ID: 1084706565

View in Genome Browser
Species Human (GRCh38)
Location 11:70819385-70819407
Sequence CCACGAAAGCTGCACCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 107}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084706565_1084706571 7 Left 1084706565 11:70819385-70819407 CCCTGCAGGTGCAGCTTTCGTGG 0: 1
1: 0
2: 0
3: 10
4: 107
Right 1084706571 11:70819415-70819437 CGACACCAACCCTAGCACCTGGG 0: 1
1: 0
2: 0
3: 6
4: 116
1084706565_1084706570 6 Left 1084706565 11:70819385-70819407 CCCTGCAGGTGCAGCTTTCGTGG 0: 1
1: 0
2: 0
3: 10
4: 107
Right 1084706570 11:70819414-70819436 CCGACACCAACCCTAGCACCTGG 0: 1
1: 0
2: 0
3: 12
4: 108
1084706565_1084706572 8 Left 1084706565 11:70819385-70819407 CCCTGCAGGTGCAGCTTTCGTGG 0: 1
1: 0
2: 0
3: 10
4: 107
Right 1084706572 11:70819416-70819438 GACACCAACCCTAGCACCTGGGG 0: 1
1: 0
2: 0
3: 7
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084706565 Original CRISPR CCACGAAAGCTGCACCTGCA GGG (reversed) Intronic
900463567 1:2812948-2812970 CCACGGAAAATGCACTTGCAGGG - Intergenic
901213572 1:7540442-7540464 CCAGGAAAGCAGCTCCTGCTGGG + Intronic
901278690 1:8013991-8014013 CCACGGAAGCTTCGCCTGCCAGG + Exonic
903007033 1:20305624-20305646 CCTCTACAGCTGCCCCTGCATGG - Intronic
903540527 1:24093819-24093841 CCAGGGAGGCTGCACCTGCTGGG - Intronic
903658655 1:24963949-24963971 GCACTGAAGCTGGACCTGCACGG - Intronic
915830475 1:159124870-159124892 CCACCTAAGATGCACCTGGAAGG - Intronic
920741064 1:208581777-208581799 TCACAAAAGCTGCAGCTGCAAGG - Intergenic
1068631082 10:59298257-59298279 CCACCAAAGCTTCTCCTTCAAGG + Intronic
1069717457 10:70530125-70530147 CCTCTAAAGCTGCCCCTCCAAGG - Intronic
1071009824 10:80924917-80924939 CCACTGAAACTGCTCCTGCAAGG - Intergenic
1073940429 10:108691697-108691719 CCATGAAGGCTCCACCTTCAGGG - Intergenic
1081709391 11:45207199-45207221 CCACGGAAGCTGGACATGAAGGG - Intronic
1084630344 11:70344215-70344237 TCCTGAAAGCTGCACCTGGAAGG + Intronic
1084706565 11:70819385-70819407 CCACGAAAGCTGCACCTGCAGGG - Intronic
1084726487 11:70945743-70945765 CCACCAAAGCTGCAGGTGCCTGG + Intronic
1087865462 11:103221250-103221272 ACATGAAACCTGAACCTGCATGG - Intronic
1089155208 11:116396761-116396783 CCAGGAAGGCTGCACTTGAAGGG - Intergenic
1090678114 11:129024069-129024091 CCAAGAAAACTGCTGCTGCAGGG - Intronic
1091921119 12:4305754-4305776 CCAGGAAAGCTGCAGGGGCAGGG - Intergenic
1093479567 12:19590714-19590736 CCACGCAAGCTGCATTTCCAAGG - Intronic
1095052442 12:37566715-37566737 CCACACAAGTTGCACCTGCGGGG - Intergenic
1096219501 12:49820225-49820247 CCTGGGAGGCTGCACCTGCACGG + Intronic
1099513943 12:83572007-83572029 CCACGAGGGCTCCACCTTCATGG - Intergenic
1100826988 12:98483776-98483798 CCTCCAGTGCTGCACCTGCAAGG + Intergenic
1104512242 12:129391499-129391521 CCTCGAAAGGTTCTCCTGCACGG + Intronic
1107860514 13:44655876-44655898 CCTCTAAAGCTCCACTTGCAGGG + Intergenic
1108784097 13:53873406-53873428 CAACCAAAGCTCCAACTGCATGG + Intergenic
1112186595 13:97133756-97133778 TCAGGAAAGCTGCATCTGCAAGG + Intergenic
1112606695 13:100913400-100913422 CCACAAAAGCAGCACCTGGGAGG - Intergenic
