ID: 1084708103

View in Genome Browser
Species Human (GRCh38)
Location 11:70827570-70827592
Sequence CAGGGGCAAGGTTCTGTTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 205}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084708097_1084708103 -2 Left 1084708097 11:70827549-70827571 CCTGAAGCTACGTGGAGCATCCA 0: 1
1: 0
2: 1
3: 3
4: 79
Right 1084708103 11:70827570-70827592 CAGGGGCAAGGTTCTGTTGCCGG 0: 1
1: 0
2: 2
3: 10
4: 205
1084708095_1084708103 14 Left 1084708095 11:70827533-70827555 CCAGGAGAAGGAGCTTCCTGAAG 0: 1
1: 0
2: 3
3: 35
4: 407
Right 1084708103 11:70827570-70827592 CAGGGGCAAGGTTCTGTTGCCGG 0: 1
1: 0
2: 2
3: 10
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084708103 Original CRISPR CAGGGGCAAGGTTCTGTTGC CGG Intronic
900440927 1:2654834-2654856 CGGGTGCAGGGTTCTGTTCCAGG - Intronic
901278623 1:8013536-8013558 CAGGGGCAAAGCTCTGTGTCGGG + Exonic
901691267 1:10974720-10974742 CAGGGGCAAACTTCTGTTACGGG - Intronic
902714215 1:18261335-18261357 CAGAGGCAGGGTTCGGATGCTGG + Intronic
907048917 1:51316669-51316691 GAGGGGCCAGGTGGTGTTGCAGG - Intronic
907242381 1:53087954-53087976 CAGGGGCAGGGTCCTGAGGCAGG - Exonic
907418976 1:54333785-54333807 CAGGTGCAAGGCTCTGTGCCTGG - Intronic
907519134 1:55011864-55011886 GAGGGGCAAGGTGCTGGTGAAGG + Intergenic
908263325 1:62355376-62355398 CTGGGGCCAGGTGATGTTGCAGG + Intergenic
910513910 1:88036924-88036946 CAGGGGCAGGGTTGTTGTGCTGG - Intergenic
911129910 1:94377240-94377262 CAGGGTCCAGGGACTGTTGCGGG - Intergenic
912191235 1:107343366-107343388 CACGGCCAAGGTTCTGTTTTGGG - Intronic
913360200 1:117972028-117972050 AAGGTGCAAGATTCTGTTGGAGG - Exonic
915855042 1:159374325-159374347 CAGGTGCAAGGTTGTCTTCCAGG - Intergenic
915914951 1:159935307-159935329 TAGGAGCCAGGTGCTGTTGCAGG - Intronic
916939384 1:169663589-169663611 CAGGGTCCAGGGACTGTTGCGGG + Intronic
916939396 1:169663669-169663691 CAGGGTCCAGGGACTGTTGCAGG + Intronic
917090192 1:171345267-171345289 CTAGTGAAAGGTTCTGTTGCGGG - Intergenic
920505414 1:206512211-206512233 CTTGGGCAAGGTCCTGTTGGAGG + Intronic
921251264 1:213300641-213300663 CAGGGGCCAGGTCGTCTTGCTGG + Intergenic
922053764 1:222020735-222020757 CAGGGGCAAAGTCCTGTTAGTGG + Intergenic
922175720 1:223195556-223195578 CAGGTGCAAGGACCTGCTGCTGG + Intergenic
922613122 1:226944445-226944467 CAGGGGCAAGGTCTTGTTGCGGG + Intronic
1064603690 10:17017186-17017208 CAGGGTCCAGGGACTGTTGCGGG - Intronic
1065082287 10:22140457-22140479 CAGGGTCCAGGGACTGTTGCAGG + Intergenic
1067065672 10:43102777-43102799 CAGGGGCCAGGTACTGTTCTAGG + Intronic
1067665110 10:48270957-48270979 CAGGGGCAAGGTATGGTTGTAGG - Intronic
1069137461 10:64783234-64783256 CAGGGTCCAGGGACTGTTGCAGG - Intergenic
