG - Intronic
928507129 2:31965290-31965312 AAGAAGGGAAGGAGGGAAGGAGG + Intronic
928602335 2:32915877-32915899 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
928602366 2:32915992-32916014 AAGTAGAGCAGGAGGGAAGGAGG - Intergenic
929212859 2:39377469-39377491 ATGTGGGTTTTGAGGGAAGTAGG + Intronic
929461545 2:42105644-42105666 AAGAAGAGTTGCAGGGAAGGGGG - Intergenic
929635973 2:43521166-43521188 AAGGAGGGAGGGAGGGAAGAAGG + Intronic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
929961752 2:46502491-46502513 GTGTATGGTTGGGGGGAAGTGGG - Intronic
929962044 2:46504299-46504321 AAGAAGGGGAGGAGGGAACTGGG - Intronic
930406267 2:50960326-50960348 AAGGAGGGAAGGAGGGAAGAAGG - Intronic
930625055 2:53687652-53687674 AACTAAGTTTGGTGGGAAGTGGG - Intronic
931160054 2:59679583-59679605 AAGTGGGGATGGTGGGAAGATGG - Intergenic
931409845 2:62019018-62019040 AGGGAGGGAGGGAGGGAAGTTGG - Intronic
931421104 2:62128596-62128618 AAGGAGGGAGGGAGGGAGGTAGG - Intronic
933047384 2:77556549-77556571 AAGGAGGGCTGTAGGGCAGTGGG - Intronic
933940208 2:87238929-87238951 AAGTAGGTTTGGAGGGAGCTGGG + Intergenic
934554758 2:95281428-95281450 CAGGAGGGTTGGGGGAAAGTGGG + Intronic
934617730 2:95785292-95785314 AAGCAGGTATGGTGGGAAGTTGG + Intergenic
934643163 2:96039267-96039289 AAGCAGGTATGGTGGGAAGTTGG - Intronic
934760995 2:96857151-96857173 TAGGAGGGGCGGAGGGAAGTAGG + Intronic
935070887 2:99692504-99692526 AAGAAGGTTAGGAGGGGAGTGGG + Intronic
935943987 2:108269684-108269706 TGGTAGGGTTTGAAGGAAGTTGG - Intergenic
936060858 2:109294900-109294922 AAGCAGGGAGGGAAGGAAGTGGG + Intronic
936352930 2:111726847-111726869 AAGTAGGTTTGGAGGGAGCTGGG - Intergenic
936416705 2:112322108-112322130 AAGGAGGGAAGGAGGGAAGACGG - Intronic
936416707 2:112322116-112322138 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
936416710 2:112322124-112322146 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
936768865 2:115887559-115887581 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
937223153 2:120353542-120353564 AGGGAGGGCTGGAGGGAAGAAGG - Intergenic
937615844 2:123921397-123921419 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
937615851 2:123921413-123921435 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
937683881 2:124674352-124674374 AAGGAGGGAGGGAGGGAAGAAGG - Intronic
937693682 2:124784158-124784180 AAGAAAGGTGGGAGGGAAGAAGG + Intronic
937737277 2:125307234-125307256 AGGGAGGGAGGGAGGGAAGTGGG + Intergenic
937778124 2:125805383-125805405 AGGGAGGGAGGGAGGGAAGTAGG + Intergenic
938665053 2:133526246-133526268 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
938665060 2:133526262-133526284 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
938665067 2:133526278-133526300 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
938665074 2:133526294-133526316 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
938665081 2:133526310-133526332 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
938860583 2:135364091-135364113 AAGGAGGGCAGGAGGGAAGGAGG + Intronic
939280475 2:140057922-140057944 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
940341656 2:152587965-152587987 AAGTAGGGCTGGAGGCAGATGGG + Intronic
940565357 2:155353566-155353588 AAGTACGTGTGGAGGGAAGGTGG - Intergenic
941201225 2:162513270-162513292 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
941223443 2:162814181-162814203 AAGTAGGTTTGCAGGAAAGTTGG + Intronic
941282273 2:163567886-163567908 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
941633298 2:167908014-167908036 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
942183394 2:173402143-173402165 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
942289427 2:174454655-174454677 AAGAAGGGAAGGAGGGAAGGAGG + Intronic
942365376 2:175220787-175220809 AAGCAAGGTAGGAGGGAAGAAGG - Intergenic
942615018 2:177782755-177782777 AAGTAGGGAAGAAGGGAAGAGGG - Intronic
942676245 2:178429420-178429442 CAGAAGGGTTGCAGGAAAGTAGG - Intergenic
942849975 2:180472830-180472852 AAGTAGGGAGGGAGGGAGGGAGG - Intergenic
943016454 2:182516666-182516688 AAGAAGGGAAGGAGGGAAGGAGG + Intronic
943060944 2:183040759-183040781 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
943232227 2:185268871-185268893 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
943430075 2:187788647-187788669 AAGGTGGGGTGGAGGGGAGTGGG + Intergenic
943499210 2:188666064-188666086 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
943860627 2:192857754-192857776 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
943896779 2:193372877-193372899 AGGTGGTGTGGGAGGGAAGTTGG - Intergenic
944225335 2:197343843-197343865 AAGAAGAGTGGGAGGGAAGGAGG + Intergenic
944688745 2:202140541-202140563 AAACAGGGTGGGAGGGAGGTGGG + Intronic
944775578 2:202960774-202960796 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
944819020 2:203410169-203410191 AAGTAGTGGTGGAGGTAAGGAGG - Intronic
945218094 2:207455803-207455825 AAGGGGGCTTGTAGGGAAGTGGG + Intergenic
945876085 2:215279773-215279795 AAGGAGGGACGGAGGGAAGGAGG + Intergenic
946121611 2:217520730-217520752 AAGGAGGGTTTGAGGGGAGCTGG + Intronic
946188813 2:217996459-217996481 AAGTGGGGTTGGAGGAAGCTGGG - Intronic
947305330 2:228740285-228740307 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
