ID: 1084706819

View in Genome Browser
Species Human (GRCh38)
Location 11:70820534-70820556
Sequence CGAGGTGGCCGTGGAGCAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 272}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084706810_1084706819 29 Left 1084706810 11:70820482-70820504 CCTCGGGCTTGCTGGGCATCTGC 0: 1
1: 0
2: 3
3: 27
4: 162
Right 1084706819 11:70820534-70820556 CGAGGTGGCCGTGGAGCAGACGG 0: 1
1: 0
2: 2
3: 11
4: 272
1084706809_1084706819 30 Left 1084706809 11:70820481-70820503 CCCTCGGGCTTGCTGGGCATCTG 0: 1
1: 0
2: 0
3: 8
4: 143
Right 1084706819 11:70820534-70820556 CGAGGTGGCCGTGGAGCAGACGG 0: 1
1: 0
2: 2
3: 11
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084706819 Original CRISPR CGAGGTGGCCGTGGAGCAGA CGG Intronic
900002905 1:24787-24809 AGAGGAGGCCGTCCAGCAGATGG - Intergenic
900022625 1:195312-195334 AGAGGAGGCCGTCCAGCAGATGG - Intergenic
900106913 1:985994-986016 CGAGGTGGCCGGGGTACAGCTGG - Intergenic
900215098 1:1477371-1477393 CGAGGAGGCCGGGGCGCACATGG + Intronic
900475361 1:2873884-2873906 AGGGGTAGCCGTGGGGCAGAAGG + Intergenic
900489919 1:2942735-2942757 CGAGTTGACCATGGAGCAGTGGG + Intergenic
900895870 1:5482490-5482512 CGAGGTGGCGGTGGAGCACATGG - Intergenic
901409761 1:9074161-9074183 TGAGGTGGTGGTGGAGCGGAGGG + Intronic
902201479 1:14836666-14836688 GGAGGTGGCTGGGGAGCAGGAGG - Intronic
902594901 1:17502667-17502689 CGAGGAGGCCTTGGATCACATGG - Intergenic
903101787 1:21036064-21036086 AGAGGAGGCCCTGGAGCAGGTGG - Intronic
904293068 1:29500066-29500088 TGAGGTGGCCATGGAGAACAGGG + Intergenic
904532302 1:31177128-31177150 CGGGGTGGCCGCCGGGCAGAGGG - Intergenic
904760924 1:32804267-32804289 CGGGGTGGCCGCCGGGCAGAGGG + Intronic
906152394 1:43595163-43595185 AGAGAGGGCCGTGGAGCTGAGGG + Intronic
906356902 1:45115172-45115194 CGGGGTGGCCGCCGGGCAGAGGG + Intronic
908208701 1:61878020-61878042 GGAGGAGGCAGTGGGGCAGAGGG + Intronic
911038168 1:93571729-93571751 CCAGGTGGCGGTGGAACTGAAGG - Exonic
911104271 1:94117749-94117771 CGTGGAGACCGTGGAGTAGAAGG - Intronic
912679667 1:111721113-111721135 GGAGGTGGCGGTGAGGCAGACGG + Intronic
914353097 1:146857212-146857234 CCAGCTGGCAGTGGAGCTGATGG - Intergenic
914374667 1:147062236-147062258 TGGGGTGGCGGTGGGGCAGAGGG - Intergenic
915018805 1:152760789-152760811 AGACGTGGACGTGGAGCAGGAGG - Exonic
915313279 1:155015222-155015244 CGAGGTGGCGGTGGCGGAGGTGG - Exonic
916037437 1:160933620-160933642 CGGGGTGGCGGCGGGGCAGAGGG - Intergenic
918282827 1:183023159-183023181 CGAGGTGGGCGGGGAGCCGGGGG - Intergenic
919838890 1:201594993-201595015 CGAGGAGGCCGTTGAGGGGAGGG + Intergenic