1070712421 10:78692363-78692385 CAGGGCCCAGCTTCTGCTGCTGG + Intergenic
1071225568 10:83524595-83524617 CAGGGCCAGGGTTTTGTAGCAGG - Intergenic
1072194705 10:93107225-93107247 CAGGGACAAGCTGGTGTTGCTGG - Intergenic
1072371767 10:94771715-94771737 CAGGGTCCAGGGACTGTTGCAGG - Intronic
1072619012 10:97067708-97067730 CTGGGGCAAGGCTCTGGGGCAGG - Intronic
1074533181 10:114310786-114310808 CAGGGCTACTGTTCTGTTGCAGG + Intronic
1074941668 10:118241865-118241887 CAGGGGAAAGATTCTGTGGCAGG + Intergenic
1076090944 10:127684920-127684942 CAGAGGGAAGGATCTGTTCCAGG + Intergenic
1076271501 10:129156204-129156226 CTGGGGCAAGGTTCTCTGGGAGG + Intergenic
1077401477 11:2360228-2360250 CTGGGGCAAGGTGCTGCTCCAGG + Intergenic
1078018302 11:7634135-7634157 GAGGGGAAAGGTGCTGATGCTGG - Intronic
1079731358 11:23940010-23940032 CAGGGTCCAGGGACTGTTGCGGG - Intergenic
1084041471 11:66545505-66545527 TAGGTGCAAGGTTTTGTTACAGG - Intronic
1084210877 11:67621680-67621702 CAGGGTCCAGGGACTGTTGCGGG + Intergenic
1084708103 11:70827570-70827592 CAGGGGCAAGGTTCTGTTGCCGG + Intronic
1085408482 11:76277908-76277930 CAGGGGCTGGGCTCTGTGGCTGG + Intergenic
1085803566 11:79613636-79613658 CAGGAGGAAGTTTCTGTTACTGG + Intergenic
1087074891 11:94119835-94119857 CAGGGTCCAGGGACTGTTGCGGG + Intergenic
1087459116 11:98423426-98423448 CAGGGTCCAGGGACTGTTGCAGG - Intergenic
1088333462 11:108677008-108677030 GAGGGGCAAGGTTGAGATGCAGG + Intronic
1090385357 11:126355264-126355286 CTGGGGCAGGGTCCTGTTCCGGG - Intergenic
1091269933 11:134300937-134300959 CCCGGGCAAGTCTCTGTTGCAGG - Intronic
1091288229 11:134421049-134421071 CAAGGGCCAGATTCTGCTGCTGG - Intergenic
1091761990 12:3093540-3093562 CAGCCACAAGTTTCTGTTGCAGG + Intronic
1092705510 12:11279822-11279844 CAGGAGCAAGGTTGTGGTGAAGG + Intergenic
1094338230 12:29384186-29384208 CAGGGTCCAGGGACTGTTGCGGG - Intergenic
1096537676 12:52285984-52286006 CGTGGGCAAGGTTCTGGTCCTGG + Exonic
1099479438 12:83147803-83147825 CTGGGGCAAGGTTCTCCTGAAGG - Intergenic
1099986323 12:89669241-89669263 TGTGGGCAAGGTACTGTTGCTGG - Intronic
1101704767 12:107211498-107211520 CAGGGTCCAGGGACTGTTGCGGG + Intergenic
1101713004 12:107286176-107286198 CAGAGGCTGGGTTCTGTAGCTGG - Intergenic
1101915576 12:108893146-108893168 CTGGGGCAAGGGTCTGAGGCAGG - Intronic
1102220264 12:111189359-111189381 CAGGAGAATGGTTATGTTGCTGG - Intronic
1103285286 12:119796002-119796024 CAGGGGCAAGGCACTGTTTCAGG + Intronic
1106795236 13:33198369-33198391 TAGGGCCAAGGCTCTGATGCTGG - Intronic
1107336815 13:39364159-39364181 AAGGGGCAGGGTTATGTGGCAGG + Intronic
1109392523 13:61710688-61710710 CTGAGGCAAGGTTCTCTTGGAGG + Intergenic