947544706 2:231002645-231002667 AAGTGGGGGTGGTGGGAAGCTGG - Intronic
948080327 2:235200334-235200356 AGGTAGGGAGGGAGGGAAGGAGG + Intergenic
948760477 2:240187238-240187260 AAGTGGGGTGGGAGGGAGGAAGG + Intergenic
1169766738 20:9154888-9154910 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1170589355 20:17759769-17759791 AAGTAATGTGGGAGGAAAGTGGG - Intergenic
1170634082 20:18089594-18089616 AAGTAGGGGTGAAGAGAAGTTGG + Intergenic
1170881006 20:20296371-20296393 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1171344105 20:24452690-24452712 AAGGAGGGCTGGAGGGAAAGGGG - Intergenic
1171370922 20:24661486-24661508 AAGAAGGGAGGGAGGGAAGAGGG + Intronic
1171562925 20:26144159-26144181 TAGAAGGGCTGGAGGGAATTAGG + Intergenic
1171770708 20:29320266-29320288 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1171862402 20:30412933-30412955 AAGTAGGGAGGGAGGGAGGTAGG + Intergenic
1171885139 20:30646566-30646588 GAGGAGGGTTGGAGGGGATTGGG - Intergenic
1172022460 20:31924229-31924251 ACGTTGGGGTGGAGTGAAGTGGG - Intronic
1172350545 20:34235962-34235984 AAGGAGGGAGGGAGGGAAGAAGG + Intronic
1172858744 20:38030248-38030270 AAGGAGGGAGGGAGGGAAGCAGG + Intronic
1172993006 20:39049877-39049899 GAGTAGGGTAGGAGGAATGTTGG + Intergenic
1173089010 20:39952457-39952479 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1173997942 20:47353800-47353822 AAGGGGGGTTGGGGGGAAGCAGG + Intronic
1174090055 20:48039580-48039602 AAGGGGGGTTGGGTGGAAGTGGG + Intergenic
1174164547 20:48575614-48575636 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1174692080 20:52516082-52516104 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1174795847 20:53522041-53522063 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1174795850 20:53522049-53522071 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1174819110 20:53712155-53712177 AAGGAAGGAGGGAGGGAAGTAGG - Intergenic
1174832699 20:53827727-53827749 AAGGAGGGAGGGAGGGAAGAGGG - Intergenic
1174926547 20:54766754-54766776 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1174926550 20:54766762-54766784 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1174926553 20:54766770-54766792 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1174941108 20:54929406-54929428 AGCTAGGGTTGGGGGGAGGTAGG - Intergenic
1175338235 20:58210319-58210341 AAGTAGGGAAAGAGGGGAGTTGG + Intergenic
1175449061 20:59047064-59047086 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1175499865 20:59442110-59442132 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1175605776 20:60311248-60311270 AAGGAGGGAGGGAGGGAAGGTGG - Intergenic
1175717132 20:61262747-61262769 AAGGAGGGTGGGAGGTAAGGAGG - Intronic
1175744110 20:61441901-61441923 AAGAAGGGTTGGAGAGAACCTGG - Intronic
1176661296 21:9637336-9637358 AAGGAGGGTGGGAGGGAGGAAGG - Intergenic
1177046895 21:16182539-16182561 AAGGAGGGATGGAGGGAGGCAGG - Intergenic
1177097370 21:16853143-16853165 AGGAAGGGAAGGAGGGAAGTAGG + Intergenic
1177401430 21:20610638-20610660 ATGGAGGGTTGGGGGGAGGTGGG + Intergenic
1177430667 21:20988574-20988596 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1177510757 21:22084475-22084497 AAGTAGTGATTGAAGGAAGTTGG + Intergenic
1177880912 21:26693609-26693631 AACTAGAGTGGGAAGGAAGTTGG + Intergenic
1178163931 21:29950241-29950263 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1178319878 21:31597234-31597256 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1178568762 21:33714352-33714374 AAGTAGAGTTGGAGGTCAGAAGG + Intronic
1178669109 21:34575317-34575339 AAGGAGGAAAGGAGGGAAGTGGG - Intronic
1178762209 21:35413831-35413853 AAGAAGGGAAGGAGGGAAGAGGG + Intronic
1179156980 21:38859292-38859314 AGGTGGGGTTGCAGGGAAGGGGG + Intergenic
1179296850 21:40070342-40070364 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1179388962 21:40970004-40970026 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1180013082 21:45064240-45064262 AAGAAGGGTGGGAGGGTAGGAGG - Intergenic
1180469389 22:15641746-15641768 AAAGAGGGTGGGAGGGAAATGGG - Intergenic
1180694827 22:17744924-17744946 GAGAAGGGTGGGAGGGAAGATGG + Intronic
1181000809 22:19987057-19987079 CAGACAGGTTGGAGGGAAGTTGG - Intronic
1181036363 22:20171632-20171654 AGGGAGGGCTGGAGGGGAGTGGG + Intergenic
1181969467 22:26679454-26679476 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1182201351 22:28573832-28573854 TAGTGGGGGTGGGGGGAAGTGGG - Intronic
1182699235 22:32220587-32220609 AAGTAAAGTTGGAGAGAAGGTGG + Intronic
1182934387 22:34207471-34207493 AAGGAGAGTAGGAGGGAAGGGGG - Intergenic
1182989182 22:34750714-34750736 CAGCAGGGTTGGAGGAAAGTGGG + Intergenic
1183209736 22:36443425-36443447 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1183338071 22:37262321-37262343 GAATGGGGTTGGTGGGAAGTGGG - Intergenic
1183658003 22:39201514-39201536 AGCTGGGCTTGGAGGGAAGTGGG + Intergenic
1183698797 22:39438162-39438184 AGGAAGGGATGGAGGGAAGGAGG - Intergenic
1183853982 22:40617159-40617181 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1183853985 22:40617167-40617189 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1184975351 22:48057776-48057798 TACAAGGGTTGGAGGGAGGTGGG + Intergenic
950579709 3:13854159-13854181 AAGGAGGGACGGAGGGAAGGAGG + Intronic
951485499 3:23204130-23204152 AAGTGGGGTGGGCGGGAAGGGGG - Intronic
