ID: 1084705898

View in Genome Browser
Species Human (GRCh38)
Location 11:70815817-70815839
Sequence GCCCACTGCAGTCCTGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 344}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084705894_1084705898 6 Left 1084705894 11:70815788-70815810 CCTGAGGCTGGTTCTGACCACAC 0: 1
1: 0
2: 1
3: 16
4: 175
Right 1084705898 11:70815817-70815839 GCCCACTGCAGTCCTGGCCAAGG 0: 1
1: 0
2: 3
3: 28
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084705898 Original CRISPR GCCCACTGCAGTCCTGGCCA AGG Intronic
900394099 1:2446114-2446136 GTCCACTGCAGTCCTAGCCAGGG + Intronic
900680076 1:3911820-3911842 GCCCACAGCAGTTCAGGCCCTGG + Intergenic
902709366 1:18228040-18228062 CCTCACACCAGTCCTGGCCATGG - Intronic
902710579 1:18236866-18236888 GCCCACTGGGGACCTGGGCAAGG + Intronic
903182415 1:21611620-21611642 GCCCCATGGAGGCCTGGCCAGGG - Intronic
903625992 1:24730460-24730482 GCTGACTGCAGACATGGCCAGGG - Intergenic
903929795 1:26855590-26855612 GGCCACTGCAGTGATGGCCCAGG - Exonic
904364437 1:30001559-30001581 CCCCACTGCAGTCCTGGGAGAGG + Intergenic
904496457 1:30889590-30889612 GCCCACTGCAGAGCTGGGAAGGG - Intronic
904588010 1:31590765-31590787 GTCCACTGCAGAACTGGCCCAGG - Intergenic
908251722 1:62271226-62271248 GCCACCTGGAGTCCTGGCCCTGG + Intronic
910643205 1:89486820-89486842 GCCCACTGCTCTCCCTGCCAAGG + Intergenic
911232355 1:95374456-95374478 TCCCACTGTAGTACAGGCCAAGG - Intergenic
912638938 1:111325120-111325142 GCCAGCTGCAGCCCTGGGCATGG + Intergenic
912856203 1:113170758-113170780 GACTCCTGCAGTCCTAGCCATGG + Intergenic
913189714 1:116403218-116403240 GACCACCGGAGTCCTGCCCAGGG + Intronic
913489806 1:119368397-119368419 CCCCACTGCTGTCCTGCCCATGG + Intergenic
914739918 1:150455884-150455906 GCTCACTGCAGCCCTGACCTGGG + Intronic
915112431 1:153572675-153572697 GGCCGCTGCTGTCCTGGCAAGGG + Intergenic
915564360 1:156705631-156705653 GGCCACTTCAATCCTGGGCAGGG - Intronic
915835219 1:159171276-159171298 AGCCACTGCAGGCCTGGGCAAGG - Intergenic
916601245 1:166295574-166295596 GCCACCTGCAGTCCTTGACAAGG - Intergenic
917671975 1:177281535-177281557 GCCCACTTCAGCACTGGGCAAGG + Exonic
919514813 1:198510355-198510377 ACCCACTGCAGTGCTGGCTTTGG - Intergenic
920167469 1:204045868-204045890 GGCCACAGGACTCCTGGCCACGG - Intergenic
920496739 1:206460312-206460334 GCCAACAGCAGTCCTAGCCCAGG - Intronic
920630643 1:207648098-207648120 GCTCACTGCAGCCTTGACCATGG - Intronic
922467510 1:225854257-225854279 GCCCACTGCTGTCCAGCCCCTGG - Intronic
922715705 1:227870113-227870135 GCCCACTGCAGACCAGACCATGG + Intergenic
923259898 1:232258521-232258543 GCCCACTGAAGACGCGGCCAAGG + Intergenic
924272168 1:242345151-242345173 ACCCACTGCAGTTGTGACCATGG + Intronic
924508210 1:244705737-244705759 GCCTGCTGCAGTGCTTGCCACGG - Exonic
1062971176 10:1650716-1650738 GCCCACTGCAGTCCCGGATAGGG + Intronic
1063177997 10:3569750-3569772 GCCCTCTGCTGTCCTGGCCTTGG - Intergenic
1064418388 10:15169098-15169120 GCCCTGTGCAGGGCTGGCCAGGG - Intergenic
1064578632 10:16770753-16770775 GCCACCTGCTGTCCTGGCCCTGG - Intronic
1066197572 10:33116044-33116066 GCCCACCGTAGGGCTGGCCACGG - Intergenic
1067115678 10:43433908-43433930 TGCCACTGCACTCCTGGCTAGGG + Intergenic
1067143532 10:43676561-43676583 GCCCAGTGCTGACCTGGCCCGGG - Intergenic
1067267168 10:44756343-44756365 GCCCACTGCAGTCACTCCCAGGG + Intergenic
