ID: 1084706593

View in Genome Browser
Species Human (GRCh38)
Location 11:70819516-70819538
Sequence CAGAGCTCCAACTCCCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 183}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084706593_1084706604 19 Left 1084706593 11:70819516-70819538 CCTGCTTGGGAGTTGGAGCTCTG 0: 1
1: 0
2: 1
3: 12
4: 183
Right 1084706604 11:70819558-70819580 TGGCTGCTTGGGAGGCAGGAGGG 0: 1
1: 0
2: 10
3: 77
4: 669
1084706593_1084706606 23 Left 1084706593 11:70819516-70819538 CCTGCTTGGGAGTTGGAGCTCTG 0: 1
1: 0
2: 1
3: 12
4: 183
Right 1084706606 11:70819562-70819584 TGCTTGGGAGGCAGGAGGGTGGG 0: 1
1: 0
2: 2
3: 69
4: 681
1084706593_1084706596 8 Left 1084706593 11:70819516-70819538 CCTGCTTGGGAGTTGGAGCTCTG 0: 1
1: 0
2: 1
3: 12
4: 183
Right 1084706596 11:70819547-70819569 TCCAGCTCCCCTGGCTGCTTGGG 0: 1
1: 0
2: 3
3: 33
4: 365
1084706593_1084706594 -1 Left 1084706593 11:70819516-70819538 CCTGCTTGGGAGTTGGAGCTCTG 0: 1
1: 0
2: 1
3: 12
4: 183
Right 1084706594 11:70819538-70819560 GAGTGCAAATCCAGCTCCCCTGG 0: 1
1: 0
2: 0
3: 12
4: 140
1084706593_1084706595 7 Left 1084706593 11:70819516-70819538 CCTGCTTGGGAGTTGGAGCTCTG 0: 1
1: 0
2: 1
3: 12
4: 183
Right 1084706595 11:70819546-70819568 ATCCAGCTCCCCTGGCTGCTTGG 0: 1
1: 0
2: 3
3: 35
4: 288
1084706593_1084706603 18 Left 1084706593 11:70819516-70819538 CCTGCTTGGGAGTTGGAGCTCTG 0: 1
1: 0
2: 1
3: 12
4: 183
Right 1084706603 11:70819557-70819579 CTGGCTGCTTGGGAGGCAGGAGG 0: 1
1: 0
2: 12
3: 142
4: 1010
1084706593_1084706607 24 Left 1084706593 11:70819516-70819538 CCTGCTTGGGAGTTGGAGCTCTG 0: 1
1: 0
2: 1
3: 12
4: 183
Right 1084706607 11:70819563-70819585 GCTTGGGAGGCAGGAGGGTGGGG 0: 1
1: 0
2: 10
3: 115
4: 1354
1084706593_1084706598 11 Left 1084706593 11:70819516-70819538 CCTGCTTGGGAGTTGGAGCTCTG 0: 1
1: 0
2: 1
3: 12
4: 183
Right 1084706598 11:70819550-70819572 AGCTCCCCTGGCTGCTTGGGAGG 0: 1
1: 0
2: 1
3: 30
4: 233
1084706593_1084706605 22 Left 1084706593 11:70819516-70819538 CCTGCTTGGGAGTTGGAGCTCTG 0: 1
1: 0
2: 1
3: 12
4: 183
Right 1084706605 11:70819561-70819583 CTGCTTGGGAGGCAGGAGGGTGG 0: 1
1: 1
2: 11
3: 160
4: 1183
1084706593_1084706600 15 Left 1084706593 11:70819516-70819538 CCTGCTTGGGAGTTGGAGCTCTG 0: 1
1: 0
2: 1
3: 12
4: 183
Right 1084706600 11:70819554-70819576 CCCCTGGCTGCTTGGGAGGCAGG 0: 1
1: 0
2: 7
3: 83
4: 807

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084706593 Original CRISPR CAGAGCTCCAACTCCCAAGC AGG (reversed) Intronic
903997802 1:27318707-27318729 CAGAGCTGAAACTGTCAAGCTGG - Intergenic
904317301 1:29673763-29673785 CAGACATCCATCTCCCTAGCAGG + Intergenic
905798381 1:40828232-40828254 CAGAGCTCGGCCTCCCCAGCAGG + Intronic