951546363 3:23829974-23829996 AAGAAGGAGTGGAGGGAAGGGGG - Intronic
951902351 3:27669371-27669393 GAGTAGGGTGGGAGGGGAGGTGG - Intergenic
952003254 3:28810294-28810316 GAGCAGGGCTGGAGGGAACTGGG + Intergenic
952164620 3:30733636-30733658 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
952224839 3:31365008-31365030 AAACAGGGGAGGAGGGAAGTTGG - Intergenic
952590108 3:34942487-34942509 AAGTAGGAAGGGAGGGAAGGAGG - Intergenic
953279437 3:41539461-41539483 TAGTAGTGTTGGAGAGTAGTAGG - Intronic
954125938 3:48528885-48528907 AGGAAGGGTTAGAGGGAAATGGG + Intronic
955058314 3:55474886-55474908 AGGTAGGGCTGGGGGGAGGTTGG + Intronic
955473726 3:59313741-59313763 AAGTAAGATTAGAAGGAAGTAGG - Intergenic
955770236 3:62378156-62378178 AAGGAGAGCTGGAGGGAAGAAGG - Intergenic
956329285 3:68087551-68087573 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
956603267 3:71046110-71046132 AAGGAAGGTGGGAGGGAAGGAGG - Intronic
956643558 3:71435682-71435704 AAGAAGGGAGGGAGGGAAGAAGG + Intronic
956643673 3:71435969-71435991 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
956675229 3:71725904-71725926 AAGGAGGGATGGAGGGCAGATGG + Intronic
956783705 3:72624803-72624825 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
957037058 3:75303130-75303152 GAGTAGGGGTGGAGGAAAGGGGG + Intergenic
957220842 3:77380676-77380698 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
957275188 3:78081793-78081815 AAGACGGGTTTGAGGTAAGTTGG + Intergenic
957979849 3:87494586-87494608 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
958164641 3:89864262-89864284 TAGTAGGTTTGGAAAGAAGTAGG - Intergenic
959368614 3:105494626-105494648 AAGAAGGGAGGGAGGGAAGGAGG - Intronic
959687927 3:109167765-109167787 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
959758660 3:109930089-109930111 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
960004449 3:112767620-112767642 CAGGAGGGAGGGAGGGAAGTTGG - Intronic
960200004 3:114821617-114821639 AAGTACGGTAGGTGGGAAGCAGG - Intronic
960891410 3:122452503-122452525 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
960891413 3:122452511-122452533 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
960891416 3:122452519-122452541 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
960891419 3:122452527-122452549 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
961004563 3:123396169-123396191 AAGAAGGGAGGGAGGGAAGAAGG + Intronic
961064444 3:123862788-123862810 AAGTAGGGGAGAAGGGAGGTGGG - Intronic
961369603 3:126421507-126421529 AAGCAGGGATGGAGAGAAGTGGG + Intronic
961396780 3:126599184-126599206 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
962087645 3:132208720-132208742 AGATAGGGTTGGGGTGAAGTAGG - Intronic
962516852 3:136160308-136160330 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
962848928 3:139293446-139293468 AAGTAGGGTTGGGGGGTGGCTGG + Intronic
962859747 3:139389008-139389030 AAGAAGGGTTGGGAGGAAGGGGG - Intronic
962866168 3:139449512-139449534 AAGGAGGGTTGGGGAGAGGTGGG - Intergenic
963309041 3:143688053-143688075 AAGAAGGGAGGGAGGGAAGAAGG - Intronic
963638150 3:147825381-147825403 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
963934218 3:151035689-151035711 AAGTAGGGTTGCGGGGGATTTGG - Intergenic
964090310 3:152868540-152868562 CAGAAGGGCTGGAGGGATGTGGG - Intergenic
964490657 3:157232435-157232457 AAGTAGGATTGGATGGAGCTTGG + Intergenic
964608066 3:158580132-158580154 AAGTAGAGTGGGGTGGAAGTAGG + Intronic
964751577 3:160058688-160058710 GAGTGGGGTTGGTGGGGAGTGGG + Intergenic
964903847 3:161693962-161693984 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
965382272 3:168004708-168004730 GAGTAGGAATGGAGGGAAGGAGG - Intergenic
965415433 3:168387069-168387091 AAGAAGAGGTGGTGGGAAGTGGG - Intergenic
965745991 3:171926471-171926493 GAGAAGGGTAGTAGGGAAGTGGG + Intronic
965834959 3:172841140-172841162 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
965915248 3:173837826-173837848 CAGTGCAGTTGGAGGGAAGTGGG + Intronic
966109133 3:176375979-176376001 ATGTAGAGATGAAGGGAAGTAGG - Intergenic
966273882 3:178141541-178141563 AAGAAGGGAGGGAGGGAAGAAGG - Intergenic
966311023 3:178594031-178594053 AAGGAGGGAGGGAGGGAAGAGGG - Intronic
966592949 3:181701470-181701492 AAGTTGGGTTGGGGGGGGGTGGG + Intergenic
966944773 3:184770152-184770174 AAGTAGGGGTGGTGGGAGGGAGG - Intergenic
967789476 3:193531416-193531438 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
967973868 3:195019993-195020015 AAATAGTGTTGGAGAGAGGTGGG - Intergenic
968149373 3:196324949-196324971 AAGAAGGGAAGGAGAGAAGTGGG + Intronic
968159980 3:196418259-196418281 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
968844242 4:3031092-3031114 AAGATGGGCTGGAGGGAAGGGGG + Intronic
968940099 4:3633302-3633324 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
969278048 4:6150278-6150300 AGGTTGGGTGGGAGGGAAGCTGG - Intronic
969308103 4:6336876-6336898 AAGGAGGGATGGAGGGAGGGAGG - Intronic
969392360 4:6900413-6900435 ATGTGGGGTTGGAGAGAAGTGGG + Intergenic
970224568 4:13844159-13844181 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
970289913 4:14560891-14560913 AAGAAGGGAGGGAGGGAAGAAGG + Intergenic
970365064 4:15350128-15350150 AAGAAGGGAGGGAGGGAAGGAGG + Intronic
970434690 4:16022104-16022126 AAGGAGGGAAGGAGGGAAGAAGG + Intronic
970571988 4:17392397-17392419 AGGAAGGGTGGGAGGGAAGGAGG + Intergenic