1067344807 10:45429314-45429336 GCCCAGTCCAGTCCTGGCCTTGG - Intronic
1067690210 10:48497006-48497028 GCCCAGTGCAGTGCTGCCCTGGG - Intronic
1067690371 10:48497824-48497846 GCCCACTGCAGTGCTGCCCTGGG - Intronic
1068120785 10:52780297-52780319 GCCCCCTGCAGTCCTAAGCATGG - Intergenic
1069680857 10:70284101-70284123 TCCCACTGCAGCCCTGGCAGCGG + Intergenic
1070695693 10:78561559-78561581 GCCCCCAGCAGGGCTGGCCAAGG + Intergenic
1070778449 10:79123840-79123862 GCTCACAGCAGGCCTGGCCAGGG + Intronic
1072066789 10:91879313-91879335 GTCCACTCCAGTCCTGGTTAGGG + Intergenic
1072353721 10:94585441-94585463 GCTCACTGCACTCCAGGCCTGGG - Intronic
1072633819 10:97164757-97164779 TGCCACGGCAGTCCTGGGCAGGG - Intronic
1072735736 10:97878144-97878166 GCCCACTGCTCCCCAGGCCAGGG - Intronic
1073328786 10:102657574-102657596 GCCACCTGCCGTCCTGGCCCAGG - Exonic
1074190023 10:111127608-111127630 GCCCCCTGCAGACATGGCCAGGG + Intergenic
1075883481 10:125875789-125875811 GCCCACTGCAGGAATGGCTAAGG - Intronic
1076055322 10:127367932-127367954 GCCCACTGCAGCCATGCCCCTGG + Intronic
1076166666 10:128287637-128287659 GCCCACAGCAGCACTTGCCAAGG + Intergenic
1076722812 10:132400159-132400181 CACCACTGCAGCCCTGGCCCAGG - Intronic
1077113269 11:871342-871364 GCCTGCTGCTGTCCTGGGCATGG - Intronic
1077140879 11:1024359-1024381 GGCCACTGCAGTCCCACCCAGGG + Intronic
1077232563 11:1464577-1464599 GCACACAGCAGTCCAGGCCTAGG + Intergenic
1077369414 11:2174519-2174541 CCCGACTCCAGTCCTGGCCCTGG + Intergenic
1077433543 11:2527553-2527575 GCCCACAGCAGTCCCGCCCTGGG + Intronic
1077462348 11:2716904-2716926 TCCTACTGCAGGCCTGGCCTTGG - Intronic
1079400938 11:20105788-20105810 GCAAAGTGCTGTCCTGGCCAGGG - Intronic
1081716684 11:45255617-45255639 CCCCACTGGAGTGCTGCCCATGG + Intronic
1081876211 11:46410029-46410051 GCCCTCTCCCATCCTGGCCATGG - Intronic
1082640453 11:55653725-55653747 ACCAACTGAAGTTCTGGCCAAGG - Intergenic
1083223253 11:61267310-61267332 GCTCCCTCCAGTCCTGCCCAGGG - Intronic
1083596528 11:63920497-63920519 GGCCACTGATGGCCTGGCCAGGG - Intergenic
1083723291 11:64614471-64614493 ACCCACTTCAGACATGGCCATGG + Intronic
1084380027 11:68805865-68805887 GCCCATTGTAGTCATGGCCCTGG - Intronic
1084705898 11:70815817-70815839 GCCCACTGCAGTCCTGGCCAAGG + Intronic
1084783607 11:71428711-71428733 GCTCCCTGCAGTCCTGTCCAGGG + Intronic
1084840113 11:71839784-71839806 GGACACTGCAATCCTAGCCAAGG + Intergenic
1085784909 11:79440417-79440439 GCCCTCTGCACTGCTGGCCCGGG - Intronic
1087639305 11:100738845-100738867 GCCCGTTGCATTCCTTGCCAAGG + Intronic
1088640760 11:111871089-111871111 GCCCACTCTAGGCCTGGCCCAGG + Intronic
1089097345 11:115930432-115930454 GCCCACTGCACTCGGTGCCAGGG + Intergenic
1089665032 11:120012964-120012986 GCTCACTGGAGTCCTGGCCCTGG + Intergenic
1090269909 11:125378663-125378685 GAGGTCTGCAGTCCTGGCCAAGG + Intronic
1094313545 12:29113074-29113096 GACTTCTGCAATCCTGGCCATGG - Intergenic
1095050240 12:37547931-37547953 GCTGAGAGCAGTCCTGGCCAGGG + Intergenic
1096084189 12:48854512-48854534 GCTCACTGCAGCCCTGACCTGGG + Intergenic
1096670162 12:53193732-53193754 CCCCACTGCAGTGATGGCCAGGG - Exonic
1097176363 12:57145698-57145720 GGCCCCTGCATTTCTGGCCAAGG + Intronic
1097558859 12:61175533-61175555 TCTCACTGCAGTGCTGTCCAAGG + Intergenic
1097743239 12:63270126-63270148 GCCCATGGAAGTTCTGGCCAGGG + Intergenic
1099010072 12:77281296-77281318 GCACTCTGCAGTCCTTGTCATGG + Intergenic