907277429 1:53324668-53324690 GAGAGCTCCAATGGCCAAGCTGG - Intronic
907464289 1:54624681-54624703 CAGGGCTCCATCTCCCAGCCTGG - Intronic
910015988 1:82524624-82524646 CATAGCTGTAACTCACAAGCTGG - Intergenic
910695982 1:90016290-90016312 CAGAGCTCATACTCTCAACCAGG + Intronic
912932859 1:113980278-113980300 CAGGGTTACAACTCCCAGGCAGG - Intronic
914830595 1:151168191-151168213 CAGAGGTCAAACTCCAAAGTGGG + Exonic
915100987 1:153499961-153499983 CCCAGCTCCAACTCCCAGACAGG + Intergenic
918239750 1:182611120-182611142 CAGACATCAACCTCCCAAGCTGG - Intergenic
918339273 1:183553803-183553825 CAGAGCTCAAACACACAAACTGG - Exonic
922001078 1:221479010-221479032 AAGAGCTGCAACTGGCAAGCTGG + Intergenic
922591424 1:226780060-226780082 CGGAGCTCCTACTCCCTATCAGG + Intergenic
1062803352 10:396253-396275 CATAGCTCCAAATACCAAGGTGG - Intronic
1063132818 10:3193315-3193337 CAGAGCTCCAATTCCCAACAGGG - Intergenic
1067166713 10:43871142-43871164 CAGAGCCCCAAGTCTCCAGCGGG - Intergenic
1067279310 10:44859311-44859333 CAGTTCTTCAACTTCCAAGCTGG + Intergenic
1067382720 10:45789827-45789849 CAGAGGTTAAACTCCCAAGCTGG - Intronic
1067472223 10:46545585-46545607 CAGAGGGCCAAGTCCCAGGCAGG + Intergenic
1067890423 10:50130372-50130394 CAGAGGTTAAACTCCCAAGCTGG - Intronic
1068887404 10:62111699-62111721 CAGCTCTGCAACTCACAAGCTGG - Intergenic
1069089759 10:64185665-64185687 CAGAGCTGCCACTACCAAGTTGG - Intergenic
1070274525 10:74992843-74992865 AAGGGCACCAACTCCCAATCTGG + Intronic
1070972474 10:80578949-80578971 AAGACATCCAAGTCCCAAGCTGG + Intronic
1070981752 10:80653992-80654014 CAGAGCCCCAACTTCCAGCCTGG - Intergenic
1072347032 10:94518122-94518144 CAGAGCTCCATCACGCAGGCTGG - Intronic
1073426332 10:103457766-103457788 CTCAGCTCCCACTCCCCAGCAGG + Intronic
1074115908 10:110457473-110457495 CAGAGCTCAGAGTCCCAGGCAGG + Intergenic
1077049479 11:560437-560459 CAGGGCTCCACCTCCCTCGCCGG + Intronic
1077386635 11:2272272-2272294 CAGACCACCAGCTCCCAGGCAGG - Intergenic
1078082110 11:8211609-8211631 CAGTGCTCCAACTGGCAGGCAGG - Intergenic
1078985277 11:16588356-16588378 TAGAGCTGAAACTCCCAAACTGG + Intronic
1079119635 11:17672608-17672630 CAGAGCTCTGACTCCCCACCTGG - Intergenic
1081122693 11:39285954-39285976 CAGGGCACCAAGTCCCAAGGAGG + Intergenic
1081666348 11:44919115-44919137 CATTCCCCCAACTCCCAAGCAGG + Intronic
1081736994 11:45411100-45411122 CAGAGATCAAACACCCCAGCGGG - Intergenic
1082110850 11:48272104-48272126 CAGATGTCAAACCCCCAAGCAGG - Intergenic
1083815515 11:65130420-65130442 CACAGACCCAACTCCCAGGCAGG + Intronic
1084095242 11:66907032-66907054 CTGTGCTCCAGCTCCCCAGCCGG - Intronic
1084706593 11:70819516-70819538 CAGAGCTCCAACTCCCAAGCAGG - Intronic
1087559221 11:99763293-99763315 CAGAGATGCAACACCCAAGAGGG + Intronic