1109500928 13:63235523-63235545 CAGGGTCCAGGGACTGTTGCAGG + Intergenic
1111372427 13:87335169-87335191 CAGGGTCCAGGGACTGTTGCAGG + Intergenic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1111976759 13:94974406-94974428 CAGGGGCATGTTACTGTTGTGGG - Intergenic
1112519004 13:100079923-100079945 CAGGGTCCAGGGACTGTTGCGGG + Intergenic
1118178280 14:63464449-63464471 CAAGTGCAAGGTACTGTGGCAGG + Intronic
1118865230 14:69697913-69697935 TGGGGGCATGGTTCTGTTACCGG + Intronic
1119400111 14:74357479-74357501 CAGGGGCAAAGTACTGGTGGCGG - Exonic
1120664413 14:87289310-87289332 AAGTGGCAAGGGTCTGTTACGGG - Intergenic
1120744045 14:88137782-88137804 CAGCTGCAAGGATCTGTGGCTGG + Intergenic
1121593459 14:95138160-95138182 CAGTGTCCAGGTTCTGTTCCTGG + Intronic
1122340044 14:101022017-101022039 CAGGGGCAAGGCCCTGGTTCTGG + Intergenic
1123501157 15:20882363-20882385 CAGGGCCAGGGTTCTGAAGCTGG + Intergenic
1123558409 15:21456068-21456090 CAGGGCCAGGGTTCTGAAGCTGG + Intergenic
1123594640 15:21893343-21893365 CAGGGCCAGGGTTCTGAAGCTGG + Intergenic
1124046835 15:26158285-26158307 CAGGAGCAGGGTTCTGATGCAGG + Intergenic
1124647484 15:31449129-31449151 CTGGGGCAAGGTTCTCCAGCAGG - Intergenic
1125274773 15:37978691-37978713 CAGAGGCAAGGTTGTTGTGCTGG + Intergenic
1126532877 15:49730973-49730995 CAGGGGCATTTTTCTGTTCCTGG - Intergenic
1129100257 15:73255479-73255501 CAAGGGGAAGGTTCTTTTGCAGG + Intronic
1129931195 15:79412400-79412422 CAGGGGCAAGGCACTGGTGAAGG - Intronic
1130557917 15:84935797-84935819 AAGAGGCAAGGTACTGTGGCTGG - Intronic
1202966759 15_KI270727v1_random:183218-183240 CAGGGCCAGGGTTCTGAAGCTGG + Intergenic
1134271971 16:12740765-12740787 CAGGTGCAAGGCCCTGTGGCAGG + Intronic
1135413725 16:22253477-22253499 CAGGGCCAAGGTTTTGGGGCAGG - Intronic
1135937859 16:26796338-26796360 CAGGAGGAAGGTTCTGCAGCAGG + Intergenic
1138477827 16:57282619-57282641 CAGGGTCTAGGTTCTGTTGGTGG - Intronic
1139595226 16:67953973-67953995 CAGGTGCAGGGTCCTGCTGCAGG + Intronic
1140044654 16:71432432-71432454 CAGGGGCCAGGTTCTGCGGTTGG - Intergenic
1144719637 17:17459707-17459729 GAGGGGATAGGTTCGGTTGCTGG - Intergenic
1146751842 17:35389195-35389217 CATGGCCAAGGGTCTTTTGCTGG + Intergenic
1146752006 17:35390125-35390147 CAGGGGCAAGGTGGTTGTGCTGG + Intergenic
1150575894 17:66430550-66430572 CTGGGGCATGGGTCTGATGCAGG + Intronic
1152290115 17:79435595-79435617 CAGGAGCCAGGCTCTGTTGCAGG - Intronic
1152639782 17:81444684-81444706 CGGGGGGCAGGTTCTGGTGCAGG - Exonic
1152728162 17:81957816-81957838 CGGGGCCAAGGTGCTGCTGCTGG - Exonic
1152736313 17:81999030-81999052 CAGGTGCAGGGCTCTGATGCGGG - Intronic
1153574643 18:6508399-6508421 CAGGGGCAGGGTGCTGAGGCAGG - Intergenic