1103705004 12:122866683-122866705 GGCCACTGCAGCCCTGGTGAGGG - Exonic
1103711168 12:122913777-122913799 GACCACTGCAGTCCAGCCTAGGG + Intergenic
1104789532 12:131473057-131473079 GCCCACAGCTGCCCTGCCCAGGG - Intergenic
1106187907 13:27424995-27425017 AGCCACTGCAGTCGTGGCCAGGG + Intronic
1106313794 13:28576532-28576554 CCCCACTGCTGTTCTGGCCTTGG - Intergenic
1106468374 13:30033165-30033187 TCCCATTGCAGTCCCAGCCATGG - Intergenic
1106663291 13:31825004-31825026 GCCCAGTGCAGTCCAGTGCATGG + Intergenic
1107040578 13:35943580-35943602 GCACGCAGCAGGCCTGGCCAAGG + Intronic
1107638818 13:42420283-42420305 TCCCACTGCTGTCCTGGCTGGGG + Intergenic
1108530753 13:51325045-51325067 CCCCTCTGCAGGCCTGGGCAGGG - Intergenic
1108603227 13:52012192-52012214 CCCCACTGCTGTCCCGCCCACGG + Intergenic
1112752528 13:102597152-102597174 GCTCATCGCAGTCCTGGACACGG + Exonic
1113485850 13:110651953-110651975 TCCGACTGCACCCCTGGCCAGGG + Intronic
1113503897 13:110799710-110799732 GCTGACTGCAATCCCGGCCAGGG + Intergenic
1113513289 13:110872535-110872557 GGACACTGCAGCCCTGGTCATGG + Intergenic
1114459476 14:22877419-22877441 CCACACAGCAGTCCTGGCCCTGG + Exonic
1115407354 14:33032542-33032564 GACTGCTGAAGTCCTGGCCAGGG + Intronic
1119756688 14:77124859-77124881 GGACACTGCAGTCTTGTCCACGG - Intronic
1120805023 14:88737495-88737517 GCCCAGTGCAGCCCGGGACAGGG + Intronic
1121226587 14:92325612-92325634 GACCACCTCAGTCTTGGCCAAGG + Intronic
1121967892 14:98327191-98327213 CCCCAATGCAGTCATGGCAATGG - Intergenic
1122140627 14:99660850-99660872 GCTCCCTGCAGTCCTGGCTGGGG - Intronic
1123054871 14:105564581-105564603 GCCTGCTGCTGTCCTGGCCTGGG + Intergenic
1123079315 14:105684160-105684182 GCCTGCTGCTGTCCTGGCCTGGG + Intergenic
1123115384 14:105892067-105892089 CTCCACTGCAGTCCTGGGCCTGG - Intergenic
1123119637 14:105910785-105910807 CTCCACTGCAGTCCTGGGCCTGG - Intergenic
1202873570 14_GL000225v1_random:188094-188116 GGCCACTGCACTCCAGCCCAGGG - Intergenic
1124182682 15:27491383-27491405 GCCCAGTCCAGTCCTGGCTAGGG + Intronic
1124204052 15:27702243-27702265 GACCCCTGCAGTCCTAGCCAGGG - Intergenic
1124656244 15:31510173-31510195 GCCGGCTGCAGTCCTGGCCCAGG + Intronic
1126019088 15:44382348-44382370 TGCCACTGCACTCCTGGCCTGGG - Intronic
1126104658 15:45139517-45139539 GCCCAGTGCTGCCCTGGCCTTGG - Exonic
1129473103 15:75766020-75766042 GCCCAATGCAGTCCTGTCTCTGG + Intergenic
1129703411 15:77781049-77781071 GGACACCGCAGACCTGGCCAAGG + Intronic
1131116179 15:89797471-89797493 GCCTACTGGACTCCTGGTCAGGG - Intronic
1132021125 15:98363610-98363632 GCCCACTGCAGTACTAGGCCTGG + Intergenic
1132623526 16:879392-879414 CCCCACTGCAGCCCTGTCCCGGG - Intronic
1132838392 16:1966127-1966149 TCCCACTGAAGCCCTGGCCTGGG + Intergenic
1132840188 16:1975089-1975111 GCCCACTGCTGACCTGAGCATGG - Exonic
1132865918 16:2092680-2092702 TCCCACTGCCCTGCTGGCCACGG + Intronic
1133586799 16:7203590-7203612 ACTCACTGCAATCCTGGGCACGG - Intronic
1133629105 16:7602277-7602299 GGCCCCTTGAGTCCTGGCCACGG + Intronic
1134015599 16:10885902-10885924 GCCCAGTGCAGCCCAGGTCATGG + Intronic
1136540570 16:30925678-30925700 GCCCACTGGGGCCCTGGCCTGGG - Intronic
1136746757 16:32597635-32597657 GCCCATTGCAGTGCCTGCCACGG + Intergenic
1137350681 16:47711725-47711747 TCCCACTGGAGACCTGGACATGG - Intergenic
1137558840 16:49490179-49490201 GCCACCTGGAGTCCTGGCAAGGG + Exonic
1139625989 16:68188511-68188533 GCCCACTGCAGCCAGGGTCATGG + Intronic