1088335638 11:108700476-108700498 CAGACCTGCAGCTCCCATGCAGG + Intronic
1091092411 11:132784388-132784410 CACAGCACCAACTTCCAATCTGG + Intronic
1092244335 12:6855081-6855103 AAGAGCTCCAAAGCCCAAGAAGG + Intronic
1092445004 12:8547020-8547042 AAGAGCTCCCAGTCCAAAGCTGG - Intergenic
1092446834 12:8565940-8565962 AAGAGCTCCCAGTCCAAAGCTGG + Intergenic
1095049917 12:37546128-37546150 CAGAGCCCCAACAACGAAGCAGG - Intergenic
1096063348 12:48720292-48720314 CAGGGCACCAACTCCCTAGGTGG + Intergenic
1096456962 12:51795489-51795511 CAGAGCTCCAGCGGCCATGCTGG + Intronic
1096809495 12:54160520-54160542 CAGAGCCCCCACTCCCATTCTGG + Intergenic
1101849856 12:108393428-108393450 CAGTGCTCCCACTTCCCAGCTGG - Intergenic
1102614957 12:114145543-114145565 CAAAGCTCCATCTACCAAGGAGG + Intergenic
1104794271 12:131506256-131506278 CAGAGCACTCACTCCCAACCAGG + Intergenic
1106132984 13:26954695-26954717 CAGAGAGCCAACAGCCAAGCTGG - Intergenic
1111601657 13:90482009-90482031 CAGGGCACCAAGTCCCAAGGCGG + Intergenic
1113281328 13:108791593-108791615 CACAGCACTAACACCCAAGCAGG + Intronic
1113475580 13:110578459-110578481 CAGCGCTCAAACACCCATGCTGG - Intergenic
1113498033 13:110748857-110748879 CAGGTCTCCAACTCCCAGGCTGG - Intergenic
1114126722 14:19736071-19736093 CAGAGCTCCAAGTCCCAAAAGGG - Intronic
1114551579 14:23535421-23535443 CAGAGATCCAGCTGCCCAGCTGG - Intronic
1116639141 14:47438632-47438654 TGCAGCTGCAACTCCCAAGCTGG + Intronic
1118434334 14:65755755-65755777 CATAGCTCCAAGTCACAAGCAGG - Intergenic
1119122183 14:72089903-72089925 CAGGGTGCCAACTCCCAAGTGGG + Intronic
1121870468 14:97402471-97402493 CAGAGGTCAAAGTCCCAGGCTGG - Intergenic
1122329281 14:100901978-100902000 CACAGCACCAACTCCTGAGCAGG - Intergenic
1122899424 14:104776092-104776114 CAGGACTCCGCCTCCCAAGCAGG + Intronic
1123035743 14:105471214-105471236 CAGAGCTCTGGCCCCCAAGCAGG + Intergenic
1123942326 15:25222586-25222608 CAGAGCACCAACACCAAGGCTGG - Intergenic
1124503002 15:30246431-30246453 CAGAGCTACGAGTCCCAAACAGG - Intergenic
1124740554 15:32292215-32292237 CAGAGCTACGAGTCCCAAACAGG + Intergenic
1126590867 15:50338501-50338523 CAGAGCTCTGTCTCCCAGGCTGG + Intronic
1127722915 15:61720353-61720375 CAGAACTCCCACACTCAAGCAGG + Intergenic
1127965907 15:63922836-63922858 CAGAGCTCCCACTCTCCAGCTGG + Intronic
1128458482 15:67847656-67847678 TAGAGCTCCAAGTTCCAAGCAGG + Intergenic
1129082176 15:73051693-73051715 CTGACCTCCGGCTCCCAAGCCGG - Exonic
1129723703 15:77891196-77891218 CAGACCTCCAAGTCCCCAGTGGG + Intergenic
1131822503 15:96286988-96287010 CAAACCTCCAACTCCCATGAAGG + Intergenic
1132603736 16:785075-785097 CAGACCCACAGCTCCCAAGCTGG + Exonic
1133983884 16:10653249-10653271 CAGAGTTCCAGCTCCCAGGCAGG - Intronic
1134633050 16:15771022-15771044 TCTAGCTCCATCTCCCAAGCTGG + Intronic