1112727974 13:102326930-102326952 CCACGGAAACTGAACCTGAAGGG + Intronic
1118200187 14:63664028-63664050 CCGCCCAAGCTGCAGCTGCAGGG - Intergenic
1120128138 14:80772116-80772138 CCACAAAGGCTGCACCCTCAAGG + Intronic
1123979074 15:25582788-25582810 TCACGAAAGCTCCACCTCCCGGG - Intergenic
1124008292 15:25811841-25811863 CCAAGCTGGCTGCACCTGCATGG + Intronic
1124408146 15:29410385-29410407 CCACCAGAGCAGCCCCTGCAGGG - Intronic
1125960032 15:43822447-43822469 CCATGAAACCTCCACCTGCCGGG + Intronic
1128684110 15:69671134-69671156 CCACCAAAGCAGCAGCTGCCAGG + Intergenic
1128815769 15:70607036-70607058 CCTCCAAATCTGCACCTGCTGGG - Intergenic
1130688941 15:86063642-86063664 CCACGTAAGCTGAGCCTCCATGG - Intergenic
1132247281 15:100307340-100307362 CCACAAAAGCTGCAGCTGCCAGG + Intronic
1136540989 16:30927638-30927660 CCAGGAAGGCCGCACCAGCAAGG + Exonic
1137023972 16:35455391-35455413 CCACCAAACCTGGACCTGAATGG + Intergenic
1138567632 16:57845200-57845222 ACATGAAGGCTGCACCTGCAGGG - Intronic
1140123931 16:72105067-72105089 CCCCGACAGGTGCACCTGCAAGG - Exonic
1142621626 17:1169081-1169103 ACACCAAAGCTGGCCCTGCAGGG + Intronic
1142721284 17:1777508-1777530 ACACGAAGGCTGCCCCTGTAAGG + Exonic
1143350467 17:6284475-6284497 CCACTAGAGCTGTGCCTGCAGGG + Intergenic
1153412489 18:4809407-4809429 CCATGAATTCTGCAGCTGCAAGG + Intergenic
1156336773 18:36179593-36179615 CCACAAAGGCTGCTCTTGCAGGG + Intronic
1157477204 18:48031015-48031037 CCACCCAAGCCACACCTGCAGGG - Intronic
1158973790 18:62692414-62692436 TCACCAATGCTGCTCCTGCAGGG - Intergenic
1158973805 18:62692492-62692514 TCACCAATGCTGCTCCTGCAGGG - Intergenic
1159639599 18:70848187-70848209 CTAAGCAAGCTGCACCAGCAAGG - Intergenic
1166930300 19:46297991-46298013 CCAGCAGAGCTGCACCTGCTGGG - Intronic
925413696 2:3655144-3655166 CCATGACAGCTGCTCCTTCAGGG + Intergenic
927449019 2:23190623-23190645 ACACGAAAGCAGCACATGCATGG - Intergenic
927519582 2:23690765-23690787 CCCCTAAAGCTGGACCTGGAAGG - Intronic
928126156 2:28618083-28618105 CCAGGAAAGTTCCAGCTGCAGGG - Intronic
930634345 2:53787645-53787667 CTACGAAAGCTGCTTCTGCAGGG - Intronic
932440019 2:71728752-71728774 TCACCTAAGCTGCACTTGCAGGG - Intergenic
934692278 2:96370880-96370902 CCAGGAATGCTGAACTTGCATGG + Intronic
935203796 2:100880937-100880959 CCAAGAAAGCAGCAAGTGCAGGG + Intronic
937325624 2:120988329-120988351 CCGCGACAGCTCCACCAGCACGG + Exonic
940111992 2:150165152-150165174 CCACTAAAGCTGTAACTGAAAGG - Intergenic
941097922 2:161261837-161261859 CCACAAAGGCTACACGTGCAAGG + Intergenic
943779906 2:191812077-191812099 GCCTGAAAGCTGCACCTGCTGGG - Intergenic
947438222 2:230091663-230091685 CCACCAAAACTGAACCAGCAAGG + Intergenic
947497643 2:230649866-230649888 CCAAGAAAGCTGGATCTGAATGG - Intergenic
948178373 2:235961414-235961436 CCACTGATGCAGCACCTGCAGGG + Intronic
949044825 2:241867555-241867577 CCACGTAAGCAGCTCTTGCAGGG + Intergenic
1172599907 20:36176414-36176436 CCACGAATGCTGCCTCGGCAGGG - Intronic
1177054652 21:16286116-16286138 ACACAAAAGCTGTATCTGCAAGG - Intergenic
1178056625 21:28806610-28806632 CCAGGAAAGATGCACCAGCCAGG - Intergenic