1141065230 16:80908700-80908722 AGCCACTGCACTCCTGGGCAGGG + Intergenic
1141443278 16:84042852-84042874 GCCCCCTGCAGGCCCGGCCCCGG + Intergenic
1141710956 16:85698772-85698794 ACCCACTGCAGCCCTGGCACCGG - Intronic
1203048886 16_KI270728v1_random:856839-856861 GCCCATTGCAGTGCCTGCCACGG + Intergenic
1143075576 17:4340004-4340026 GCTCACTGCAGCCCTGGCTGTGG + Intronic
1143184732 17:5003390-5003412 GCCCACCGCAGGCATGGACAAGG - Intronic
1144276310 17:13671886-13671908 GCTCACTCCAGCCCTGACCAAGG - Intergenic
1144745210 17:17609370-17609392 CACCACTCCAGGCCTGGCCATGG + Intergenic
1145943344 17:28755715-28755737 GCCCACAGCAGCCCTGCCCAGGG + Intergenic
1146939063 17:36831339-36831361 GCCAGCTGCATTCCTGCCCATGG + Intergenic
1148248622 17:46054074-46054096 GTCCACTGCACTCCAGGCCTGGG + Intronic
1148332505 17:46820797-46820819 GCCTGCTGGAGTCCTGCCCAAGG + Intronic
1151513895 17:74579943-74579965 GCCCATTGACGTCCTGTCCAGGG - Exonic
1152068134 17:78122547-78122569 GCTCCCTGCAGGCCTGGCCCTGG - Intronic
1152097705 17:78281511-78281533 GCCCTCTACAGACCTGGTCAGGG + Intergenic
1152463307 17:80452385-80452407 GGCCACAGATGTCCTGGCCATGG + Intergenic
1152613489 17:81327436-81327458 GTCCACAGCAGCCCTGGTCACGG - Intronic
1152655276 17:81516531-81516553 GCCCACTCCAGACCTGCCCAAGG - Intronic
1154132007 18:11745510-11745532 GCCTTCTGCAGCCCTGGCCCTGG + Intronic
1154171672 18:12057001-12057023 CAGCACTGGAGTCCTGGCCAGGG - Intergenic
1156491673 18:37500037-37500059 GCCCAGTGCCGCCCTGGCAAAGG + Intronic
1157483988 18:48073952-48073974 ACCCACTGCAGGCCTGGCTGGGG - Intronic
1160266609 18:77344124-77344146 GCCCACTGACCTCCTGGCCTTGG + Intergenic
1160942675 19:1627720-1627742 GCCCACAGAAGCCCTGCCCAGGG + Intronic
1161076442 19:2288159-2288181 GCCGACTGCAGCTCTGGTCAAGG - Intronic
1161487712 19:4544517-4544539 GCCCGCAGGAGTCCTGGCCGGGG + Exonic
1161668193 19:5589723-5589745 CCCCACTGCAGTGCTGGTGAAGG + Intronic
1161709897 19:5841940-5841962 GCCCTCGGCAGGCCAGGCCAGGG - Intergenic
1161716106 19:5877092-5877114 GCCCTCGGCAGGCCAGGCCAGGG - Intronic
1162489200 19:10981913-10981935 GCCCACTGCAGCCTTGACCTCGG - Intronic
1162612513 19:11767389-11767411 GGCCACTGCGGCCCTGGCCCTGG + Intronic
1162930828 19:13956681-13956703 GCCCACCACAGCCCTGCCCACGG + Intronic
1163171102 19:15531668-15531690 ACCCACCTCAGTCCTGGCCCAGG - Intronic
1164099731 19:22044130-22044152 GCCCTCTGTAGTCAGGGCCAAGG + Intergenic
1164157475 19:22605359-22605381 TCCCCCTGCAGTCCTGCCCTGGG + Intergenic
1165410573 19:35658343-35658365 GCCCACTGCAGAGCTGTCGATGG - Intronic
1166342021 19:42143769-42143791 GCCCAGTGCAGTCCTTCCCCAGG + Intronic
1166643893 19:44516952-44516974 CTCCACTTCAGTCCTGGTCAAGG - Exonic
1166884868 19:45954218-45954240 GCCCACAGCAGCCCTGGGCAGGG + Intronic
1166928787 19:46288438-46288460 GCTCACTGCAGCCTTGACCAGGG - Intergenic
1168220758 19:54958601-54958623 GGCCACTGCACTCCAGCCCAAGG + Intronic
1168335865 19:55597517-55597539 TCCCACCGTAGTCCTGACCAGGG + Intronic
927933119 2:27058414-27058436 GGCCATTGCAGCCCTGGACATGG + Exonic
927935661 2:27074750-27074772 GCCCACGGCTGTCCTGACCCTGG + Intergenic
928176873 2:29039966-29039988 GCCCTCTCCAGTACTGACCAGGG - Intronic
928330751 2:30356207-30356229 GCCCACAGGAGTCCTGGGAAAGG + Intergenic
929760384 2:44801841-44801863 GCCCCCTGCAGCCCCAGCCAAGG - Intergenic
930981159 2:57528083-57528105 ACCCAGTGCAGTCCTGGCTGTGG - Intergenic