1153707965 18:7766613-7766635 CAGGGGCAAGCTGCTGCTACTGG + Intronic
1157443084 18:47724931-47724953 CAGGGGCCATCTTCTGTAGCTGG + Intergenic
1157559940 18:48638902-48638924 CAGAGGCAAGGTTTTGTGGGAGG + Intronic
1157754241 18:50204039-50204061 GAGGGGCAAGTGTCTGTTGGAGG - Intergenic
1159257052 18:65960510-65960532 CAGAGGCAGGGTCCTGTGGCAGG + Intergenic
1160147596 18:76377603-76377625 CAGGGGCATGGTTCTGGGTCTGG - Intronic
1161598348 19:5164287-5164309 CAGGGTCCAGGGACTGTTGCAGG - Intronic
1162568454 19:11457243-11457265 CGGGGGCAGGGCTCTGCTGCAGG - Intronic
1164993092 19:32698616-32698638 CAGGGTCCAGGGACTGTTGCGGG - Intronic
925950011 2:8901067-8901089 CAGGGTCCAGGGACTGTTGCAGG - Intronic
925950036 2:8901226-8901248 CAGGGTCCAGGGACTGTTGCAGG - Intronic
927488385 2:23504674-23504696 CTGGAGCAAGGTTCTAGTGCCGG + Intronic
929330237 2:40673640-40673662 CAGGGTCCAGGGACTGTTGCGGG + Intergenic
930109258 2:47664661-47664683 GAGGGGCCAAGTTCTGTGGCTGG + Intergenic
933362221 2:81302720-81302742 AAAGGGAAAGGATCTGTTGCTGG - Intergenic
933876500 2:86625303-86625325 CAGGGGCAGTGTCCAGTTGCTGG - Intronic
939818270 2:146922981-146923003 GAGGAGCAAGGTCCTGTTGGAGG - Intergenic
941243284 2:163068320-163068342 CAGGGTCCAGGGACTGTTGCGGG + Intergenic
943103193 2:183511300-183511322 CAGGGTCCAGGGACTGTTGCAGG - Intergenic
946092918 2:217246632-217246654 CAAAGGCAAGTTTCAGTTGCAGG - Intergenic
946207491 2:218120377-218120399 CAGGGTCCAGGGACTGTTGCAGG - Intergenic
947712060 2:232321935-232321957 CAGGGGAAAGGCTCTGTCCCTGG + Intronic
947731299 2:232433054-232433076 CAGGGGAAAGGCTCTGTCCCTGG + Intergenic
948567965 2:238898423-238898445 CTGGGGAATGGTGCTGTTGCTGG + Intronic
1171880739 20:30616132-30616154 CAGGGGCAGAGTTCTGGGGCTGG + Intergenic
1173857136 20:46257717-46257739 CAGGGGTGAGGTCCTGCTGCAGG + Intronic
1174624674 20:51904181-51904203 CAGGGCAAAGGCTCTGGTGCAGG + Intergenic
1176448089 21:6839763-6839785 CAGGGGCAATGCGCTGCTGCTGG - Intergenic
1176826259 21:13704785-13704807 CAGGGGCAATGCGCTGCTGCTGG - Intergenic
1178912706 21:36688617-36688639 CAGTGGCAAGGCTCTGAAGCCGG - Intergenic
1179881134 21:44293779-44293801 CAGGAGCCAGGTTCTGTGGGAGG - Exonic
1180013214 21:45064934-45064956 CAGGGGCAAGGGTCTCCCGCCGG - Intergenic
1181988829 22:26821117-26821139 ATGGGGCAGGGTTCTGTGGCTGG + Intergenic
1184094985 22:42311579-42311601 CAGGAGCAAGGTGCAGTTGAAGG + Intronic
1184377709 22:44124920-44124942 CAGGGCCAAGTTTCTCTGGCAGG - Intronic
1184892410 22:47388127-47388149 CAGAGGCAAGGGACCGTTGCTGG - Intergenic
950439266 3:12999249-12999271 CAGGGAGAAGGTTCTGGAGCTGG - Intronic
951781639 3:26369820-26369842 CAGCTGCAAGCTTCTGTTGGTGG + Intergenic
952452886 3:33448199-33448221 CAGGGTCCAGGGACTGTTGCGGG + Intergenic