1135492051 16:22917776-22917798 CAGGGCCCCAACTTCAAAGCAGG - Intergenic
1136923033 16:34346867-34346889 CTGAGCTCCAACTGAGAAGCTGG + Intergenic
1136981540 16:35064939-35064961 CTGAGCTCCAACTGAGAAGCTGG - Intergenic
1137484882 16:48882562-48882584 CAGAGCTAGAACTCCCAAGCTGG + Intergenic
1137600289 16:49751904-49751926 CAGAACTCAAACTCCCACCCAGG + Intronic
1141938172 16:87255723-87255745 CAAAGCCACCACTCCCAAGCTGG + Intronic
1142898449 17:2997169-2997191 CATAACTCCATATCCCAAGCAGG - Intronic
1146931356 17:36780429-36780451 CACAGCCTAAACTCCCAAGCAGG + Intergenic
1148109307 17:45135830-45135852 CACATCTCCAACTCCCGAACAGG - Exonic
1149537012 17:57440960-57440982 CAGAGCTACAGCTCCCACCCGGG - Intronic
1151384341 17:73746021-73746043 CAGGGCTCCAGCCCCCAACCAGG + Intergenic
1151418449 17:73982047-73982069 CAGAGCTCCGTCTCACAAGTGGG - Intergenic
1152267899 17:79306842-79306864 CAGAGGCCCAACGCCCAGGCTGG - Intronic
1156782193 18:40863857-40863879 AAGAATTCCAACTCCCAGGCTGG - Intergenic
1157121722 18:44917626-44917648 CAGAGCTCCAACCCTCCTGCTGG - Intronic
1160817587 19:1043274-1043296 CAGAGTTCCACTTCCCAAGAGGG - Intronic
1161170575 19:2810561-2810583 CAGAGCTCCGACCCCCACCCGGG - Intronic
1165097698 19:33418635-33418657 CAGGACCCCAACTCCCAGGCAGG + Intronic
1166972350 19:46577691-46577713 TAGAGCTGCCACTCCCTAGCTGG - Intronic
1168139531 19:54375964-54375986 AGGAGCTCCAACTGCCAACCGGG - Intergenic
1168158412 19:54491826-54491848 AGGAGCTCCAACTGCCAACCGGG + Intergenic
932133089 2:69204982-69205004 CTGAGCTCCCACTCTCCAGCAGG + Intronic
932276542 2:70456107-70456129 CAGTGCACCAACCCCCCAGCTGG + Intronic
933293096 2:80459621-80459643 CAGTGCTCCAATTCCTAACCTGG + Intronic
933775418 2:85768610-85768632 CTGAGCTCAACCTCCCAAGTGGG - Intronic
934974244 2:98789373-98789395 CACAGCTCCACCTGCCTAGCAGG - Intergenic
938625455 2:133104056-133104078 CAGAGCTGCCCCTCCCAAGTGGG + Intronic
939545294 2:143544796-143544818 CACAGGTCCATCTGCCAAGCAGG + Intronic
942209749 2:173658576-173658598 CAAAGATCCACCTTCCAAGCAGG - Intergenic
942448535 2:176093751-176093773 CACAACTCCCACTCCCAAGTAGG - Intronic
945054113 2:205853036-205853058 CAGAGCTAAAACTGCAAAGCAGG - Intergenic
946535140 2:220619584-220619606 TAGAGCTGCAACTCTCAAGTTGG + Intergenic
948887676 2:240892269-240892291 CAGGGCTCCCACTCCAGAGCTGG + Intronic
1168952337 20:1810982-1811004 CAGAGCTCCAGCTCTCAGCCCGG - Intergenic
1170419624 20:16179936-16179958 AAGTGCTCCAACTCTCAAGTTGG + Intergenic
1170945673 20:20889140-20889162 CAGAGCTCCAGCTGCCACACTGG + Intergenic
1171098404 20:22356158-22356180 AAAAAATCCAACTCCCAAGCTGG + Intergenic
1174362403 20:50037243-50037265 CAGAGTTCCAGCTGCCTAGCAGG + Intergenic