932570627 2:72936554-72936576 GCCCCCCGCAGGCCTGGCCTCGG - Intergenic
932587256 2:73038584-73038606 CCCCACTGCACTCCAGGCCTGGG + Intronic
933657162 2:84898522-84898544 GAGGACTGCAGTCCTGGCCGTGG - Intronic
933663587 2:84946723-84946745 GCCCACTGCAGGCCGGGCCCTGG - Intergenic
935386265 2:102502724-102502746 TCCCACTGCAGCCCTGGCACAGG - Intronic
935746649 2:106194636-106194658 GGCCACTGCAGTCGTGCCCTTGG - Intergenic
936400828 2:112163230-112163252 GCCAGCTGCACTCCTGGACAGGG + Intronic
936513560 2:113167672-113167694 GCCCACAGCTGAGCTGGCCAGGG + Intronic
937032608 2:118753103-118753125 GCCCACTGCAGACCAGGGCTTGG - Intergenic
937037419 2:118793537-118793559 GGCCACTGTAACCCTGGCCATGG - Intergenic
939077506 2:137621485-137621507 GCCTTCTGCATTCCTTGCCATGG - Intronic
942247880 2:174024100-174024122 TGCCCCTGCAGGCCTGGCCACGG + Intergenic
946015684 2:216602364-216602386 TCACACTGGAGTCCTGGGCAGGG - Intergenic
947670652 2:231933594-231933616 GCCCACTGCTCTGCTGCCCATGG - Intergenic
947745925 2:232507253-232507275 GCCCATGGCAGTCCTGGCTCCGG - Intergenic
947998792 2:234550597-234550619 GCCAACTGCATCCCTAGCCAGGG + Intergenic
948635402 2:239331339-239331361 GCCCACTGCATTTCTGGTCAGGG + Intronic
1169134887 20:3191150-3191172 AATCACTGCAGTCCTGGCCTTGG - Intronic
1169282159 20:4277183-4277205 GCCCCTTGCAGTCAAGGCCAGGG + Intergenic
1170900697 20:20460029-20460051 GCCCTCTACAGTGCTTGCCACGG + Intronic
1171224006 20:23425383-23425405 GGCCACTGCAGACCTGGGCAGGG - Intergenic
1171544754 20:25991445-25991467 GCTGAGAGCAGTCCTGGCCAGGG + Intergenic
1173969107 20:47137381-47137403 GCCTGCTGCAGTCCAGGCCTGGG + Intronic
1173978185 20:47203107-47203129 ACCCACTGCAGAACTGTCCAAGG - Intergenic
1174831747 20:53820028-53820050 GCCCAGTGCAGTCCTAGCGGTGG - Intergenic
1175184118 20:57168251-57168273 GCCCCCAGCAGGCCTGGCGAAGG - Intergenic
1175795470 20:61767761-61767783 GGACACTGCAGCCCTGGGCAGGG + Intronic
1175943441 20:62548217-62548239 GTCCACGGCTGTCCTCGCCAGGG - Intergenic
1175960652 20:62634733-62634755 GCCAAGGGCAGTCCTGGACAGGG + Intergenic
1176084903 20:63291430-63291452 GGTGCCTGCAGTCCTGGCCATGG - Intergenic
1176230973 20:64032745-64032767 GGCCCCTGCAGACCTGGCCCTGG - Intronic
1180982775 22:19886712-19886734 GCCCACTGCAGGCCTCCCCATGG + Intronic
1182945680 22:34319508-34319530 GACCACTGCAGTCCTCTCCATGG - Intergenic
1183454174 22:37912471-37912493 CACTTCTGCAGTCCTGGCCAAGG + Exonic
1183629380 22:39024001-39024023 GCCTACAGCGGTGCTGGCCACGG + Intronic
1183630636 22:39030373-39030395 GCCTACAGCAGTGCTGGCCTCGG + Intronic
1183634091 22:39050465-39050487 GCCTACAGCAGTGCTGGCCTCGG + Intronic
1184684486 22:46089979-46090001 GGCCGCCGCGGTCCTGGCCAGGG + Intronic
1184880556 22:47301848-47301870 GCCCACTGCAGAAGGGGCCAGGG - Intergenic
949296638 3:2532293-2532315 CACCACTGCAGTCCAGCCCAGGG - Intronic
949442636 3:4099017-4099039 GGCCACTGCAGTCCTTAACAAGG + Intronic
951767300 3:26214660-26214682 TCCCACTTGAGTCCTGGCCTCGG + Intergenic
952966869 3:38626427-38626449 GTCAACTGAACTCCTGGCCAGGG + Intronic
953405277 3:42656807-42656829 ACCCACTGCTCTCCTGGCGATGG + Intronic
953498745 3:43412449-43412471 GCCCAGTGCAGTGCAGGCAACGG - Intronic
953931784 3:47009349-47009371 GCCCCCGGCAGGCCTGGCCCGGG + Exonic
954170401 3:48797458-48797480 ACTCACTGCAGTCCTGGTCTAGG + Intronic
954794353 3:53154050-53154072 GCCCACTGGGATCCTGCCCAGGG + Intergenic