952555182 3:34522742-34522764 CAGGGTCCAGGGACTGTTGCAGG - Intergenic
953623075 3:44549280-44549302 CAGGGTCCAGGGACTGTTGCGGG - Intergenic
954388769 3:50258219-50258241 CAGGAGCCAGTTTCTGTTGCTGG - Intronic
954598793 3:51851805-51851827 CAGGGTCCAGGGACTGTTGCAGG + Intergenic
956906665 3:73772947-73772969 CAGGGACAAGGGTGTATTGCAGG + Intergenic
959001513 3:100969476-100969498 CAGAGTCAAGGATCTGCTGCTGG - Intronic
961785399 3:129344148-129344170 CAGGGGTCAGGCTCTGCTGCAGG + Intergenic
961787882 3:129358343-129358365 CAGGGGCAGAGTTCTGGTGTGGG + Intergenic
964064368 3:152561459-152561481 CAGGGTCCAGGGACTGTTGCGGG + Intergenic
964172694 3:153789841-153789863 CAGGGGCCAAATTTTGTTGCTGG - Intergenic
968456666 4:703989-704011 CAGGGGCAAGGTATTGGTGCTGG - Intergenic
972133430 4:35863553-35863575 CAGGGTCCAGGTACTGTTGTGGG - Intergenic
972644595 4:40955289-40955311 CAAGGGCAAGGTCATGTGGCTGG + Intronic
973263997 4:48192964-48192986 CAGGTGCCAGGCTCTGCTGCAGG - Intronic
974094809 4:57351407-57351429 CAGTGGGAATGTTCAGTTGCTGG + Intergenic
974187178 4:58459738-58459760 CAGGGTCCAGGTACCGTTGCAGG + Intergenic
974599572 4:64059920-64059942 CAGGGCCAAGGTTCTGTGCAGGG + Intergenic
975047864 4:69826490-69826512 CAGGGTCCAGGGACTGTTGCGGG + Intronic
980851480 4:138388153-138388175 CAGGGGCAAGGCCCTTTCGCAGG + Intergenic
983354349 4:166636811-166636833 CAGTGGCAAGTTTCTGCTCCTGG + Intergenic
986014397 5:3745483-3745505 CAGGGGGCTGGTTCTGTTGAGGG - Intergenic
986711617 5:10492070-10492092 CTGGGGCAGGGAACTGTTGCTGG + Intergenic
988605646 5:32676414-32676436 CAGGGTCCAGGGACTGTTGCAGG - Intergenic
989194788 5:38706296-38706318 AAGGGGCCTGGTTCTGTTGTGGG - Intergenic
1000230067 5:159307567-159307589 CAAGTGCAAGGTTCTGTTTTAGG - Intergenic
1001171698 5:169425387-169425409 CCTGGGAAAGGTTCTGTTCCTGG + Intergenic
1003671068 6:8160594-8160616 CAGGTGCAAGGTTTTGTTACAGG + Intergenic
1004288901 6:14348748-14348770 CAGAGGCAAGGATTTGTTGGGGG + Intergenic
1005214780 6:23512782-23512804 CCTGGGAAAGGTTCTGCTGCTGG - Intergenic
1006170638 6:32090022-32090044 CAAGGGAAAGGTTGTGATGCGGG - Intronic
1008451111 6:51651892-51651914 CAGTTGTAAGGTTCTATTGCTGG + Intronic
1009720025 6:67456629-67456651 CATGGGCAAGGTCCTCTTGAAGG + Intergenic
1009939225 6:70270152-70270174 CAAGGGCATGGTTCTGTTTAGGG - Intronic
1015138859 6:129907420-129907442 AAGGGGCAAGCTTCTCTTGTAGG - Intergenic
1015797981 6:137032224-137032246 CAGGGGCTAGTTTCAGTGGCAGG + Intronic
1015841964 6:137486855-137486877 CAGAGGCAAATTTCTGTAGCTGG + Intergenic
1017069929 6:150566662-150566684 CATGGACAAGGAGCTGTTGCAGG - Intergenic
1018419106 6:163626644-163626666 CAGGGCCAAGGCTTTCTTGCAGG - Intergenic