1175835976 20:61994685-61994707 CAGAGCTCCCCCTCCCCACCAGG - Intronic
1176104161 20:63377851-63377873 CAGAGCTCCGTCTCCCCAGGAGG - Intronic
1176260980 20:64179687-64179709 CAGAGTTCCAGGCCCCAAGCAGG - Intronic
1177118178 21:17110222-17110244 CAGGGCACCAACTCCCTAGGCGG + Intergenic
1178882087 21:36457655-36457677 CTGATCTCCAACTCCCGGGCTGG - Intergenic
1178935408 21:36857636-36857658 CAGAGCTCCCACTCCTAGGATGG + Intronic
1179983810 21:44910386-44910408 CAGAGCACCCACTCACCAGCCGG - Intronic
1180123368 21:45768916-45768938 CAGAGCTCCAAGGCGCAATCAGG + Intronic
1181373089 22:22433105-22433127 CAGATCTGCAACTTCCAAGGAGG - Intergenic
1181486876 22:23237140-23237162 CAGAGATTCAACTCACAAACAGG - Intronic
1181544995 22:23597723-23597745 CAGAGCTCCAGGACCCAAGGTGG + Intergenic
1181815316 22:25432159-25432181 CAGAGCTCCAGGACCCAAGGTGG - Intergenic
1181885538 22:26019188-26019210 CAGAGCTGAGACTCCCATGCTGG - Intronic
1181945711 22:26515755-26515777 AGGAGCTCAAACTCCCAGGCAGG + Intergenic
1182940095 22:34268897-34268919 CAGAGCTGCCACTCCCACACAGG + Intergenic
1184091900 22:42297310-42297332 CAGAGGTCAGACTCCCTAGCTGG + Intronic
1184682468 22:46079635-46079657 CAGAGCCCCAAGCCCCAGGCAGG - Intronic
1184782497 22:46656189-46656211 CAGAGCTCCAGCACCCACACTGG + Intronic
950094482 3:10320954-10320976 CTGAGTCCCAAATCCCAAGCTGG - Intronic
952935620 3:38396317-38396339 CAGAGCCCCACCTCCCCACCAGG - Intronic
953718634 3:45336484-45336506 CAGAACTCCACCTCATAAGCTGG - Intergenic
955654932 3:61235205-61235227 TAGAGCTCAAGCTCCCTAGCCGG + Intronic
958098134 3:88973847-88973869 CAAAGCTTCAAATCCCCAGCTGG + Intergenic
962728170 3:138254995-138255017 TACAGCTCCAGCTCCCAGGCAGG + Intronic
967963075 3:194940676-194940698 CTGAATTCCCACTCCCAAGCAGG - Intergenic
969781744 4:9409743-9409765 AAGATCTCCAAGTCCCCAGCCGG + Intergenic
975735027 4:77372685-77372707 CAGAGCTACAACTCACAAGTGGG - Intronic
984117082 4:175695151-175695173 GAGAGCTCCAACTCTGAAGCAGG - Intronic
985745673 5:1645449-1645471 CAGACATCCAACTCGCCAGCAGG + Intergenic
986300430 5:6474421-6474443 CAGGGCTCCAACTCCAGTGCCGG + Intronic
992182577 5:74212607-74212629 CAGAGCTCCACCACCGAAGGTGG - Intergenic
994949211 5:106435341-106435363 AAGAGCTCCACCTACCAACCTGG - Intergenic
997295978 5:132768656-132768678 CACAGCTCCAACTCCCAGGGTGG + Intronic
999709231 5:154301800-154301822 CAGAGGTCCATCTGCCAGGCTGG - Intronic
1000142851 5:158423270-158423292 CGGAGCTTCAACTCGCAGGCTGG + Intergenic
1000230346 5:159310141-159310163 CAGTGCTCCATCGCCCAGGCTGG - Intergenic
1002393103 5:178931259-178931281 CAAAGAGCCAACTCCGAAGCCGG + Exonic
1002395658 5:178951341-178951363 CAGCGCTCCAGTACCCAAGCTGG - Intronic
1005599723 6:27413946-27413968 CAAATCTCCAGCTCCCCAGCAGG - Intergenic
