ID: 1084706260

View in Genome Browser
Species Human (GRCh38)
Location 11:70817562-70817584
Sequence CAACGGTTCTAGGTGACAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 68}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084706251_1084706260 16 Left 1084706251 11:70817523-70817545 CCCACATCACAGGCAAACCTGAA 0: 1
1: 0
2: 1
3: 14
4: 195
Right 1084706260 11:70817562-70817584 CAACGGTTCTAGGTGACAAAGGG 0: 1
1: 0
2: 1
3: 3
4: 68
1084706252_1084706260 15 Left 1084706252 11:70817524-70817546 CCACATCACAGGCAAACCTGAAT 0: 1
1: 0
2: 0
3: 14
4: 171
Right 1084706260 11:70817562-70817584 CAACGGTTCTAGGTGACAAAGGG 0: 1
1: 0
2: 1
3: 3
4: 68
1084706255_1084706260 -1 Left 1084706255 11:70817540-70817562 CCTGAATGGTTGGTCACTCTACC 0: 1
1: 1
2: 13
3: 43
4: 173
Right 1084706260 11:70817562-70817584 CAACGGTTCTAGGTGACAAAGGG 0: 1
1: 0
2: 1
3: 3
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084706260 Original CRISPR CAACGGTTCTAGGTGACAAA GGG Intronic
904001086 1:27339174-27339196 CTACGGGTATAGGTGACGAAGGG + Intergenic
907819697 1:57954863-57954885 TAACAGTTCTAGGTGACAAATGG + Intronic
910422064 1:87076689-87076711 CAACTCTTCTAGTTGAAAAATGG + Intronic
910562189 1:88602299-88602321 CATGGGTTCAAGATGACAAAAGG + Intergenic
921268738 1:213448326-213448348 CAACAGTTCTAGATGACGGATGG + Intergenic
924381594 1:243470414-243470436 CAACTGCTCTAAGTTACAAATGG + Intronic
924760972 1:246985511-246985533 TTACGGTTGTAGGTAACAAATGG - Exonic
1067818729 10:49507223-49507245 CAACTCTTCAAGGTAACAAAAGG + Intronic
1069307777 10:66993134-66993156 CCACAGTGCTAGCTGACAAATGG + Intronic
1070645801 10:78201383-78201405 CAACGGCTCTAGGAGAGAATGGG + Intergenic
1075580386 10:123613320-123613342 CAAAGGTTCCAGGTCAGAAAAGG + Intergenic
1075634106 10:124018746-124018768 CAACGGATCAAGGTGAGAAGGGG + Intronic
1077330901 11:1983434-1983456 CCCCAGTTCTAGGTGGCAAATGG - Intronic
1084706260 11:70817562-70817584 CAACGGTTCTAGGTGACAAAGGG + Intronic
1085295433 11:75429064-75429086 CAGCGGTTGGAGGTGAGAAAAGG - Intronic
1087368821 11:97254943-97254965 AAAATGTTTTAGGTGACAAAGGG - Intergenic
1202813881 11_KI270721v1_random:38613-38635 CCCCAGTTCTAGGTGGCAAATGG - Intergenic
1096422111 12:51467567-51467589 CCAGGCTTCTAGGTGACAGAAGG + Intronic
1107342497 13:39423248-39423270 CAACACTTCTATGTGCCAAATGG + Intronic
1112838280 13:103544605-103544627 CATCAGTTCTATGAGACAAATGG - Intergenic
1113459237 13:110470339-110470361 CACAGGTTCTAGGTGACAAGTGG - Intronic
1119176354 14:72570377-72570399 CAACTGTACTAGGAAACAAAGGG + Intergenic
1124091655 15:26609870-26609892 CAACAGTTCTATGGGACAATTGG - Intronic
1134232691 16:12440968-12440990 CTACGATTCTAAGTCACAAAAGG - Intronic
1144166085 17:12612095-12612117 CTACAGTTCTAGATGAGAAAGGG - Intergenic
1153938201 18:9950897-9950919 CAACAGCCCTAGGTGACTAATGG - Intronic
1154024562 18:10695378-10695400 TTAGGGTTCTAGGTGACAGAGGG + Intronic
1159361932 18:67416529-67416551 CAAGAGTTCTAGGAAACAAAAGG + Intergenic
1163594224 19:18211536-18211558 CATCTGTTCTAGGTGACATGCGG - Intronic