971289823 4:25327397-25327419 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
971289826 4:25327405-25327427 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
971289829 4:25327413-25327435 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
971394313 4:26214490-26214512 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
971596832 4:28540274-28540296 AAGAAAGGTAGGAGGGAAGGAGG - Intergenic
971665533 4:29478675-29478697 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
972055523 4:34797185-34797207 AGGGAGGGATGGAGGGAAGAAGG - Intergenic
972273533 4:37535545-37535567 AGGTAGAGGTGGAGCGAAGTGGG - Intronic
972648731 4:40994867-40994889 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
972913678 4:43849546-43849568 AAGTTGGGTGGCAGGGAAGGGGG - Intergenic
973016289 4:45142852-45142874 AAGAAGGGAGGGAGGGAAGGAGG - Intergenic
973173522 4:47175040-47175062 AAGAAGGGAGGGAGGGAAGGAGG - Intronic
973368791 4:49228834-49228856 GAGGAGGGTTGGAGGGGATTGGG - Intergenic
973392252 4:49566580-49566602 GAGGAGGGTTGGAGGGGATTGGG + Intergenic
973544354 4:51966084-51966106 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
973544391 4:51966197-51966219 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
973655620 4:53044616-53044638 AAGGAGGGAGGGAGGGAAGAAGG - Intronic
974095496 4:57359467-57359489 AGAGAGGGATGGAGGGAAGTTGG + Intergenic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
974392531 4:61290684-61290706 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
974392534 4:61290692-61290714 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
974479958 4:62430347-62430369 GAGGAAGGTTGGAGGGAAGAAGG + Intergenic
974875036 4:67693489-67693511 AGGTAGGGTGGTAGGGGAGTTGG + Intronic
975089240 4:70381418-70381440 AAGGAGGGCAGGAGGGAAGGAGG + Intronic
975302718 4:72809622-72809644 GAGTGAGGTGGGAGGGAAGTGGG + Intergenic
975808014 4:78133380-78133402 TAGTGGGGTGGGAGGGAGGTAGG + Intronic
976310537 4:83607483-83607505 GAGGTGGGGTGGAGGGAAGTGGG + Intergenic
976484861 4:85590244-85590266 ATGGAGGGATGGAGGGAGGTGGG - Intronic
979538448 4:121851412-121851434 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
979698558 4:123640977-123640999 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
979698579 4:123641037-123641059 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
979722206 4:123914195-123914217 AACTGGGGTTGGAGTGAAGAAGG + Intergenic
979865060 4:125744121-125744143 AGGGAGGGAGGGAGGGAAGTGGG + Intergenic
980078618 4:128320513-128320535 AAGGAGGGAGGGAGGGAAGCAGG - Intergenic
980807145 4:137828324-137828346 AAGTGGGGAAGGAGGGAAGGAGG + Intergenic
981045306 4:140259325-140259347 AACTAGGGTTGGAGCACAGTAGG - Intronic
981783857 4:148455879-148455901 AAGGAGGGATGGAGGGAGGGAGG - Intergenic
982202816 4:152975745-152975767 ATGTAGGGTTGGAGGAGACTTGG - Exonic
982220026 4:153116306-153116328 GAGGTGGGGTGGAGGGAAGTGGG - Intergenic
982294085 4:153808823-153808845 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
982294116 4:153808899-153808921 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
982294123 4:153808915-153808937 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
982294126 4:153808923-153808945 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
982294129 4:153808931-153808953 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
982529262 4:156517989-156518011 AAGGAGGGAGGGAGGGAAGCAGG + Intergenic
982643910 4:157998165-157998187 AAGGAGGGAGGGAGGGAAGGTGG - Intergenic
982654970 4:158136439-158136461 AAGAAAGGTTGAAGGCAAGTGGG + Intronic
982755208 4:159209656-159209678 TAGTAAGGTTGTGGGGAAGTAGG + Intronic
982972050 4:162000879-162000901 AAGAAGGGATGGAGGGAAGAGGG + Intronic
983995167 4:174174169-174174191 AGGTAGAGTTTGAGGGAATTTGG + Intergenic
984224965 4:177023602-177023624 AAGAAGGGATGGAGGGAGGGAGG + Intergenic
984224993 4:177023792-177023814 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
984392377 4:179152406-179152428 AAGTAGGGTGGGAGAGAGTTGGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985349071 4:189038398-189038420 AAGTAGGGAAGGACTGAAGTAGG - Intergenic
985545986 5:509456-509478 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
985648591 5:1096831-1096853 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
985663627 5:1169863-1169885 AAGGAGGGGAGGAGGGAAGGAGG + Intergenic
986500476 5:8393316-8393338 AAGAAGGGAGGGAGGGAGGTAGG + Intergenic
987207516 5:15642730-15642752 AAGCAGGGTAGGTGGGAAGAGGG + Intronic
987384144 5:17313203-17313225 AGGTAGGGATGGGAGGAAGTAGG - Intergenic
987908650 5:24112877-24112899 AAGCAGGGTTAGAGAGAGGTGGG + Intronic
987960173 5:24796941-24796963 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
988346074 5:30039471-30039493 AAGAAGGGATGGAGGGAGGGAGG + Intergenic
989331395 5:40263185-40263207 AAGAAGGGAGGGAGGGAAGAAGG + Intergenic
989383264 5:40830085-40830107 AACTAAGATGGGAGGGAAGTAGG + Exonic
989463598 5:41728805-41728827 AGGCACGGCTGGAGGGAAGTTGG + Intergenic
989550643 5:42731735-42731757 AAAAAGGGTTGGGGGGAGGTGGG + Intergenic
989559097 5:42830525-42830547 AGGTAGGTAGGGAGGGAAGTAGG - Intronic
990032819 5:51282645-51282667 AAATAAGGGAGGAGGGAAGTGGG - Intergenic
990654433 5:57939578-57939600 AGGAAGGGAGGGAGGGAAGTGGG - Intergenic