956046514 3:65201426-65201448 GCCGATTACAGTCCAGGCCATGG - Intergenic
956832904 3:73070881-73070903 GCCCACTGATTTCCTGGCAAGGG - Intergenic
956871244 3:73420379-73420401 GACCACTGCAGTCCTGCCAGTGG + Intronic
960140062 3:114142961-114142983 GCCCCCAGCAGGCCTGGCCCTGG + Intronic
961713702 3:128845319-128845341 GCCCCCTACAGCCCTGGTCATGG - Intergenic
961726361 3:128933478-128933500 GCCCACTGCACACCAGGCCATGG - Intronic
962178783 3:133183527-133183549 GCCTGCTTCTGTCCTGGCCAGGG + Intronic
964734550 3:159903238-159903260 CGCCACTGCAGCCCTTGCCACGG + Intergenic
965110858 3:164420415-164420437 GGCCACTGCACTCCAGGCCTGGG - Intergenic
965849690 3:173009408-173009430 GGCCTTTGTAGTCCTGGCCATGG + Intronic
968503380 4:961245-961267 GCCCACCGCTGACCTGGCCCTGG + Intronic
968928510 4:3562748-3562770 GCCCCCTGCAGTCCTGGGAGTGG - Intergenic
969527305 4:7710378-7710400 ACCCACTGCAGGCCGGGCCCAGG - Intronic
980044674 4:127974410-127974432 GGCTACTGCACTCCAGGCCAGGG - Intronic
980354605 4:131725163-131725185 GCTGACACCAGTCCTGGCCAGGG + Intergenic
980356758 4:131735135-131735157 GCTCAGACCAGTCCTGGCCAGGG + Intergenic
980357841 4:131740118-131740140 GCTCAGACCAGTCCTGGCCAGGG + Intergenic
980358911 4:131745098-131745120 GCTCAGACCAGTCCTGGCCAGGG + Intergenic
982729507 4:158940889-158940911 GACTACTGCAGTCCTGTCTAAGG - Intronic
984731763 4:183075119-183075141 GCCCACTGCACTCCAGCCCGGGG + Intergenic
985367350 4:189245706-189245728 GCCTACTGAAGTCTTGGCAATGG + Intergenic
986200468 5:5574101-5574123 GCCCAGCGGAGTCCTGGTCAGGG + Intergenic
987415134 5:17654554-17654576 GGTCACTCCAGTCATGGCCATGG + Intergenic
988497551 5:31758027-31758049 GCCCACAGCAGTCCCTGCCCAGG + Intronic
988584435 5:32496510-32496532 GCCCACAGAAATTCTGGCCATGG + Intergenic
990900056 5:60739891-60739913 GCCCAGTGCAGTCCCAGTCATGG + Intergenic
995692133 5:114839141-114839163 GACTCCTGCAGTTCTGGCCATGG + Intergenic
996545799 5:124677853-124677875 GCCTTCTGCAGTGCTGGGCAAGG - Intronic
997624967 5:135325273-135325295 GCCCCTTGCAGGCCTGGCTAGGG + Intronic
998429763 5:142060818-142060840 TCCCACTCCTGTCCTTGCCATGG + Intergenic
999222036 5:149988353-149988375 GCTCACTGCAGTCTTGACCTGGG + Intronic
999263187 5:150250190-150250212 ACCCTCCACAGTCCTGGCCATGG - Intronic
1001154141 5:169258428-169258450 TCCCAGTGAAGTCCTGGCCAAGG + Intronic
1003171502 6:3724933-3724955 CCACACTCCAGGCCTGGCCATGG - Intronic
1004300688 6:14454600-14454622 TGTCACTGCTGTCCTGGCCAGGG - Intergenic
1008597740 6:53060293-53060315 GACCCCTGCTGTCCTTGCCAAGG - Intronic
1009413764 6:63394782-63394804 GCACCCGGCAGTCCTGGGCAGGG - Intergenic
1011556397 6:88574640-88574662 GCCCTCTGCAGTCATGGGGATGG - Intergenic
1011930178 6:92701499-92701521 GGGCACTGCAGGCCTGCCCATGG - Intergenic
1012245844 6:96924699-96924721 GCCACCTGCAGTGCTGGCTAGGG + Intronic
1012979778 6:105817389-105817411 GCCCACTGCAGCCACGGCCGTGG + Intergenic
1013430422 6:110050413-110050435 CCCCGCTGCTGACCTGGCCAAGG - Intergenic
1014964502 6:127730223-127730245 TGCCACTGCAGTCCAGGCCTGGG + Intronic
1016175560 6:141074547-141074569 GCCCAGTCCAGCCCTGCCCATGG - Intergenic
1017725483 6:157273812-157273834 GCCCACCCGAGGCCTGGCCAGGG - Intergenic
1017759866 6:157559899-157559921 GCTCCCTGCAGCCCTGTCCATGG - Intronic
1018065348 6:160121892-160121914 GCCCAGAGCAGGTCTGGCCACGG + Exonic
1018198980 6:161378276-161378298 GGCCACAGCAGTCCTGGGCCAGG + Intronic