920065483 1:203266657-203266679 CGGGGTGGCAGCTGAGCAGAGGG + Intronic
920260471 1:204685060-204685082 GGAGGCGGCCGAGGGGCAGAGGG - Intronic
920681248 1:208074441-208074463 CGAGCTGGCTGAGGAGCAGAAGG + Intronic
922572409 1:226641945-226641967 CAGGGTGGCCGTGGAGCTGATGG + Exonic
922776998 1:228219406-228219428 TGAGGTGGCCCAGGACCAGATGG + Exonic
922777752 1:228224541-228224563 CGAGGTGGCCCAGGCCCAGACGG + Exonic
922779849 1:228243265-228243287 CGAGGTGGCCCAGGCCCAGACGG + Exonic
924562296 1:245166851-245166873 GGAGGTGACCGTGGAGGAGAGGG + Intronic
924732475 1:246724497-246724519 GGAGGTGGCCCGGGAGCAGGTGG + Exonic
1063822832 10:9856772-9856794 CAGGGTGGCCTTGGAGTAGAAGG - Intergenic
1063958692 10:11288243-11288265 AGAGGTGGCCTTGGAGGAGAGGG + Intronic
1067216414 10:44307963-44307985 GCAGGTGGCCGTGGCCCAGAGGG + Intergenic
1067509161 10:46881168-46881190 GGAGGTGGGCGTGGGGCTGAAGG + Intergenic
1067836406 10:49644301-49644323 GGAGGTGGCCATGGAGCCCACGG + Intronic
1069957879 10:72062801-72062823 CGAGGAGGCCGAGGAGGAGGAGG - Exonic
1071271459 10:84011277-84011299 GGAGATGGACCTGGAGCAGAGGG + Intergenic
1071489964 10:86129586-86129608 AGAGGGGGATGTGGAGCAGAGGG - Intronic
1071570140 10:86692255-86692277 GGAGTTGGCATTGGAGCAGAAGG - Intronic
1072336493 10:94402835-94402857 CGCGGCGGCCGGGGAGCAGCTGG + Exonic
1073403513 10:103277366-103277388 CGACGAGGCCGAGGAGCAGGCGG - Exonic
1075760047 10:124848791-124848813 AGAGGTGGCGGTGGATCGGAAGG - Intergenic
1077087324 11:760418-760440 GGAGCTGGCTCTGGAGCAGAGGG - Intronic
1077104540 11:836463-836485 CGGGGTGGGGGTGGTGCAGATGG + Intronic
1077228824 11:1449720-1449742 CCAGGGGGCAGTGGAGCAGCAGG - Intronic
1077887229 11:6395163-6395185 AGAGGTGCCCATGGAGCAGGGGG + Exonic
1078391454 11:10938712-10938734 AGAGGTAGCGGTGGAGGAGATGG - Intergenic
1078748035 11:14133955-14133977 TGATGTGGCCCTGGAGCAGAGGG + Intronic
1084706819 11:70820534-70820556 CGAGGTGGCCGTGGAGCAGACGG + Intronic
1085328611 11:75628097-75628119 CTAGCTGGTCTTGGAGCAGAGGG + Intronic
1085509805 11:77082512-77082534 GGAGGTGACCTTGGGGCAGATGG + Intronic
1088429586 11:109744519-109744541 CGAGATGGCCGCTGATCAGAAGG - Intergenic
1089790135 11:120936867-120936889 CCAGGAGGCAGAGGAGCAGAAGG + Intronic
1091376323 12:26850-26872 AGAGGAGGCCGTCCAGCAGATGG - Intergenic
1091987579 12:4924796-4924818 TGAGCTGTCCGGGGAGCAGATGG - Intronic
1092087020 12:5770927-5770949 GGAGGTGACATTGGAGCAGATGG - Intronic
1092137482 12:6159804-6159826 CTAGGTGCCAGTGGAGCAGCGGG - Intergenic
1096644053 12:53018866-53018888 CGAGCAGCCCGTGGAGCAGTGGG - Exonic