990768564 5:59216426-59216448 TAGTAGGGATGGAAGGAAGTGGG - Intronic
991422607 5:66456370-66456392 GAGTGGGGTTGGGGGGTAGTGGG - Intergenic
991454401 5:66786911-66786933 ATGTAGGGTTGGCAGGAAGCAGG + Intronic
991898770 5:71435208-71435230 AAGTAGGGAGGGAGGGAGGGAGG - Intergenic
992530728 5:77649292-77649314 ATGAAGGCATGGAGGGAAGTAGG - Intergenic
992998382 5:82355082-82355104 GTGTGGGGTTGGGGGGAAGTTGG + Intronic
994102607 5:95910266-95910288 AAGGAGGGTGGGCTGGAAGTTGG + Intronic
994198856 5:96949915-96949937 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
994596400 5:101843227-101843249 AAGGAGGAAAGGAGGGAAGTAGG + Intergenic
994596407 5:101843243-101843265 AAGTAGGGAAGGAGGGAGGGAGG + Intergenic
994730982 5:103490474-103490496 AAGGAGGGAAGGAGGGAGGTTGG - Intergenic
994731028 5:103490624-103490646 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
994918986 5:106017701-106017723 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
995019309 5:107349038-107349060 TAGTGGGGTTAGGGGGAAGTGGG - Intergenic
995404070 5:111774238-111774260 AAGAAGGGAGGGAGGGAAGGAGG + Intronic
995655206 5:114418568-114418590 AAGTGGGGCTGGCGGGGAGTTGG + Intronic
995696538 5:114884137-114884159 AAGCAGGGTTGGAGTGAGGGAGG - Intergenic
995813880 5:116144326-116144348 AAGTAAAGTTAGAGGGAAGCAGG + Intronic
996009488 5:118465885-118465907 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
996906028 5:128601403-128601425 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
996906040 5:128601432-128601454 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
997291893 5:132742995-132743017 AAGGAGGGATGGAGGGAGGGAGG - Intergenic
997291905 5:132743031-132743053 AAGGAGGGATGGAGGGAGGGAGG - Intergenic
997576331 5:134980381-134980403 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
997672220 5:135684535-135684557 AATTTGGGTTGGAGGGGAGCAGG + Intergenic
997750083 5:136335991-136336013 AAGTTGGGTTTGTGGGAAGGGGG - Intronic
998426268 5:142031350-142031372 AAGGAGGGTTGAAGGGAAGCAGG - Intergenic
998870419 5:146546089-146546111 GAGTACAGTTGGATGGAAGTTGG + Intergenic
1000115294 5:158148652-158148674 AAGAAGGGAAGGAGGGAAGAAGG - Intergenic
1000115299 5:158148668-158148690 AAGAAGGGAAGGAGGGAAGAAGG - Intergenic
1000115304 5:158148684-158148706 AAGAAGGGAAGGAGGGAAGAAGG - Intergenic
1000115309 5:158148700-158148722 AAGAAGGGAAGGAGGGAAGAAGG - Intergenic
1000428054 5:161115986-161116008 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1000520999 5:162294170-162294192 AGGAAGGGATGGAGGGAAGGAGG + Intergenic
1000676680 5:164130337-164130359 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
1000976815 5:167774179-167774201 AAGAAGGGAGGGAGGGAAGGAGG + Intronic
1001332866 5:170774360-170774382 TAGTGGGGTTGGGGGGATGTAGG + Intronic
1001425807 5:171621617-171621639 AAGTAGGATGGGCAGGAAGTGGG + Intergenic
1001708921 5:173762378-173762400 AGATAAGGTTGGAGAGAAGTGGG + Intergenic
1001774787 5:174320734-174320756 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
1001774832 5:174320864-174320886 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
1001926662 5:175642129-175642151 AAATGGGGTTGGGGGGAATTAGG + Intergenic
1002258941 5:177981152-177981174 AACAAGGGGTGGAGAGAAGTGGG + Intergenic
1002377009 5:178796056-178796078 AAGGAGGGAGGGAGGGAAGTGGG + Intergenic
1002886826 6:1304558-1304580 CAGAAAGGTGGGAGGGAAGTAGG + Intergenic
1002917637 6:1541974-1541996 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1002917649 6:1542002-1542024 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1002917656 6:1542018-1542040 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1002917705 6:1542162-1542184 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1003709792 6:8576441-8576463 AAGGAGGGAGGGAGGGAGGTAGG - Intergenic
1004452583 6:15760398-15760420 AACTTGGCTTGGAGGGAAGGTGG - Intergenic
1004982528 6:21042250-21042272 GAGTAGGGTGGGTGGGAAATGGG - Intronic
1005598400 6:27401625-27401647 AAGGAGGGAAGGAGGGAAGAAGG - Exonic
1005602687 6:27443778-27443800 AAGTGGGGGTGGAGGGAGGTGGG - Intergenic
1005631058 6:27708423-27708445 AAGTAGGGAGGGAGGGAGGTAGG - Intergenic
1005821785 6:29604802-29604824 AAGGAGGGATGGAGGGAACATGG + Intronic
1006308808 6:33242611-33242633 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1006573233 6:35022736-35022758 AAGTATGCATGGAGGGATGTGGG - Intronic
1007075771 6:39065239-39065261 AAGGAGTGTGGGAGGGAGGTGGG + Intronic
1007104924 6:39277087-39277109 AAGGAGGTTTGCATGGAAGTAGG - Intergenic
1007265743 6:40594580-40594602 ATGTAGGGTGAGAGGGAGGTGGG + Intergenic
1007277860 6:40688922-40688944 GAGAAGGCTTGGAGGGAAGTAGG - Intergenic
1007407512 6:41643527-41643549 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1007840625 6:44713089-44713111 CAGCAAGGTTGGGGGGAAGTTGG - Intergenic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1008288412 6:49682815-49682837 AGGAAGGGATGGAGGGAAGGAGG - Intergenic
1008327419 6:50200235-50200257 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1008418609 6:51271709-51271731 AAGAAGGGAGGGAGGGAAGGAGG + Intergenic
1008527274 6:52419626-52419648 AAGGAGGGACGGAGGGAAGGAGG + Intergenic
1008623114 6:53291367-53291389 AGGTAGGGGAGGAAGGAAGTGGG - Intronic
1008733749 6:54516127-54516149 AAGAAGGGAGGGAGGGAAGAAGG + Intergenic
1009035218 6:58109504-58109526 AATTAGGGGTGTAGGAAAGTGGG + Intergenic