1018866158 6:167748400-167748422 GTCCCCTGCAGTCCTGGCATTGG - Intergenic
1018866173 6:167748452-167748474 GTCCCCTGCAGTCCTGGCATTGG - Intergenic
1018940744 6:168307834-168307856 GCCACCTGCTCTCCTGGCCACGG + Exonic
1019436265 7:1023801-1023823 GGCCCCTGCAGCCCAGGCCAGGG + Intronic
1019550209 7:1598470-1598492 GCCTTCTGCAGGACTGGCCAGGG + Intergenic
1021327866 7:19296682-19296704 GCCCACTGCAATCTTGGCCATGG - Intergenic
1021647179 7:22799861-22799883 GGTAATTGCAGTCCTGGCCAAGG - Intergenic
1021841765 7:24726762-24726784 GCCCACTGCACTCCAGCCCGGGG + Intronic
1022494297 7:30843626-30843648 GCCCACTGCTGTCCACACCAGGG + Intronic
1023029267 7:36078815-36078837 GCCCACTGCAGCCCTGGCGATGG + Intergenic
1023831267 7:44040157-44040179 ACACTCTGCAGTCCAGGCCAGGG + Intergenic
1023848252 7:44135468-44135490 GGGCCCTGCAGGCCTGGCCAGGG + Intergenic
1023874941 7:44281844-44281866 GCCCACTGCTCTCCCGGCCAGGG + Intronic
1024949094 7:54839735-54839757 ACACCCTGCAGCCCTGGCCAAGG - Intergenic
1024984779 7:55185530-55185552 GGACTCTGCAGTCCTGGGCATGG - Intronic
1025138196 7:56438306-56438328 CGCCACTGCAGTCCGGGCCTTGG + Intergenic
1025728317 7:64088012-64088034 GCCCACTTCTGTTCTGGCCTGGG - Intronic
1025780710 7:64599510-64599532 GCCCTCTGCAGGCTGGGCCAAGG - Intergenic
1026930271 7:74219869-74219891 CCCCACATCAGGCCTGGCCACGG - Intronic
1027008937 7:74724884-74724906 GCCCACTGCACTCCCAGCCTGGG + Intronic
1029284769 7:99457963-99457985 GCCCACAGCACTCATGGCAAGGG + Intronic
1029606191 7:101600845-101600867 GCCCAGAGCAGTCCTGGCTGGGG - Intergenic
1029741597 7:102494463-102494485 ACACTCTGCAGTCCAGGCCAGGG + Intronic
1029759588 7:102593632-102593654 ACACTCTGCAGTCCAGGCCAGGG + Intronic
1029776955 7:102689542-102689564 ACACTCTGCAGTCCAGGCCAGGG + Intergenic
1031720606 7:125171340-125171362 GCCCACTTCAGACATGGGCAAGG + Intergenic
1032201861 7:129827827-129827849 GCCCTCTTCAGCCCTGCCCATGG + Intergenic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1032436656 7:131906434-131906456 CCCCACTTCAGGCCAGGCCAGGG - Intergenic
1033312725 7:140273572-140273594 AGCCGCTGCAGTCCTGACCAGGG + Intergenic
1034400817 7:150860434-150860456 GCCCCCCTCAGTCCTGCCCAGGG - Exonic
1035064479 7:156095100-156095122 GCCCACTGCACCCCAAGCCATGG + Intergenic
1035314338 7:157988802-157988824 GCCCAGAGCAGCCCTGCCCAGGG - Intronic
1035659050 8:1333225-1333247 ACCCACTGCTACCCTGGCCAGGG + Intergenic
1036278636 8:7379704-7379726 GGACACTGCAATCCTAGCCAAGG + Intronic
1036342886 8:7932164-7932186 GGACACTGCAATCCTAGCCAAGG - Intronic
1036400382 8:8402470-8402492 GCCCAGTGCAGGCCAAGCCATGG + Intergenic
1036704245 8:11034797-11034819 GCACAGAGCAGACCTGGCCATGG - Intronic
1036813793 8:11886250-11886272 GCTCATTACAGTCCTGGTCAGGG + Intergenic
1036838228 8:12092919-12092941 GGACACTGCAATCCTAGCCAAGG - Intergenic
1036860018 8:12339167-12339189 GGACACTGCAATCCTAGCCAAGG - Intergenic
1037823395 8:22146748-22146770 GCCCACGGGAGGCCTGGCAATGG - Intergenic
1037947203 8:22996958-22996980 TCCCGGGGCAGTCCTGGCCAGGG + Intronic
1038356157 8:26831414-26831436 GCCCACTTGAGCACTGGCCATGG - Intronic
1038610662 8:29057688-29057710 CCCCACTGCATTCCAGCCCATGG + Intronic
1039379013 8:37067551-37067573 GCCCGCTTCAGACCTGGCCTTGG + Intergenic
1040960142 8:53023065-53023087 GCCCAATGCAGTTCTGTGCATGG + Intergenic
1041635190 8:60134710-60134732 GCCCACGGCAGTCCAGGCATTGG + Intergenic