1178722115 21:35019210-35019232 AGAAGAAAGCAGCACCTGCAAGG - Intronic
1180017201 21:45095227-45095249 GCAGGTAGGCTGCACCTGCAGGG - Intronic
1181435233 22:22906583-22906605 CCACAAAAGCTACAGCTGCCAGG + Intergenic
1181872387 22:25910378-25910400 CCATGAAAGCTCTACCTTCATGG + Intronic
1184669390 22:46004831-46004853 CCAAGCAGGCAGCACCTGCATGG + Intergenic
950796054 3:15511551-15511573 CAACCAATGCTGCTCCTGCAGGG + Intronic
952650383 3:35719625-35719647 CCATGAACTCTGCACCTCCATGG - Intronic
954360726 3:50121494-50121516 CCATGACAGCTGCTCCTGGACGG - Intergenic
957039487 3:75326552-75326574 CAAGGAAAGCTGCACATGGAGGG - Intergenic
963167194 3:142216725-142216747 ACCCCAAAGCTGCACTTGCATGG + Intronic
965041008 3:163507035-163507057 CCATGAAAACTCCACCTACATGG - Intergenic
968268115 3:197378221-197378243 CCCAGAATGCTGCAACTGCAAGG - Intergenic
968525761 4:1055925-1055947 CCACGCAGGCCGCATCTGCAGGG + Intergenic
978661240 4:111129057-111129079 CCACGAAAGCTTGACCCACATGG + Intergenic
981637665 4:146899089-146899111 CCAATAAAGCTGCAACTGCAAGG + Intronic
981888602 4:149709819-149709841 CCACAGAAGCTGCTCCTGCAAGG + Intergenic
983134031 4:164057523-164057545 CCATGAAAGCTGCCCCAGAACGG + Intronic
986765742 5:10924393-10924415 CCATGAGAGCTCCACCAGCACGG - Intergenic
991015505 5:61927881-61927903 CAATGAAAGCTCCACCTCCAGGG + Intergenic
1001144962 5:169175835-169175857 CCTAGAGAGCTGCTCCTGCAGGG + Intronic
1001269693 5:170302055-170302077 ACAAGAAAGCAGTACCTGCAGGG + Intergenic
1002605482 5:180380573-180380595 CCAGGAAAGGTCCACCTCCAGGG + Intergenic
1002719048 5:181246875-181246897 CCCCTCAAGCTGCACCTGAAGGG - Intronic
1003194140 6:3899987-3900009 CCCCGACATCTGCAGCTGCATGG + Intergenic
1006834987 6:36992699-36992721 CCACGCAAGTTCCACCTGCCAGG + Intergenic
1007740557 6:44006944-44006966 CCAAGCAACCTGCATCTGCATGG + Intergenic
1011138389 6:84125122-84125144 CTCCGAGAGCTGCACCGGCAAGG - Exonic
1015944213 6:138483544-138483566 CCACTCCAGCTGCAACTGCAGGG + Intronic
1016001178 6:139042841-139042863 CCAGGAGAGCTGCTTCTGCAAGG + Exonic
1019334150 7:475088-475110 CCACGCATGCTCCACGTGCATGG - Intergenic
1021813797 7:24428313-24428335 CAGGAAAAGCTGCACCTGCAAGG - Intergenic
1024960047 7:54964552-54964574 CCATGAATGCTGCACCGTCATGG - Intergenic
1032535669 7:132661505-132661527 CCAAGGAAACTGCACCTGCAAGG - Exonic
1036525667 8:9532297-9532319 TCACCAAAGCTGGACCTGGAAGG - Intergenic
1039467758 8:37796586-37796608 AGACGCAAGCTGCACCGGCACGG + Intronic
1049526674 8:143130315-143130337 CGAGGGAAGCTGCACCTCCAGGG + Intergenic
1056847162 9:90049679-90049701 CCATGAGGGCTCCACCTGCATGG + Intergenic
1057200132 9:93135261-93135283 CCACGACAGCTCCTCCTTCATGG - Intergenic
1058129461 9:101233567-101233589 CCATGAAGGCTCCACCTTCATGG + Intronic
1061763559 9:132867613-132867635 CCACCAGAGCTTCACCTGCCGGG - Intronic
1062370295 9:136235298-136235320 CCACGACGGCCACACCTGCAGGG + Intronic
1203759792 EBV:6297-6319 CCACGAAAGGTCAGCCTGCAAGG + Intergenic
1192019924 X:67377274-67377296 CCATAAAAGCTTCAACTGCAGGG - Intergenic
1200568856 Y:4802812-4802834 ACAGGAATGCTTCACCTGCATGG - Intergenic