1009210731 6:60860212-60860234 AATTAGGGGTGTAGGAAAGTGGG + Intergenic
1009828887 6:68904044-68904066 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1009828890 6:68904052-68904074 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1010168131 6:72941399-72941421 AAGAAGGGAGGGAGGGAAGGAGG - Intronic
1010168151 6:72941471-72941493 AAGAAGGGAGGGAGGGAAGGAGG - Intronic
1011601442 6:89064090-89064112 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
1011641254 6:89418242-89418264 AAGGAGGGAGGGAGGGAGGTGGG + Intergenic
1011716406 6:90109655-90109677 AAGCAGGTTTGGAGGGAGGATGG - Intronic
1013136585 6:107288553-107288575 ATTTAGATTTGGAGGGAAGTAGG + Intronic
1013216615 6:108033125-108033147 AAGAAGGGAGGGAGGGAAGAGGG - Intergenic
1013299351 6:108789199-108789221 TGGTTGGGTTGGAGGGAAATTGG - Intergenic
1013424442 6:109998258-109998280 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1014265334 6:119270515-119270537 AAGAGGGGTTGGAGGGAAATGGG - Intronic
1014543981 6:122710914-122710936 AAATAGGGTTTGAGGTAAGGTGG + Intronic
1015383906 6:132600774-132600796 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1015383942 6:132600886-132600908 AAGAAGGGAAGGAGGGAAGGAGG + Intergenic
1015383953 6:132600922-132600944 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1015383962 6:132600954-132600976 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1015384012 6:132601106-132601128 AAGAAGGGAAGGAGGGAAGGAGG + Intergenic
1015890496 6:137965346-137965368 AAGAAGGGAGGGAGGGAAGGAGG + Intergenic
1015918618 6:138244248-138244270 AAGTAAGGTTGGAGGAAGGCAGG - Intronic
1016990768 6:149926146-149926168 AAGAAGGATTGGAGGGAGGGCGG + Intergenic
1017041106 6:150309201-150309223 AGGTAGGGAGGGAGGGAGGTAGG + Intergenic
1017334063 6:153234485-153234507 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1017587081 6:155938269-155938291 AAGTGGGATTGGAGGGAAGGTGG + Intergenic
1017790279 6:157792095-157792117 AGGAAGGGATGGAGGGAAGGAGG - Intronic
1018271193 6:162079659-162079681 AGGTGGGGAAGGAGGGAAGTGGG - Intronic
1019273925 7:166148-166170 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1019273932 7:166164-166186 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1019974455 7:4569483-4569505 AAGGAGTGCTGGAGGGATGTGGG - Intergenic
1020023263 7:4881941-4881963 AAGCAGGGGTGGGGGGAAGTGGG - Intronic
1020677502 7:11198673-11198695 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1021511617 7:21439480-21439502 AAGGAGGGTGTGAGGGGAGTAGG - Intronic
1021964501 7:25904422-25904444 AATTAGGGGTGGAGGTAGGTGGG - Intergenic
1021971057 7:25966583-25966605 AAGAAGGGAAGGAGGGAAGGAGG + Intergenic
1022108973 7:27216321-27216343 AAGGAGGGGTAGAGGGAGGTGGG + Intergenic
1022109233 7:27218177-27218199 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1022502853 7:30893434-30893456 AATCAGGCTGGGAGGGAAGTGGG + Intergenic
1023311729 7:38894445-38894467 GGCTAGGGTTGGGGGGAAGTGGG + Intronic
1023397401 7:39763873-39763895 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1023848151 7:44134829-44134851 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1024213763 7:47228902-47228924 AAGCAAGGTTGGAGGGAGGCGGG - Intergenic
1024283219 7:47736339-47736361 AAGCAGGGAGGGAGGGAAGGAGG - Intronic
1025147062 7:56514241-56514263 AAGGAGGGACGGAGGGAAGGAGG - Intergenic
1025147068 7:56514257-56514279 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1025147075 7:56514273-56514295 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1025606667 7:63044517-63044539 TAGTAGGGATGCAGGGAAGGGGG - Intergenic
1025992835 7:66508587-66508609 AAGTAGGGAGGGAGGGAGGAAGG - Intergenic
1026195493 7:68169821-68169843 AAAGAAGGTTGGAGGGAAGTGGG + Intergenic
1026207278 7:68269031-68269053 AAGTAGGGAAGGAGGGAGGGAGG - Intergenic
1026214451 7:68335809-68335831 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1026962820 7:74420026-74420048 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1026962827 7:74420042-74420064 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1027416879 7:77983400-77983422 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1027899513 7:84092739-84092761 AAGGAGGCATGGAGGGAAGGAGG - Intronic
1028057150 7:86260070-86260092 AAGGTGGGTTGGAGAGATGTTGG + Intergenic
1028206524 7:88023820-88023842 CAGGAGGGTAGGGGGGAAGTGGG - Intronic
1028621313 7:92832783-92832805 AAGGAGGGTCTGGGGGAAGTGGG - Intronic
1028636783 7:92997986-92998008 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1028932036 7:96423988-96424010 AAGCAGGGCTGGAGGAAAGGAGG - Intergenic
1028948122 7:96603734-96603756 AGGTGGGGTTGGAGGGAGGGAGG - Intronic
1029088266 7:98028297-98028319 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1029184478 7:98728769-98728791 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
1029875020 7:103741550-103741572 AAGGAGGATGGGAGGGAAGAAGG + Intronic
1030114584 7:106053662-106053684 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1030990927 7:116298978-116299000 TGATAGGGCTGGAGGGAAGTGGG + Intronic
1031445260 7:121845791-121845813 AGGGAGGGTTGGAGGGAGGGAGG + Intergenic
1032357759 7:131226026-131226048 AAGTAGGGAGGGAGGGAGGGGGG - Intronic
1032738204 7:134712056-134712078 AGGGAGGGAGGGAGGGAAGTTGG + Intergenic