1006911375 6:37565836-37565858 CTCAGCTCCATCTCCCAGGCAGG - Intergenic
1008571152 6:52818045-52818067 CTATGCTCCACCTCCCAAGCAGG - Intergenic
1010135140 6:72542928-72542950 CAGGGCACCAATTCCCCAGCAGG + Intergenic
1013176133 6:107678531-107678553 AAGAGCTCCAATGCCCAAACTGG - Intergenic
1013294482 6:108746608-108746630 CACAGCTTCACCTCCAAAGCTGG + Intergenic
1013514586 6:110874562-110874584 CACAGCACCAACTCCCACTCAGG + Intronic
1014509896 6:122308040-122308062 GAGAGCTCCAACCCTAAAGCAGG - Intergenic
1015683406 6:135833207-135833229 GAGACTGCCAACTCCCAAGCAGG - Intergenic
1017973702 6:159335931-159335953 CTGGGCTCCAACGCCCATGCTGG - Intergenic
1019008536 6:168823837-168823859 CAAAGCTCCAAATCCTATGCTGG - Intergenic
1019330314 7:457733-457755 CAGACCTCCCACTCCAACGCTGG + Intergenic
1021327476 7:19292355-19292377 TATAGCTCCAACCCCCAAGGAGG - Intergenic
1022135089 7:27439623-27439645 AAGAGCTCAAACTTCCAAGAGGG + Intergenic
1023870276 7:44259498-44259520 CTGAGCTCCAATTCCAGAGCTGG + Intronic
1024568498 7:50704798-50704820 CACAGCTCCCTCTGCCAAGCGGG + Intronic
1026990112 7:74580242-74580264 CAGAGCCCCAACTCCCTGCCAGG - Intronic
1028045046 7:86107612-86107634 CAGGGCACCAAGTCCCAGGCTGG - Intergenic
1028439969 7:90848482-90848504 CAGAGAGCCAACAGCCAAGCTGG - Intronic
1034411163 7:150942913-150942935 CAGACCTCCACCGCCCAGGCAGG + Intergenic
1048512198 8:135072872-135072894 GAGAGCACCAACTCCCAGTCTGG - Intergenic
1048865085 8:138754885-138754907 CAGAGCCCCCAGTCCCCAGCGGG - Intronic
1049748295 8:144272225-144272247 CAGAGCTACAACTTCCAGGTGGG + Intronic
1050724785 9:8636423-8636445 CAGAGCTCCATCTTGCAACCTGG + Intronic
1056902632 9:90613835-90613857 GAGAGCTCCAACTCTCAGCCAGG + Exonic
1058776703 9:108291306-108291328 AAGTCCTCCAACTCCCAAGGGGG - Intergenic
1060373062 9:123092878-123092900 CAGAGCTCACCCTCCTAAGCAGG + Intronic
1061386129 9:130290270-130290292 CAGCCCCCCAACTCCCAAGTGGG + Intronic
1061552353 9:131344879-131344901 CAGAGCTCCAACTCCATGCCGGG + Intergenic
1061886318 9:133592748-133592770 CAGAGTTCCAAGTCCCACCCAGG + Intergenic
1062490061 9:136800579-136800601 CAGAGCTCCCTCTCCCTGGCGGG - Exonic
1187467036 X:19537000-19537022 CAGAGCTCTAACGCCCTGGCAGG + Intronic
1192170205 X:68849723-68849745 CAGAGATCCAATTCTGAAGCAGG + Intergenic
1193747890 X:85304959-85304981 CATAGCTGCAACTCCAAAACAGG + Intronic
1194987765 X:100509343-100509365 CAGAGCTCTATCTCAAAAGCTGG + Intergenic
1195992040 X:110692320-110692342 CCCACCCCCAACTCCCAAGCTGG - Intronic
1196177339 X:112653668-112653690 CTCATCTCCAACTCCCAGGCAGG - Intronic
1197172032 X:123444958-123444980 GAGAGTTCCAATTCTCAAGCAGG + Intronic
1199035905 X:143050735-143050757 GGGAGCTCCATCCCCCAAGCAGG - Intergenic
1199657127 X:150007143-150007165 CAGAGCTTCAGCTCCATAGCAGG + Intergenic