1019501701 7:1368147-1368169 CACGGGCAAGGTGGTGTTGGTGG - Intergenic
1022980102 7:35596233-35596255 CAGGGGAAAGGTCCAGTTTCTGG + Intergenic
1026483656 7:70799574-70799596 CAGGGCCATGGTTATGGTGCAGG - Intergenic
1029215908 7:98949535-98949557 CAGGCGCATGGTGCTGGTGCTGG - Exonic
1031731616 7:125309399-125309421 CAGGGTCCAGGGACTGTTGCAGG + Intergenic
1031731627 7:125309479-125309501 CAGGGTCCAGGGACTGTTGCGGG + Intergenic
1032171811 7:129591111-129591133 ATAGGGCAAGGTTCTGTTGTGGG + Intergenic
1032361359 7:131258334-131258356 CTGGAGGAAGATTCTGTTGCTGG + Intronic
1032361361 7:131258353-131258375 CTGGAGGAAGATTCTGTTGCTGG + Intronic
1033280187 7:140001049-140001071 AAAGGGCAGGGTTCTGTTCCGGG - Intronic
1034357077 7:150459585-150459607 CTGGGGCAAGGTTCTCTAGGAGG - Intronic
1034683906 7:152952897-152952919 CAGGGTCCAGGTTCTGGAGCTGG + Intergenic
1037572115 8:20166975-20166997 CATGGTCAAGGTACTGTTGAGGG - Intronic
1038360744 8:26873490-26873512 CAGGGCAAAGGTTCTAATGCAGG + Intergenic
1039693328 8:39883838-39883860 CAGGGTCCAGGGACTGTTGCAGG - Intergenic
1040063859 8:43128179-43128201 GAGGGGCAAGGTTCTGTTGGTGG + Intergenic
1044930618 8:97248424-97248446 CAGGGGCCAGTTTCTATTGGGGG + Intergenic
1046359491 8:113131745-113131767 CAGGTGCACGGTGCTGTTGGTGG - Intronic
1046517908 8:115287360-115287382 CAGAGGTAAGGTTCTGGTCCTGG - Intergenic
1049838275 8:144754321-144754343 CAGCGGCGATGTTTTGTTGCAGG - Exonic
1053530846 9:38879378-38879400 CAGGGGCAGGGTGCTGGTGGAGG - Intergenic
1054203069 9:62103811-62103833 CAGGGGCAGGGTGCTGGTGGAGG - Intergenic
1054635294 9:67484554-67484576 CAGGGGCAGGGTGCTGGTGGAGG + Intergenic
1057547900 9:96031775-96031797 CAGGGTCAAGCTTGTGTTCCTGG - Intergenic
1057793595 9:98140258-98140280 CAGGGGACAGGTGCTGTTGGAGG + Intronic
1059420370 9:114186828-114186850 CTGGGGCAGGGTGCTGATGCTGG + Intronic
1060392232 9:123287468-123287490 CAGGGACAAAGTCCTGTTGATGG + Intergenic
1060420442 9:123465430-123465452 CAGGGTCAAGGTTCAAATGCAGG - Intronic
1060879121 9:127105403-127105425 CAGGGGCACAGTTCTATTCCTGG - Intronic
1061822941 9:133238633-133238655 CAGGGTCAAGGCTGTGTTGAGGG + Intergenic
1203521101 Un_GL000213v1:44755-44777 CAGGGGCAATGCGCTGCTGCTGG + Intergenic
1192926562 X:75760157-75760179 CAGGGGCTAGGTGCTGGTGGGGG - Intergenic
1193042020 X:77014132-77014154 CAGGGGCCAGGGTTTGTTGAGGG - Intergenic
1195439416 X:104884405-104884427 CAGGGTCCAGGGACTGTTGCAGG + Intronic
1195552542 X:106185365-106185387 CAGGGTCCAGGTACCGTTGCAGG - Intronic
1196488830 X:116245152-116245174 CAGGGTCCAGGGACTGTTGCAGG + Intergenic
1201516111 Y:14820051-14820073 CAGGGTCCAGGGACTGTTGCAGG - Intronic
1201631106 Y:16072828-16072850 CAGGGTCCAGGGACTGTTGCAGG + Intergenic