1042799773 8:72706035-72706057 GCCAACAGCAGACCTGGCTAGGG + Intronic
1044110295 8:88264675-88264697 GAGCATAGCAGTCCTGGCCATGG - Intronic
1047196125 8:122722850-122722872 GCCCCATGCAGTGCTGACCAAGG - Intergenic
1047952598 8:129947484-129947506 GCCCACTGCAGTTCCTGCCATGG + Intronic
1048022781 8:130555715-130555737 TCCCACTGCAATCCTAGACATGG - Intergenic
1049004344 8:139845329-139845351 CTCCACTGCATTCCTGGCCCAGG + Intronic
1049601978 8:143512184-143512206 GGCCACTGCAGCGCTGCCCAGGG + Intronic
1049610353 8:143552412-143552434 GCCCACCTCAGACCTGCCCAGGG + Intergenic
1050127133 9:2368485-2368507 GCTCACTGGAGTTGTGGCCATGG - Intergenic
1051476740 9:17516965-17516987 GCCCACTGCATTCCAGGAGATGG - Intergenic
1051566428 9:18504610-18504632 GCCCACTTCAGTCATTGCCCAGG + Intronic
1053070825 9:35100985-35101007 GGCCAGTGCAGTTCTGGCGAAGG - Exonic
1053344727 9:37370033-37370055 TCCCACTGCAGACCTGGCTGTGG + Intergenic
1053803392 9:41777890-41777912 GCCCCCTGCAGTCCTGGGAGTGG - Intergenic
1054141871 9:61537234-61537256 GCCCCCTGCAGTCCTGGGAGTGG + Intergenic
1054191684 9:61989200-61989222 GCCCCCTGCAGTCCTGGGAGTGG - Intergenic
1054461629 9:65468412-65468434 GCCCCCTGCAGTCCTGGGAGTGG + Intergenic
1054646686 9:67598512-67598534 GCCCCCTGCAGTCCTGGGAGTGG + Intergenic
1055281299 9:74677292-74677314 GCCCAAAGTAGTGCTGGCCACGG - Intronic
1055610667 9:78020878-78020900 GCCCACTTTACTCCTGGCCCAGG - Intronic
1055772241 9:79729968-79729990 TCTCACTGCAGGCCTAGCCAGGG + Intergenic
1056576599 9:87859671-87859693 GCCCAGTGGACACCTGGCCACGG - Intergenic
1056753133 9:89365777-89365799 GGCCACTACTGTCCTGCCCAGGG - Intronic
1059255787 9:112929438-112929460 GCCCATTGCAGTCCTGTGCTGGG - Intergenic
1060266558 9:122115143-122115165 CCCTACCCCAGTCCTGGCCATGG + Intergenic
1060430144 9:123543925-123543947 CCCCACCGCAGACCTGACCAGGG - Intronic
1060543935 9:124449817-124449839 TCCCTCTGCAGCCCTGGCCCTGG + Intergenic
1060992200 9:127855587-127855609 GACCACTGCACTCCTGGCCTAGG + Intergenic
1061294106 9:129667642-129667664 TCGTACTCCAGTCCTGGCCAGGG + Intronic
1062305628 9:135905485-135905507 GCCCAGTGCATTCTTGGGCATGG - Intronic
1062350694 9:136137308-136137330 GCCCACTGCAGACCAGGCAGGGG + Intergenic
1062541607 9:137044087-137044109 GCACACTGCAGGCAGGGCCACGG + Intronic
1062589586 9:137267394-137267416 GCCGTATGCAGTCCTGCCCAGGG + Intronic
1203730887 Un_GL000216v2:88443-88465 GGCCACTGCACTCCAGCCCAGGG + Intergenic
1203441680 Un_GL000219v1:15574-15596 GCCCACTGAAGCCCTGGCGGGGG - Intergenic
1186618294 X:11212981-11213003 GCCCCCTGCAGGCATGCCCATGG + Intronic
1186705913 X:12138874-12138896 GCGCACTGAGGTCTTGGCCATGG + Exonic
1187423753 X:19159491-19159513 GCCCAATGCAGTCCTCTCCTTGG - Intergenic
1192533348 X:71908498-71908520 ACCCACTCTAGTCCTGGCAAGGG + Intergenic
1195203399 X:102571536-102571558 GCCAACCCCAGTCCTGGGCACGG - Intergenic
1195666507 X:107436288-107436310 GCCCACTGTACTCCAGGCTAGGG - Intergenic
1198651078 X:138864504-138864526 GCCAACCGAAGTCCTGGCCCAGG + Intronic
1199882643 X:151986812-151986834 GACAACTGCTGTCATGGCCAAGG - Intergenic
1200845541 Y:7828825-7828847 GCCCACTTCTGCTCTGGCCACGG + Intergenic
1200986831 Y:9309802-9309824 GCTCACTGCAGCCTTGGACACGG - Intergenic
1202257408 Y:22936450-22936472 TCCAACTGCAGACCTGGCGATGG - Intergenic
1202410398 Y:24570197-24570219 TCCAACTGCAGACCTGGCGATGG - Intergenic
1202460383 Y:25099875-25099897 TCCAACTGCAGACCTGGCGATGG + Intergenic