1033263674 7:139865868-139865890 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1033336330 7:140455682-140455704 AAGAAGGGTAGGAAGGAGGTAGG + Intronic
1033485165 7:141781828-141781850 AAGTAGGGAGGGAGGGAGGGAGG - Intronic
1033608797 7:142946163-142946185 AGGAAGGGGTGGAGGGATGTGGG + Intronic
1035638622 8:1165175-1165197 AGGGAGGGTGGGAGGGAAGGAGG + Intergenic
1036482343 8:9150521-9150543 AAGGAGGCTTGTAGGGAGGTTGG - Intronic
1036496614 8:9276025-9276047 AGGGAGGGAGGGAGGGAAGTAGG - Intergenic
1036699828 8:11005394-11005416 TGGAAGGGCTGGAGGGAAGTGGG + Intronic
1036778269 8:11628456-11628478 CAGTAGGGATGCAGGGAAGGGGG + Intergenic
1037089752 8:14899298-14899320 AAGAAGAGAGGGAGGGAAGTGGG - Intronic
1037339650 8:17830981-17831003 AAGAAAGGAGGGAGGGAAGTGGG + Intergenic
1037764771 8:21765866-21765888 AGGTGGGGTTGAAAGGAAGTGGG - Intronic
1037774405 8:21823398-21823420 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1038255304 8:25945727-25945749 ATGCAGAGTTGGAGGGAAGGTGG + Intronic
1038285610 8:26203881-26203903 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1038515724 8:28186188-28186210 AAGTAGGGTTGGTGTTTAGTGGG + Intronic
1038531509 8:28321548-28321570 AAGTAAGGATGGAAGGAAGAAGG - Intronic
1038899856 8:31830362-31830384 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1038899859 8:31830370-31830392 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1039644189 8:39262616-39262638 AGGGAGGGATGGAGGGAAGGAGG - Intronic
1041444181 8:57931891-57931913 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1041474287 8:58246684-58246706 AAGAAGGGAGGGAGGGAAGAGGG + Intergenic
1041802323 8:61813504-61813526 AAGGAGGGAAGGAGGGAAGAAGG - Intergenic
1042049508 8:64688375-64688397 AAGGAGGGTGGGAGGGAGGGAGG - Intronic
1042193957 8:66215971-66215993 AAGTAGAGTGAGAGGAAAGTGGG + Intergenic
1042230024 8:66545711-66545733 GAGGAGGGATGGAGGGAAGGAGG + Intergenic
1042889353 8:73590085-73590107 AAGTAGGGGGAGAAGGAAGTAGG + Intronic
1043037734 8:75218949-75218971 AAGGAAGGATGGAGGGAAGGAGG + Intergenic
1044091683 8:88010320-88010342 AAGGAAGGATGGAGGAAAGTTGG - Intergenic
1044271378 8:90248481-90248503 AAAAAGGGTTCGAGAGAAGTTGG + Intergenic
1044443564 8:92247776-92247798 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1044562155 8:93623088-93623110 AAGAAGGGAGGGAGGGAAGGAGG + Intergenic
1045370178 8:101515069-101515091 AAGGAGGGAGGGAGGGAGGTAGG - Intronic
1045412131 8:101929670-101929692 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1045523272 8:102921569-102921591 AAGAAGGGAAGGAGGGAAGGAGG - Intronic
1045544710 8:103118215-103118237 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1045789379 8:105964116-105964138 AAGAAGGGAAGGAGGGAAGGAGG + Intergenic
1045972592 8:108096040-108096062 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1046265133 8:111821285-111821307 AAGGAGGGTGGGATGGAAGAGGG + Intergenic
1046605341 8:116365508-116365530 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1046754674 8:117961121-117961143 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1047061838 8:121235732-121235754 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1047927633 8:129696981-129697003 AAGAAGGATTGGAGGGAGGTGGG + Intergenic
1048044035 8:130756571-130756593 AAGAAGGGAGGGAGGGAAGGAGG - Intergenic
1048161859 8:132028596-132028618 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1048366439 8:133742706-133742728 AAGGAGGGGAGGAGGGAAGGAGG + Intergenic
1048453564 8:134555965-134555987 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1048505837 8:135020519-135020541 CAGGAGTGTTGGAGGGAAGTGGG - Intergenic
1048742556 8:137578237-137578259 AAGGAGGAATGGAGGGAAGGAGG - Intergenic
1048822633 8:138393958-138393980 AAGTGGGGTTTGGGGGCAGTTGG + Intronic
1049609922 8:143550146-143550168 AGGTTGGGCTGGAGAGAAGTGGG - Intergenic
1050489699 9:6175299-6175321 AGGTAGGGATGAAGAGAAGTTGG + Intergenic
1050503901 9:6327843-6327865 AATTACGGTTGGGGGGAGGTTGG + Intergenic
1050571125 9:6940046-6940068 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1050782606 9:9356604-9356626 AAGTAGTGATGGGGAGAAGTAGG + Intronic
1051370942 9:16358503-16358525 TGGTAGGGATGGTGGGAAGTGGG + Intergenic
1051858760 9:21600240-21600262 AAGAAGGGAGGGAGGGAAGGAGG + Intergenic
1052868005 9:33477596-33477618 AAGGAGGGTGGGAGGGAGGGAGG - Intergenic
1053028653 9:34755067-34755089 TTGGAGGGTTGGGGGGAAGTAGG + Intergenic
1055004374 9:71488794-71488816 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1055600901 9:77917365-77917387 AAGGAGGGTGGGGGGGAAGAAGG + Intronic
1055725698 9:79226022-79226044 AAGTAGGAATGAAGGGAAGGAGG - Intergenic
1056184141 9:84116334-84116356 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1056665126 9:88575612-88575634 AAGTGGGGTTGGGAGGAAGGTGG + Intronic
1056671114 9:88627588-88627610 AAGGAGGATTGGGGGGAAGGTGG + Intergenic
1057690932 9:97284204-97284226 AGGAAAGGTTGGAGGGAAATGGG - Intergenic
1057778798 9:98033430-98033452 GGGTGGGGCTGGAGGGAAGTGGG + Intergenic
1058710952 9:107678660-107678682 AAGTAGGGTTGCAGTGAAAGGGG + Intergenic
1058935229 9:109763769-109763791 ATGTGGGGTGGGAGGGAAGTAGG + Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059929904 9:119250107-119250129 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1060081246 9:120648383-120648405 AAGAAGGGTTGAAAGGAAGTAGG - Intronic