925123429 2:1437288-1437310 CAAAGCTTCTAGGTGACCACCGG - Intronic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
932739359 2:74280040-74280062 GAAGGGTTCTAGGTGGGAAAAGG - Intronic
939966110 2:148612034-148612056 GAACAGTCCTTGGTGACAAATGG + Intergenic
946703469 2:222435486-222435508 CATGGGTTCAAGTTGACAAAAGG - Intronic
948095877 2:235333816-235333838 CAAGGCTTCTGGGTGAAAAAAGG + Intergenic
1173414816 20:42846089-42846111 CCATGGTTCTGGGTGACACACGG - Intronic
1177422655 21:20881229-20881251 CAAAAGTACTAGGTGACAACAGG - Intergenic
1182706031 22:32280976-32280998 CAACAGTTCTAGAAAACAAAAGG + Intergenic
1184394352 22:44224059-44224081 CAACAGTTCTAGAAAACAAAAGG + Intergenic
1184923904 22:47624383-47624405 CAGCGAGTCAAGGTGACAAATGG + Intergenic
949410939 3:3763645-3763667 CAACGGTGTTAAGTGTCAAATGG - Intronic
949861016 3:8504785-8504807 CAACATTTCTTGGTAACAAAGGG + Intronic
951202803 3:19893362-19893384 CAAAAGTTCTAGGTGAAAATAGG + Intronic
957801185 3:85084406-85084428 CAACTGTTCAAGGTGATAATTGG - Intronic
967030929 3:185605992-185606014 CAGTGGTTCCAGGTGACTAAAGG + Intronic
967852317 3:194091412-194091434 CAACTTTTCTAGGTGACTCATGG - Intergenic
974751733 4:66150985-66151007 CAAGGATTGTAGATGACAAAAGG - Intergenic
976134122 4:81917571-81917593 CAACGGTTATAAATGACTAAGGG - Intronic
980411074 4:132419751-132419773 CATCAGTTCTATGAGACAAATGG + Intergenic
983229924 4:165119217-165119239 CAACCGTTCTAGGAATCAAAGGG + Intronic
984550521 4:181153727-181153749 CAATGGTGTTAGATGACAAAAGG - Intergenic
984667152 4:182441246-182441268 CAATGGTGCTAGGTGACATTAGG + Intronic
985616481 5:925788-925810 GAAAGGTTCTAGGTAACAAACGG - Intergenic
990965964 5:61448169-61448191 CATCAGTTCTATGTGACAATTGG + Intronic
996387967 5:122928663-122928685 CAGAGGTTCTAGGTGATAACAGG - Intronic
1004461215 6:15838235-15838257 CAACCATTCTAGAAGACAAAAGG + Intergenic
1007447413 6:41917659-41917681 CAAAGATTCTAGATGACACACGG + Intronic
1016788375 6:148038690-148038712 CAAAGGTTAGAGGTGACATATGG - Intergenic
1017905986 6:158757815-158757837 TAACAGTAATAGGTGACAAATGG + Intronic
1019618438 7:1977747-1977769 GAGAGGTTCTAGGTGCCAAAAGG + Intronic
1027530240 7:79322326-79322348 CAATGTTTCTAGGTGACTAGTGG - Intronic
1028673139 7:93427906-93427928 GTAAGGTTCGAGGTGACAAATGG + Intronic
1028859832 7:95636710-95636732 AAATGGTTGTAGGTGACAAAAGG + Intergenic
1030391153 7:108930576-108930598 CAAAGGGTCCAGATGACAAAGGG - Intergenic
1032923188 7:136573819-136573841 TAATGGTTCAAGTTGACAAAGGG - Intergenic
1039497565 8:37992503-37992525 CTACGATTCTAGGTGACATTTGG + Intergenic
1040062853 8:43119156-43119178 CATCGTTTTTAGGTGAAAAATGG + Intronic
1047307896 8:123668017-123668039 CATCAGTTCTAGGGGACAATTGG + Intergenic
1055211067 9:73792418-73792440 CAATGGTTCTGGATGACAAGAGG + Intergenic
1057086145 9:92212605-92212627 CAACAGTACTTGGTGACCAAAGG + Intronic
1060871856 9:127049184-127049206 CAACAGTTCTATGTGAAACACGG - Intronic
1189407566 X:40738826-40738848 CATCGGTTCTATGGGACAATTGG - Intergenic
1189589084 X:42492994-42493016 TAACTGATGTAGGTGACAAATGG + Intergenic