1096999322 12:55863115-55863137 CGGGGTGGCGGTTGGGCAGAGGG + Intergenic
1097275644 12:57811637-57811659 GAAGGTAGCCCTGGAGCAGAGGG + Intronic
1099103346 12:78470644-78470666 GGATGTGGCCCTGCAGCAGATGG + Intergenic
1100985608 12:100199621-100199643 CCAGGTGGCCGAGGGGCAGCGGG + Intronic
1101900510 12:108788363-108788385 GGAGGTGGGGGTGTAGCAGATGG + Exonic
1102180857 12:110911328-110911350 CGAGGGGGCCCTGCAGCAGCTGG - Intronic
1102301956 12:111777648-111777670 CGGGGTGCCCGTGGAGGAGAAGG - Intronic
1102389708 12:112539717-112539739 CGAGGTGGCTCTGCAGCTGAAGG - Intergenic
1104663184 12:130627164-130627186 CGTGGTGGTGGTGGAGGAGATGG - Intronic
1105745725 13:23375525-23375547 CGCGGCGGCCGAGGAGCAGGCGG + Intronic
1111388639 13:87561889-87561911 CGGGGTGGCGGCGGGGCAGAGGG - Intergenic
1113329199 13:109311850-109311872 CGGGGTGGCGGTAGGGCAGAGGG - Intergenic
1118849194 14:69571792-69571814 CGAGGAAGCAGTGCAGCAGAAGG - Exonic
1119775075 14:77243180-77243202 GGAGGTGGCCATGGTGCAAATGG + Intronic
1121075033 14:91060654-91060676 GGAGGCGGCGGTGGAGCAGGGGG - Intronic
1121557341 14:94848390-94848412 ATAGGTGGGCTTGGAGCAGAGGG + Intergenic
1121633679 14:95439526-95439548 TCAGGTGCTCGTGGAGCAGAGGG - Intronic
1121956012 14:98214063-98214085 TGGAGTGGCTGTGGAGCAGAAGG - Intergenic
1122972592 14:105158463-105158485 CCAGGTGGCCCGGGGGCAGAGGG - Intronic
1124567990 15:30833952-30833974 CCAGGTGGCCAGGCAGCAGAAGG - Intergenic
1124813906 15:32968963-32968985 AGAGGTGGCGGTGGAGGAGGCGG + Exonic
1124974953 15:34522719-34522741 AGAGGTGGCCCTGGACCAGTTGG + Intergenic
1125797076 15:42410842-42410864 AGAGGTGGACGTGGAGCTGGAGG - Intronic
1125891217 15:43268614-43268636 CGAGGCAGCCGTGGGACAGAAGG - Intergenic
1126429072 15:48561256-48561278 CTAGGTGTCCCTGTAGCAGAAGG - Intronic
1126761158 15:51971468-51971490 CTGGGTGTCGGTGGAGCAGACGG - Intronic
1127207150 15:56733167-56733189 GGAGGTGGCGGAGGAGCAGAAGG + Intronic
1127968939 15:63944185-63944207 GAAGGTGGCCGTGGGGCAGTAGG + Intronic
1129062439 15:72871032-72871054 CGAGGTGTCCTTTGAGCTGAAGG - Intergenic
1129161563 15:73750977-73750999 GGAGGTGGCCAAGGAGCTGAGGG - Exonic
1129538946 15:76335962-76335984 GGAGGTGGTGGTGGAGGAGAGGG + Intergenic
1131035141 15:89217204-89217226 GGCGGTGGCCGTGGCGGAGAGGG - Exonic
1132152639 15:99473501-99473523 TGGGGTGGCCTTGGGGCAGATGG + Intergenic
1132450605 15:101966152-101966174 AGAGGAGGCCGTCCAGCAGATGG + Intergenic
1133009161 16:2900757-2900779 AGGGGTGGCTGTGGAGCAGCAGG + Intergenic
1133126853 16:3652746-3652768 CCAGCTGGCCATGAAGCAGAAGG - Intronic
1133314544 16:4874577-4874599 CTAGCTGGTGGTGGAGCAGAAGG - Exonic
1135047582 16:19168107-19168129 CGGGGCAGCCGTGGAGCCGAGGG - Intronic
1135424576 16:22325930-22325952 CGAGGAGGACGAGGAGCAGGAGG + Exonic
1136136376 16:28259089-28259111 CGAGGTGGCTGGTGGGCAGACGG - Intergenic
1136447925 16:30335319-30335341 CGAGGAGGACGAGGAGCAGGCGG + Intergenic
1137438978 16:48482964-48482986 CGGGGTGGCCGCCGGGCAGAGGG + Intergenic
1137596226 16:49725842-49725864 AGAGGTGGCTCTGAAGCAGATGG - Intronic
1137898392 16:52238274-52238296 GGAGGAGGCCATGGAGCAGTGGG + Intergenic
1138457359 16:57129065-57129087 AGAGGTGGCAGTGGGGCAGGGGG + Intronic
1138573137 16:57888864-57888886 GGAGGTGACAGTGAAGCAGAAGG - Intronic
1139504594 16:67392656-67392678 GGAGGTGGCAGTGGAGGAGGGGG - Intronic
1139593541 16:67945950-67945972 CGAGGTGGAGGTGGTGGAGATGG - Exonic
1139980928 16:70858306-70858328 CCAGCTGGCAGTGGAGCTGATGG + Intronic
1140602929 16:76500086-76500108 CGGGGTGGCGGCGGGGCAGAGGG + Intronic
1142114115 16:88347624-88347646 CGGGGTGGATGTGGGGCAGATGG - Intergenic
1142484263 17:236548-236570 CGGGGTGGGGGTGGGGCAGATGG + Intronic
1143918050 17:10309305-10309327 GAAGGTGGCCCTGGAACAGACGG - Exonic
1144004603 17:11088766-11088788 CGAGGGGGCCGGGGGGCAGCGGG - Intergenic
1144811064 17:17999233-17999255 CGAGGTGGCCTTTGAGGAGCTGG - Intronic
1145060650 17:19731232-19731254 AGAGGTGGCCAAGGAGTAGAGGG + Intergenic
1147044833 17:37744563-37744585 CGAGGAGGCGGCGGAGCAGCGGG - Exonic
1148441904 17:47715819-47715841 CGAGGTGGAGGCAGAGCAGAAGG + Intergenic
1148564448 17:48625052-48625074 CGAGGACGCCGAGGAGGAGAGGG + Intronic
1151477788 17:74353591-74353613 TGAGGTGGCCGGGCAGCAGAGGG - Intronic
1151714230 17:75823333-75823355 CGAGCTGGCCCGGGAGCAGCGGG + Exonic
1151745561 17:76009985-76010007 GGAGGTGGACGTGAAGGAGAAGG - Exonic
1152267882 17:79306787-79306809 CCAGGTGCCCGTGGAGCTGGGGG - Intronic
1152269727 17:79317116-79317138 GGGGGTGGCCGTGGGGGAGATGG - Intronic
1152352172 17:79790138-79790160 GGAGGTGGCCGGGGTGCAGGTGG - Intergenic
1152630468 17:81408615-81408637 AGAGGTGGGCATGGAGCAGTCGG - Intronic
1152755750 17:82086328-82086350 CCAGGAGGCCGCTGAGCAGAGGG + Exonic
1154354057 18:13611389-13611411 CGGGGTGGCCGTGGTGGAAAGGG - Intronic
1154955470 18:21250131-21250153 CTAGGAGGCCTGGGAGCAGATGG + Intronic
1155654434 18:28177451-28177473 GGAGGTGGAAGTGGAGCGGATGG + Intergenic
1156373921 18:36495364-36495386 GGAGGTTGCAGGGGAGCAGATGG - Intronic
1157444833 18:47736884-47736906 TGAAGAGGTCGTGGAGCAGAGGG - Intergenic
1160327479 18:77964478-77964500 AGAGGTGGCAGTGTAGCTGAAGG + Intergenic
1160634656 19:66395-66417 AGAGGAGGCCGTCCAGCAGATGG - Intergenic
1160861200 19:1237834-1237856 CCCGGTGGCCGCGGAGCAGGCGG + Exonic
1160927894 19:1555830-1555852 CGAGGTGGCCGTGGAGAAGGCGG + Exonic
1161070913 19:2260405-2260427 CGAGTTGGACGTGGAGAAGTTGG - Intronic
1161204558 19:3034257-3034279 GGAGGTGGCTGTGGTCCAGATGG - Intronic
1161766979 19:6213559-6213581 CGGTGTGGCCTTGGAGCTGAGGG - Intronic
1161796051 19:6387393-6387415 CGAGGAGGCCGAGGAGGAGTGGG - Exonic
1161967511 19:7556616-7556638 CGAGGTGGGGGAGGAGCAGGGGG - Intronic
1162111560 19:8402562-8402584 ACAGGTGGCCGGGGACCAGATGG + Exonic
1163444709 19:17339555-17339577 CGTGGGGCCCGTGGAGCAGGAGG + Exonic
1164526126 19:29014893-29014915 TGAGGTGCCCGTGGAGTTGAGGG - Intergenic
1166063688 19:40343683-40343705 GTAGATGGCAGTGGAGCAGAAGG - Intronic
1167292739 19:48633443-48633465 CCAGGTGCCGGAGGAGCAGAAGG - Exonic
926629407 2:15123096-15123118 CGAGGTAGCCTGGGAGCAGCAGG + Intergenic
927813562 2:26194352-26194374 TGAGGAGGCTGTGGGGCAGAGGG + Intronic
928371217 2:30741564-30741586 GGAGGTGGCCGAGTAGGAGAAGG + Intronic
929983186 2:46699480-46699502 CGCGGGGGCCGGGGAGCAGGCGG - Intronic
930330151 2:49972910-49972932 ATAGGTGGGGGTGGAGCAGATGG - Intronic
932054714 2:68432664-68432686 AGAGGAGGCCCTGGAGTAGATGG + Intergenic
933142566 2:78812392-78812414 CGAGGTGACCCTGGAGGAGCTGG - Intergenic
934522198 2:95026484-95026506 CGGGGTGGGGGTGGAGGAGATGG + Intronic
934562588 2:95320873-95320895 CGAGGGGGGCGGGGAGGAGAGGG - Intronic
934721512 2:96580561-96580583 AGAGGTTGTCCTGGAGCAGAAGG + Intergenic
935668829 2:105538029-105538051 CCAGGTAGCCCTGCAGCAGAGGG - Intergenic
936022103 2:109002625-109002647 GAGGGTGGCCGGGGAGCAGAGGG - Intergenic
936566822 2:113588632-113588654 AGAGGAGGCCGTCCAGCAGATGG + Intergenic
943524300 2:188997189-188997211 CGAGGTGGCCCTGGAGGACCTGG + Exonic
943909321 2:193542701-193542723 TGAGGTTGCTGTGGAGCATAGGG - Intergenic
945917346 2:215717881-215717903 GGAGGTGGCTGGGGAGGAGAGGG + Intergenic
946044519 2:216810347-216810369 GGAGGTGGCTGTGGGGGAGACGG + Intergenic
946410500 2:219513046-219513068 CGGGGTGGCCGTTGGGCAGCGGG + Intergenic
947702059 2:232242773-232242795 AGAGCTGGCCGTGGAGAAAAGGG - Intronic
948784728 2:240346420-240346442 GGAGGTGGCGGTGAAGAAGAGGG - Intergenic
1168947164 20:1770730-1770752 GGTGGTGCCCGTGGAGAAGAGGG + Intergenic
1170629744 20:18056845-18056867 CGGGGGGGTCGTGGAGCAGGCGG + Exonic
1170766094 20:19291136-19291158 CGAGGTGCCCCTGGGGCTGAGGG + Intronic
1170829185 20:19824938-19824960 CGAGCAGGCCTTGGAGAAGAGGG - Intergenic
1171180232 20:23086070-23086092 CGAGTGGGCCGTGTAGCAGGCGG + Exonic
1171405348 20:24909208-24909230 GGAGGAGGCCGTGGAGAAAATGG - Intergenic
1172033735 20:31997902-31997924 GGAGGTGGCCGTGGAAGGGATGG + Exonic
1174246877 20:49188229-49188251 CGGAGTGGCCGTGGAGGAGGCGG + Exonic
1175532594 20:59684412-59684434 GGAGGTGGCCTTGGTGCTGAGGG + Intronic
1175722897 20:61298053-61298075 CGAGGTGGCCTTTGTGCAGGCGG + Intronic
1177788237 21:25695504-25695526 CGGGGCGGCCGCGGGGCAGAGGG + Intronic
1178720895 21:35007990-35008012 GGTGGTGGCCGTGGGGTAGATGG - Intronic
1179728624 21:43354640-43354662 CGAGGTGCCAGAAGAGCAGAAGG - Intergenic
1179990993 21:44948186-44948208 GGAGGTGGTCGTGGAGCATCGGG + Intronic
1181044703 22:20209084-20209106 CCAGTTGGCCGCAGAGCAGAAGG - Intergenic
1181417615 22:22771844-22771866 CGAGGAGGCTGAGGAGGAGAGGG - Intronic
1183185455 22:36289165-36289187 GGAGGAAGCCATGGAGCAGAAGG - Exonic
1183322318 22:37172543-37172565 CGAGGGGTCCCTGGAGAAGAGGG + Intronic
1183545572 22:38453497-38453519 GGAGGTGGGCGTGGGGCAGTGGG - Intronic
952892679 3:38053661-38053683 CGGGGTGGCCGCTGGGCAGAGGG - Intronic
953489828 3:43340150-43340172 AGTGGTGGCAGTGGGGCAGATGG - Intronic
960851449 3:122059091-122059113 TGAGGTGCCTGTGGAGCAGCTGG + Intronic
960902145 3:122564171-122564193 CGAGGTGGGCGGGGAGAAGGGGG - Intronic
961376325 3:126468593-126468615 GGAGTTGGCCGTGGAGGATAGGG - Intronic
961550298 3:127667079-127667101 GGAGATGGCCATAGAGCAGATGG - Intronic
961936913 3:130594305-130594327 CCTGGTGACCGTGGAGCAAAGGG + Exonic
963788118 3:149556060-149556082 CCATGTGGCTGAGGAGCAGAGGG + Intronic
965551263 3:169967061-169967083 GGAGGTGGTGGTGGAGCAGCAGG + Intronic
968652509 4:1765871-1765893 GGAGGAGGGCGTGGAGCACAGGG + Intergenic
971349384 4:25842948-25842970 GGAGATGGCATTGGAGCAGAGGG + Intronic
973037152 4:45420481-45420503 CTGGGTGCCCGTGGAGCAGGGGG - Intergenic
974626244 4:64431565-64431587 CCAGAAGGCAGTGGAGCAGATGG + Intergenic
978995018 4:115139968-115139990 CGAGGTGGCAGATGAACAGAGGG - Intergenic
979941824 4:126771472-126771494 CGAGGTGGCGGCCGGGCAGAGGG - Intergenic
982437919 4:155399285-155399307 CCAGGTGGGAGTGGAGGAGATGG - Intergenic
984638604 4:182140876-182140898 CGGGGAGGCGGTGGAGCAGCAGG + Intergenic
985551296 5:534838-534860 CGGGGTGGACGCGGAGCTGAGGG + Intergenic
985641111 5:1063843-1063865 CGAGGTGGAGGTGGTGGAGATGG - Exonic
986249347 5:6042584-6042606 AGAGGTGGCAGGGCAGCAGAAGG - Intergenic
986353632 5:6903478-6903500 CAAGCTGGCTGTGGAGCAGATGG + Intergenic
990409202 5:55523790-55523812 TGAGTTGGCCGTGGAGGAGCTGG - Intronic
990434927 5:55780029-55780051 CGAGGTTGCCGTGGAGGATTTGG + Exonic
992552775 5:77874892-77874914 AGAGGTGGTGGTGGAGCAGGTGG + Intergenic
993677261 5:90831711-90831733 GGTGGTGGCGGTGGGGCAGAGGG - Intronic
998053615 5:139056383-139056405 CGGGGTGGTTGTGGGGCAGAGGG - Intronic
999498798 5:152126044-152126066 GGGGGTGGGAGTGGAGCAGAGGG - Intergenic
1001400278 5:171442315-171442337 AGAGGTGGCAATGGAGGAGAAGG - Intronic
1001415677 5:171543500-171543522 TGCGGTGACCGAGGAGCAGAAGG - Intergenic
1001702042 5:173713765-173713787 CAAGGTTGCTGGGGAGCAGAGGG - Intergenic
1006831129 6:36968965-36968987 AGAGCTGGCCCTGGACCAGAAGG + Exonic
1008564057 6:52749995-52750017 CAAGGTGGCCTGAGAGCAGAGGG + Intergenic
1017418931 6:154252298-154252320 GAAGGTTGTCGTGGAGCAGAGGG + Intronic
1017429227 6:154354434-154354456 GGAGGTGGTGGTGGAGGAGATGG - Intronic
1017429234 6:154354458-154354480 GGAGGTGGTTGTGGAGGAGATGG - Intronic
1018939493 6:168299752-168299774 CGCGGTGGCCCCGGAGCACATGG - Intronic
1019421697 7:953965-953987 CGAGGTGGCCCCGGAGCCGGCGG + Intronic
1019717013 7:2543757-2543779 GGGGGTGGCCGCGGAGCACAAGG + Exonic
1022271179 7:28809451-28809473 GGAAATGCCCGTGGAGCAGAGGG - Intronic
1022484930 7:30771055-30771077 AGAGGGGGCCGTGGTGCTGAGGG + Intronic
1023897352 7:44445058-44445080 ACAGGTGGAGGTGGAGCAGAGGG - Intronic
1023899552 7:44464979-44465001 GGAAGTGGCAGGGGAGCAGAAGG + Intronic
1024109479 7:46130808-46130830 TGTGGTGGCCGCGGAGAAGAGGG - Intergenic
1024569646 7:50713391-50713413 GGAGGTGGCGGTGGAGGAGGTGG - Intronic
1024818423 7:53298037-53298059 GGAGGAGGCCGTGGGGCAGCGGG - Intergenic
1026735315 7:72945329-72945351 CGAGGTGGCTGCGGGGCAGGGGG + Intronic
1026785655 7:73300259-73300281 CGAGGTGGCTGCGGGGCAGGGGG + Intergenic
1027108411 7:75419677-75419699 CGAGGTGGCTGCGGGGCAGGGGG - Intronic
1029115131 7:98232823-98232845 CGAGCAGGCCGTGGAGCAGGTGG - Exonic
1029202970 7:98851383-98851405 CCATGTGGCACTGGAGCAGAAGG + Intronic
1029274002 7:99393486-99393508 CGAGGTGGGGGCGGAGCTGAGGG + Intronic
1029958765 7:104667968-104667990 CGAGCAGCCCGTGGAGCAGTGGG - Intronic
1030157935 7:106475728-106475750 CTAGGTGGCAGTGGTGGAGAAGG - Intergenic
1031558198 7:123204666-123204688 CGAGGTGGCTGTGCAGGGGAGGG - Intergenic
1031747761 7:125524995-125525017 CTGGTTGGCTGTGGAGCAGATGG - Intergenic
1032076527 7:128838664-128838686 GGAGGTGGCCCTGGAGGACAAGG + Exonic
1033099826 7:138460551-138460573 GGAGGTGGCGGTGGAGAAGGCGG + Exonic
1033146140 7:138871353-138871375 AGTGGTGGCCCTGGAACAGAAGG + Exonic
1033314027 7:140283175-140283197 AGAGGTGGCTGGGGAGCCGAGGG + Intergenic
1033986286 7:147229369-147229391 GGATGTGGCAGTTGAGCAGATGG + Intronic
1034419570 7:150982059-150982081 TGTGGTGGCAGTGGAGCAGCAGG + Intergenic
1034885796 7:154797982-154798004 CGTGGTGGACATGGAGCAGGAGG + Intronic
1035244298 7:157552147-157552169 CGTGGTGGCCGTGGGGTACACGG - Intronic
1035339275 7:158150075-158150097 GGAAGAGGCCGTGGGGCAGAAGG + Intronic
1035502749 8:102397-102419 CCAGGTGGGTGTGGATCAGAAGG - Intergenic
1035667502 8:1389737-1389759 TTAGGTGGCCGTGGAGCAGCTGG + Intergenic
1038534623 8:28344871-28344893 CGAGGTGGTGGTGGGGCAGGTGG - Intergenic
1039440242 8:37590062-37590084 CGGAGTGGATGTGGAGCAGAAGG - Intergenic
1047392622 8:124465819-124465841 GGAGGGGGCGGTGGAGCCGATGG - Intergenic
1049122846 8:140755417-140755439 CGGTGTGGCCGCGGAGTAGAGGG - Intronic
1049251300 8:141590639-141590661 TGAGGAGGGCGTGGAACAGATGG - Intergenic
1049412374 8:142478977-142478999 TGGGGTGGCCGTGGAGTAGCGGG + Intronic
1049451518 8:142664588-142664610 GGAGGTGGCCTGGGAGCAGGCGG - Exonic
1049463092 8:142739160-142739182 AGAGGTGGCGGTGGAGGGGAGGG - Intergenic
1049885710 9:24900-24922 AGAGGAGGCCGTCCAGCAGATGG - Intergenic
1050189877 9:3013597-3013619 GGAGGTGGAAGTGGGGCAGAAGG + Intergenic
1051893311 9:21965217-21965239 CACGGGGGCTGTGGAGCAGAAGG - Intronic
1052017170 9:23482529-23482551 TGAGATGGCCCTGGAGTAGAAGG - Intergenic
1052951933 9:34219983-34220005 GGAGGTGGGAGGGGAGCAGAGGG - Intronic
1056191994 9:84194159-84194181 AGAGGAGGCCCTGGAGAAGATGG + Intergenic
1057169825 9:92955042-92955064 TCAGGTGGCCAAGGAGCAGAGGG + Intronic
1057563331 9:96146226-96146248 CGAGCAGCCCGTGGAGCAGTGGG - Intergenic
1058885495 9:109319517-109319539 CGAGGAGGCTGCGGGGCAGATGG + Intronic
1060429140 9:123533847-123533869 CACAGTGGCCGTGGAGGAGAGGG - Intronic
1061315901 9:129795621-129795643 GGAGGTGGGCTTGGAGCTGAGGG + Intergenic
1061821277 9:133228313-133228335 GGAGGGGGCCGGGGTGCAGAAGG - Intergenic
1062512788 9:136916703-136916725 AGAGGTGGCTGAGGAGCAGCTGG - Intronic
1187212454 X:17244802-17244824 CGGGGTGGCCGCCGGGCAGAGGG + Intergenic
1190058949 X:47198762-47198784 AGAGGTGACCCTGGAGCACATGG - Intronic
1191894150 X:65975237-65975259 CGGGGTGGCGGCGGGGCAGAGGG + Intergenic
1191901527 X:66045753-66045775 AGAGGTGGGTTTGGAGCAGAGGG + Intergenic
1191904695 X:66076109-66076131 CGAGCAGCCCGTGGAGCAGTGGG + Intergenic
1193114847 X:77766384-77766406 CGGGGTGGCAGCGGGGCAGAGGG + Intronic
1195626152 X:107007102-107007124 GGGGGTGGTAGTGGAGCAGAGGG - Intergenic
1196080067 X:111621249-111621271 CGAGCAGCCCGTGGAGCAGTGGG + Intergenic
1196647049 X:118128991-118129013 GGAGGGGGCCGAGGAGGAGATGG + Intergenic
1201638791 Y:16156044-16156066 AGAGGTGGCAGAGAAGCAGAGGG - Intergenic