1061403435 9:130381039-130381061 TGGTAGGGTTGGAGGTAAGTGGG - Intronic
1061416084 9:130447594-130447616 AAGGAGGGCTGGAGGGCAGTGGG + Intronic
1061726556 9:132585165-132585187 AAATAGGTTTGGAGCGAAGGGGG + Intronic
1062127372 9:134870803-134870825 AGGTGGGGTGGGAGGGAGGTGGG + Intergenic
1062144086 9:134979180-134979202 AAGGAGGGAGGCAGGGAAGTAGG + Intergenic
1062227201 9:135459416-135459438 AAGAAGGGAGGGAGGGAAGGAGG - Intergenic
1062449206 9:136608444-136608466 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1062474482 9:136720405-136720427 AAGCAGGCTTGGAGGGAGCTGGG - Intronic
1202802111 9_KI270720v1_random:9561-9583 AAGGAGGGAAGGAAGGAAGTAGG - Intergenic
1203626136 Un_KI270750v1:25127-25149 TAGAAGGGCTGGAGGGAATTAGG - Intergenic
1203638862 Un_KI270750v1:139180-139202 AAGGAGGGTGGGAGGGAGGAAGG - Intergenic
1185534838 X:852853-852875 AAGAAGGGATGGAGAGAGGTTGG - Intergenic
1185602314 X:1348837-1348859 AAGTAGGGTGGGAAGGAGGAGGG - Intronic
1185627588 X:1493382-1493404 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1185680027 X:1880946-1880968 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1185680082 X:1881291-1881313 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1185734391 X:2485961-2485983 AGGGAGGGTTGGACGGAAGGAGG + Intronic
1186022429 X:5271384-5271406 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1186079300 X:5912913-5912935 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1186079307 X:5912929-5912951 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1186079314 X:5912945-5912967 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1186206359 X:7204823-7204845 AAGGAGGGGAGGAGGGAAGAAGG - Intergenic
1186267282 X:7844583-7844605 ATGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186376413 X:9006799-9006821 GAGGTGGGATGGAGGGAAGTGGG - Intergenic
1186406994 X:9313050-9313072 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1186490769 X:9970437-9970459 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1186490772 X:9970445-9970467 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1186490810 X:9970570-9970592 AAGTAGGGAGGGAGAGAAGGAGG - Intergenic
1186490815 X:9970586-9970608 AAGAAGGGAGGGAGGGAAGTAGG - Intergenic
1187438197 X:19291786-19291808 AAGTAGTGTTTTATGGAAGTAGG + Intergenic
1187768840 X:22672543-22672565 AAGAAGGGCTGAAGGGAGGTTGG + Intergenic
1187982324 X:24770697-24770719 AAGAAGGGTGGCAGGGAAGGGGG + Intronic
1188303468 X:28533051-28533073 AAGAAGGGTGGAAGGGAAGAGGG + Intergenic
1188786787 X:34356496-34356518 AAGTTGAGTTGGAGGGAAGAAGG - Intergenic
1189675505 X:43456877-43456899 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1191178405 X:57532003-57532025 AAGGAGGGTTGGAGGGGGTTAGG + Intergenic
1191786873 X:64925635-64925657 AAGTAGGCATGGAGGGAGGAGGG - Intronic
1191870715 X:65742724-65742746 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1193644263 X:84047597-84047619 CAGTGGGCTTGGAGGGGAGTGGG - Intergenic
1193824416 X:86205465-86205487 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1193824419 X:86205473-86205495 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1194831268 X:98625232-98625254 AAGAAGGGAGGGAGGGAAGGAGG - Intergenic
1194982545 X:100454999-100455021 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1194982555 X:100455031-100455053 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1194982575 X:100455087-100455109 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1195892717 X:109712989-109713011 AAGAAGGGAGGGAGGGAAGGAGG + Intronic
1195892733 X:109713057-109713079 AAGGAGGGATGAAGGGAAGAAGG + Intronic
1196107064 X:111907722-111907744 ATGTAGGATTGGATGAAAGTAGG - Intronic
1196348408 X:114696325-114696347 AAGTAGAGGTGGAAGGAAGAAGG - Intronic
1197207371 X:123801586-123801608 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1197207413 X:123801696-123801718 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1197290786 X:124654648-124654670 AGTTAGGGCTGGAGGGAAGAAGG + Intronic
1198210935 X:134515431-134515453 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1198473316 X:136970907-136970929 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1198511412 X:137355342-137355364 AAGTAGGATTGGAGGAACCTTGG + Intergenic
1198770009 X:140120463-140120485 GAGTAGTGTTGGGAGGAAGTGGG - Intergenic
1198963501 X:142205416-142205438 AGGAAGGGTTGGAGGGCAGCTGG - Intergenic
1199046580 X:143181255-143181277 AAGGAGGGAAGGAGGGAAGAAGG + Intergenic
1200147136 X:153932200-153932222 AAGTGGGATTGGGGGGAAGGAGG - Intronic
1200413990 Y:2889336-2889358 AAGGAGGGACGGAGGGAAGAAGG - Intronic
1200710463 Y:6479901-6479923 AAGAAGGGAGGGAGGGAAGAAGG + Intergenic
1200783459 Y:7237858-7237880 TAGAAGGCTTGGAGGCAAGTGGG + Intergenic
1200907960 Y:8504316-8504338 AAGTAGGATTGAATAGAAGTAGG + Intergenic
1201023474 Y:9682093-9682115 AAGAAGGGAGGGAGGGAAGAAGG - Intergenic
1201559234 Y:15298609-15298631 AAGAAGGGTTGGAGGTAAACTGG + Intergenic
1201652285 Y:16302751-16302773 AAGGAGGGAAGGAGGGAGGTTGG + Intergenic
1202051074 Y:20781437-20781459 AAAGAGGGGAGGAGGGAAGTGGG - Intergenic
1202098871 Y:21284533-21284555 GTGTGGGGTTGGAGGGAGGTGGG - Intergenic
1202107798 Y:21388322-21388344 AAGGAAGGTTGGAGGGAGGGAGG + Intergenic
1202193758 Y:22273888-22273910 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic