ID: 1084708419

View in Genome Browser
Species Human (GRCh38)
Location 11:70829419-70829441
Sequence AAGGCTCCTTCCCTTCTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 375}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084708419_1084708428 13 Left 1084708419 11:70829419-70829441 CCAGGGAGAAGGGAAGGAGCCTT 0: 1
1: 0
2: 2
3: 30
4: 375
Right 1084708428 11:70829455-70829477 CCCGTCACCAGGAATACGGCTGG 0: 1
1: 0
2: 0
3: 2
4: 33
1084708419_1084708425 9 Left 1084708419 11:70829419-70829441 CCAGGGAGAAGGGAAGGAGCCTT 0: 1
1: 0
2: 2
3: 30
4: 375
Right 1084708425 11:70829451-70829473 AGGCCCCGTCACCAGGAATACGG 0: 1
1: 0
2: 0
3: 2
4: 73
1084708419_1084708432 27 Left 1084708419 11:70829419-70829441 CCAGGGAGAAGGGAAGGAGCCTT 0: 1
1: 0
2: 2
3: 30
4: 375
Right 1084708432 11:70829469-70829491 TACGGCTGGCTTCCACCCCTGGG 0: 1
1: 0
2: 0
3: 5
4: 92
1084708419_1084708431 26 Left 1084708419 11:70829419-70829441 CCAGGGAGAAGGGAAGGAGCCTT 0: 1
1: 0
2: 2
3: 30
4: 375
Right 1084708431 11:70829468-70829490 ATACGGCTGGCTTCCACCCCTGG 0: 1
1: 0
2: 1
3: 4
4: 76
1084708419_1084708433 28 Left 1084708419 11:70829419-70829441 CCAGGGAGAAGGGAAGGAGCCTT 0: 1
1: 0
2: 2
3: 30
4: 375
Right 1084708433 11:70829470-70829492 ACGGCTGGCTTCCACCCCTGGGG 0: 1
1: 0
2: 0
3: 20
4: 212
1084708419_1084708424 2 Left 1084708419 11:70829419-70829441 CCAGGGAGAAGGGAAGGAGCCTT 0: 1
1: 0
2: 2
3: 30
4: 375
Right 1084708424 11:70829444-70829466 CAAGACAAGGCCCCGTCACCAGG 0: 1
1: 0
2: 2
3: 33
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084708419 Original CRISPR AAGGCTCCTTCCCTTCTCCC TGG (reversed) Intronic
900782761 1:4628760-4628782 AAGGCCCCTCCCCCTCCCCCAGG - Intergenic
902436269 1:16399897-16399919 AAGCCTGCCTCCCTTCCCCCAGG - Intronic
902556049 1:17247410-17247432 GAGGTTTCCTCCCTTCTCCCTGG - Intergenic
903302121 1:22386493-22386515 CCTGCTCCTTCCATTCTCCCTGG + Intergenic
903540666 1:24094552-24094574 ATGGCTTCCTCCCTCCTCCCAGG + Intronic
903751337 1:25623046-25623068 AAGATCCTTTCCCTTCTCCCTGG + Intronic
903885111 1:26536599-26536621 CATGACCCTTCCCTTCTCCCTGG + Intronic
903977738 1:27162207-27162229 AAGCCTTCTTCCAGTCTCCCCGG + Intronic
904276688 1:29389522-29389544 AAGGCTTCCACCCTCCTCCCTGG - Intergenic
904802423 1:33103267-33103289 AAGGCTCCTGCCATCTTCCCAGG + Intronic
904970372 1:34414742-34414764 AAGGCTCCATCCCATGGCCCTGG + Intergenic
905515446 1:38558902-38558924 GAGGCCCCCTCCCTTCCCCCAGG + Intergenic
905601325 1:39254299-39254321 ACGCATCCTGCCCTTCTCCCGGG - Exonic
905643687 1:39609821-39609843 GAGGCTCCCTCCCATCACCCGGG - Intergenic
905645313 1:39621264-39621286 TAGCCTCCTTCCCTCCTTCCTGG - Intergenic
905677911 1:39842516-39842538 AATGCACCTTCCTGTCTCCCTGG - Intronic
905828320 1:41044279-41044301 ATGACTCCTGCCCTTCTGCCTGG - Intronic
906660218 1:47576571-47576593 AAGACTCCTTCCCTACCCCTTGG - Intergenic
906792442 1:48670651-48670673 AAGGCTGCCTACCTGCTCCCAGG - Intronic
906797357 1:48708691-48708713 AAAGCTCATTCCCTTCTTTCAGG + Intronic
906922897 1:50083514-50083536 AAAGCTCCTTCCTCTCTCACTGG + Intronic
906933934 1:50195539-50195561 AAGGCTCTTTCTCTTTCCCCAGG + Exonic
907395345 1:54185753-54185775 AAGAATCCTTCCCTTCTTCTTGG - Intronic
908166223 1:61462137-61462159 ACGGCTCGGTGCCTTCTCCCTGG + Intronic
909554110 1:76933696-76933718 AAGGATACGTCTCTTCTCCCGGG - Intronic
909662924 1:78104094-78104116 AAGGCCTCTCCCCATCTCCCAGG - Intronic
909986645 1:82169449-82169471 GAGTCTCATTCCCTTCACCCAGG + Intergenic
912251273 1:108014930-108014952 AGTGCCCTTTCCCTTCTCCCAGG + Intergenic
913188750 1:116395088-116395110 AAGGCTCCTGTCCTCCTCGCAGG + Exonic
914404586 1:147358220-147358242 ATGGCTGCCACCCTTCTCCCCGG - Intergenic
914418806 1:147509575-147509597 CAGGCACCTTCCCTTCCCTCAGG + Intergenic
916494613 1:165334812-165334834 AGGGCTTCTGCCCTTCTCTCAGG - Intronic
916731311 1:167569375-167569397 AAGGCTCTTTCCCTTACCCTAGG + Intergenic
917028707 1:170667051-170667073 GAGTCTTCTCCCCTTCTCCCGGG - Intronic
917599106 1:176557363-176557385 AAGGCCCTTCCCCCTCTCCCTGG - Intronic
918270995 1:182899198-182899220 AAGGTTCTTTCCCTTCTGCTTGG + Intergenic
918319954 1:183354984-183355006 AAGGCTCCTTCCATTGTGCTTGG + Intronic
919986477 1:202679262-202679284 AAGACTCCCTCTCTTCTCCTAGG + Intronic
921318776 1:213917309-213917331 AGGACTACTTTCCTTCTCCCAGG - Intergenic
922867331 1:228871378-228871400 AAGCCTCCCTCCTTTATCCCAGG - Intergenic
922995292 1:229952888-229952910 ACTGTTCCCTCCCTTCTCCCTGG - Intergenic
923320777 1:232830871-232830893 CAGGCTCCTCACCTTCCCCCAGG - Intergenic
1063230381 10:4060425-4060447 CAGGCTCCTTCCCATCTTCTTGG - Intergenic
1064924225 10:20552164-20552186 AAGGAGCTTTACCTTCTCCCAGG + Intergenic
1066188536 10:33034399-33034421 GAGGCTCCTTCCATTTTCCGAGG - Intergenic
1067033752 10:42898327-42898349 CAGGCTCCTTCCACCCTCCCGGG + Intergenic
1067515582 10:46938775-46938797 AAGGCTCACCCCCTTCTCTCTGG + Intronic
1067646669 10:48113040-48113062 AAGGCTCACCCCCTTCTCTCTGG - Intergenic
1068602247 10:58968305-58968327 ATGGCTCCTCCACTTCTCTCAGG - Intergenic
1069796139 10:71053145-71053167 AGGCCTCCTTCCTTCCTCCCAGG - Intergenic
1069979728 10:72243772-72243794 AAGGCTCCTTGTCATCTCCTCGG - Intergenic
1070563642 10:77587270-77587292 AAGGCTTCTTGCCTTCTTCAGGG - Intronic
1070593978 10:77819812-77819834 AATGCTGCCTCCCCTCTCCCTGG + Intronic
1071129397 10:82373813-82373835 AAAGCTCTTTCCTTTCTGCCTGG + Intronic
1071342800 10:84664266-84664288 AAGGTGCCTTTCCTTCTTCCAGG + Intergenic
1071471021 10:85984138-85984160 GAGGCTCCAACCCATCTCCCTGG + Intronic
1072295048 10:94000824-94000846 AAGTCTCATTGCCTTCTGCCAGG + Intronic
1072699399 10:97629598-97629620 AAGGCTCCTTCACTGATGCCTGG - Intronic
1072773133 10:98160578-98160600 AACATTCTTTCCCTTCTCCCTGG + Intronic
1072790666 10:98315441-98315463 AAGGGTCCTTCCCTTTCTCCTGG + Intergenic
1073336624 10:102714671-102714693 AAGGCCCCTTACCTGGTCCCGGG - Exonic
1073585494 10:104706069-104706091 AAGTCTCCCTCCTTGCTCCCTGG + Intronic
1074599634 10:114900670-114900692 AAGGCTCTTTCCTTTCCACCTGG + Intergenic
1075014902 10:118903494-118903516 GGGGCTCCTTCCCTTGGCCCAGG - Intergenic
1075230398 10:120671486-120671508 ATGGCTGCTGCCCCTCTCCCTGG - Intergenic
1076183709 10:128430683-128430705 AAGCGGCCTTCCCTTCTGCCTGG - Intergenic
1076314798 10:129532589-129532611 AAGGCTCCTACCTTTCTCCCTGG + Intronic
1076568241 10:131413280-131413302 AGTGCTGCTTCCCTTTTCCCAGG - Intergenic
1076794673 10:132792794-132792816 CAGGCTGCTTCTCTTCTCCCTGG + Intergenic
1076885944 10:133262296-133262318 AAGCCACCTTCTTTTCTCCCTGG - Intergenic
1077171437 11:1168013-1168035 CAGGCCCCTTCCCTCTTCCCGGG - Intronic
1077375160 11:2202287-2202309 AAGGCTCCTTCACCTGGCCCTGG + Intergenic
1079145301 11:17846006-17846028 AAGGATACTTCCCTGGTCCCAGG - Intronic
1079331238 11:19534641-19534663 ATTGCTCCTTCCCTGCTCCCTGG - Intronic
1080267664 11:30418375-30418397 AAGACTCATTCCCTTCTACATGG - Intronic
1081812178 11:45920324-45920346 GAGGCCCCTCCCCTGCTCCCTGG + Intergenic
1081838457 11:46177046-46177068 CAGTCTCCTTTCCTTCTCACAGG + Intergenic
1083059533 11:59855394-59855416 ATGTCTCCTTTCCTTCTACCTGG + Intronic
1083361957 11:62115312-62115334 AAAGTTCCTGCCCTTTTCCCTGG + Intergenic
1083955244 11:65979236-65979258 AAGGCTCCTTCCTTCTCCCCTGG + Exonic
1084708419 11:70829419-70829441 AAGGCTCCTTCCCTTCTCCCTGG - Intronic
1084844303 11:71887456-71887478 AAGTCTCCTTTCCTCCTCTCGGG - Intronic
1084863641 11:72038924-72038946 AAGGCACCCTCTCTTTTCCCTGG + Intronic
1084928118 11:72530611-72530633 TAGGCTTCTTCCATTCTCCTGGG + Intergenic
1085392664 11:76190369-76190391 CTGGCTCCTTCCTGTCTCCCTGG + Intronic
1087153738 11:94881471-94881493 ATTGATCCTTCCCTTGTCCCTGG + Intergenic
1087473089 11:98601562-98601584 AATGCTCCTTCCATAGTCCCTGG + Intergenic
1088970973 11:114774546-114774568 AGGGCTCCTTACATTCTCCATGG + Intergenic
1089833679 11:121351080-121351102 ATGCCTGCTTCCCTTCCCCCTGG - Intergenic
1090366702 11:126212219-126212241 ACGGCCCCTTCCCTTATCCAGGG + Intronic
1090548343 11:127790800-127790822 AAGCCTCCAGCCCTGCTCCCGGG - Intergenic
1090624906 11:128598261-128598283 AAGGATTCTTCCCTGCCCCCAGG + Intergenic
1091369045 11:135043574-135043596 AGGGCAGCTTCCCTTCTCCCTGG - Intergenic
1091645014 12:2266539-2266561 AATGCACCTTCCCAACTCCCAGG - Intronic
1092259649 12:6946148-6946170 GAGGCTCCTCCCCTTCCCCCGGG + Intergenic
1093783565 12:23166342-23166364 AAGGTTCCTTGCCATTTCCCTGG + Intergenic
1094424738 12:30306043-30306065 AACTCTGCTTCCCTCCTCCCAGG + Intergenic
1096075472 12:48801155-48801177 AAGGCTCCTGCTGTTGTCCCCGG - Intergenic
1096650081 12:53058294-53058316 CAGCCTCCTGCCTTTCTCCCAGG + Exonic
1096774687 12:53956752-53956774 TAGGTTTCTTCCCTTCTCTCTGG - Exonic
1096803650 12:54127438-54127460 AAGGCCCCTACTCTCCTCCCAGG + Intergenic
1097744385 12:63285304-63285326 AGGGCTCCTTCTCTTCTCTTTGG - Intergenic
1098313684 12:69171965-69171987 AAGGCTCCATTTCTCCTCCCGGG - Intergenic
1098351742 12:69569742-69569764 AAAGCTCTTTTCCTACTCCCAGG + Intronic
1098820444 12:75221085-75221107 AAGGGTCCTTCCCTTGGCGCTGG - Intergenic
1101334531 12:103784641-103784663 GAGGCACCTTGCTTTCTCCCTGG - Intronic
1101347575 12:103900777-103900799 AATGCCCCTTCCCTTGTCTCAGG - Intergenic
1101496537 12:105259848-105259870 CAGCCCCCTTCCCTACTCCCTGG + Intronic
1103452473 12:121039011-121039033 CAGGCTCCTACCCAGCTCCCTGG + Exonic
1103865937 12:124052168-124052190 AAGGCTGCCTCCCATCTCTCGGG + Intronic
1103884136 12:124188292-124188314 CCAGCTCCTTCCCTTCTCCTGGG - Intronic
1104050306 12:125190097-125190119 AAGTCTCCTTCCCATCTGCCGGG - Intronic
1104084038 12:125458233-125458255 CAGGCTCCATCCCTTGTCCTTGG - Intronic
1104119528 12:125786052-125786074 AAATCTCCTTCCCGTCTCCTGGG - Intergenic
1104251697 12:127100619-127100641 TTGGCTCCTCCCCTTCACCCTGG + Intergenic
1104466322 12:128993814-128993836 AAAGCTCCTCTCCATCTCCCAGG + Intergenic
1104752383 12:131247919-131247941 AATGCACCTTCTCTTCTCCTGGG + Intergenic
1104779552 12:131411309-131411331 AATGCACCTTCTCTTCTCCTGGG - Intergenic
1104781578 12:131423870-131423892 AAGCCTTCCTCCCTCCTCCCTGG - Intergenic
1104816125 12:131646539-131646561 GAGGAGCCTTCCCTTGTCCCTGG + Intergenic
1105518537 13:21111684-21111706 AGGGCTCCCTCCCTCCTGCCTGG - Intergenic
1105764095 13:23541352-23541374 ATGTTTCCTTCCCTTCTCTCAGG + Intergenic
1106717573 13:32407108-32407130 AAACCTCGTTACCTTCTCCCTGG + Intronic
1106758344 13:32844340-32844362 AAAGCTCCTTCCTCTTTCCCAGG + Intergenic
1107997150 13:45872219-45872241 AAGACGCATTCCCTTCACCCCGG - Intergenic
1108574612 13:51780414-51780436 AAGGTGCCTTCCCTCCTCCCAGG - Intronic
1109224569 13:59676911-59676933 AATGTTCCTTTACTTCTCCCTGG + Intronic
1109267484 13:60217766-60217788 AGGGCTCCCTCCCCTCTACCAGG - Intergenic
1110708586 13:78624892-78624914 AAGGTTTCTTTCCTTCTCTCTGG + Intronic
1112186060 13:97128747-97128769 GAGGTTCCCTCCCTTCTCCTTGG + Intergenic
1113387245 13:109860047-109860069 TAGGCTCCTTCCCACCTCCCGGG + Intergenic
1113440725 13:110326122-110326144 ATGGCACCTGCCCTTCGCCCAGG + Intronic
1114458419 14:22872105-22872127 AAGGCACCGCCCCTACTCCCGGG + Exonic
1114459033 14:22875288-22875310 CAGGATCCTCCCCTTCTGCCTGG - Intronic
1114497826 14:23146118-23146140 AAGGCTGCGCCCCTTCACCCAGG + Intronic
1115658186 14:35464321-35464343 AAGGGGCCTTCCCTACTCCAAGG + Intergenic
1115770193 14:36659078-36659100 AAGGCTTTTTGGCTTCTCCCTGG + Intronic
1117009194 14:51452965-51452987 AAGTCACATTCCGTTCTCCCTGG - Intergenic
1117217559 14:53567689-53567711 AAGGCTCCTCCCCTCCCCACAGG - Intergenic
1117224181 14:53638111-53638133 AATGCTCCTTCACTTCTTCAGGG + Intergenic
1117588951 14:57245151-57245173 AATATTCTTTCCCTTCTCCCAGG + Intronic
1119507484 14:75185459-75185481 GAGGGTCCTTCCCTATTCCCTGG + Intergenic
1121328860 14:93037076-93037098 AAGGCTGTTCCCCTGCTCCCTGG + Intronic
1121580108 14:95023802-95023824 AAGGCTCCTTTGCTCCTCCTTGG - Intergenic
1121861004 14:97318221-97318243 AAGGCTCTTTCCCTTCCACATGG + Intergenic
1122746357 14:103899365-103899387 AAGGCGCCTTCCCTTCTAAGAGG - Intergenic
1123035216 14:105469213-105469235 AAGGCTCCTGGCCTCCTGCCTGG + Intronic
1123703689 15:22935235-22935257 AAGCCTCCATCCCTGCTCCAGGG - Intronic
1124105047 15:26729726-26729748 CAGGCTCCTTCACTTCCTCCAGG + Intronic
1125275065 15:37980254-37980276 AAGACTCCTTCACACCTCCCTGG - Intergenic
1125685487 15:41560940-41560962 CATGCCCCTTCCCTTCGCCCAGG + Intronic
1126906549 15:53374045-53374067 AAGGGTCCTTTTCTTCTCCCTGG + Intergenic
1127263988 15:57346645-57346667 CAGGCTCCTACTCTTCTCCCTGG + Intergenic
1127764643 15:62173155-62173177 AAGGCTCCTATCTTTTTCCCTGG - Intergenic
1127871533 15:63078009-63078031 AAGGCTCCTTCAGACCTCCCTGG - Intergenic
1128143477 15:65318464-65318486 GGGGCTCCTTCCCTTCCCCGAGG + Intergenic
1128816617 15:70614459-70614481 AGGGCTCATTCTCTTCTCCCTGG + Intergenic
1129241083 15:74252688-74252710 AAGGCTCCTTCTCTTCCAGCAGG + Intronic
1129270802 15:74418309-74418331 AATGCTTCTCCCCTTCCCCCAGG - Exonic
1129871416 15:78944215-78944237 CAGGCTCCTTGCCTTCAGCCAGG + Intronic
1131663678 15:94546326-94546348 AAGGCTCCTTCATTTATGCCTGG - Intergenic
1132639216 16:970211-970233 GAGCCTCCTTCGCGTCTCCCAGG - Intronic
1132710787 16:1266150-1266172 AGGGCTCCTTGGCCTCTCCCGGG - Intergenic
1134246986 16:12547428-12547450 GAGGCACCATCCCCTCTCCCCGG - Intronic
1135106188 16:19651954-19651976 AATGTTTCTTCCCTTCTCCTAGG + Exonic
1135382916 16:22008681-22008703 AGGGCTGCTCCCCTCCTCCCCGG - Intronic
1135792879 16:25413970-25413992 AAGTCTCCCTCACTTCTCCCAGG + Intergenic
1135890152 16:26349666-26349688 GATGCTCCTTCCTTCCTCCCAGG - Intergenic
1136048039 16:27631037-27631059 AAGTCTCCTTCCCTCGTCTCTGG + Intronic
1137635028 16:49978457-49978479 CATGCTCCTTCCCTCCACCCAGG + Intergenic
1137926883 16:52548052-52548074 AAAGCCCCTTCCCTTCGCCAAGG - Intergenic
1138195682 16:55050376-55050398 CAGGCTCTTCCCCTACTCCCTGG - Intergenic
1138885935 16:61079536-61079558 ATGTCTTCTTCCCTTCTGCCTGG - Intergenic
1139438093 16:66948433-66948455 ACGGCCACTTCCCTTCTGCCCGG - Intergenic
1140440685 16:74985174-74985196 TAGGCTCCGCCCCTTCTTCCTGG + Intronic
1141239051 16:82248090-82248112 GGGGCTCCTTCCCAGCTCCCCGG + Intergenic
1141431410 16:83972054-83972076 TGGGATCCTTCTCTTCTCCCAGG - Intronic
1141536336 16:84683344-84683366 CATGCCCCTCCCCTTCTCCCAGG + Intergenic
1141704094 16:85655217-85655239 TTGGCTCCTCCCCTTCTCACCGG + Intronic
1141994729 16:87629035-87629057 AAGGCTCCTTCCAGGCTCCAGGG + Intronic
1142224106 16:88869307-88869329 GACGCCCCTTCCCCTCTCCCTGG + Intergenic
1143199241 17:5100672-5100694 CAGACTCCATCCCTCCTCCCAGG + Intergenic
1143710130 17:8728622-8728644 AAGGCTCCGTGTCTCCTCCCTGG - Intergenic
1143743112 17:8968221-8968243 AAGGCTGCTTCTCTTCTCCCTGG + Intergenic
1144765025 17:17727852-17727874 CTCTCTCCTTCCCTTCTCCCCGG - Intronic
1144788874 17:17846598-17846620 AAGGCCCCTGCTCTGCTCCCTGG - Intronic
1147443335 17:40460615-40460637 CAGCCCCCTTCCCTTCTACCTGG + Intergenic
1148550838 17:48550180-48550202 GGAGCTCCTTCCCTTCCCCCTGG - Exonic
1148975957 17:51528349-51528371 AAGGCTCCCTCCCTTCCTTCTGG - Intergenic
1151224726 17:72640031-72640053 ACAGCGCCATCCCTTCTCCCAGG + Intergenic
1151298391 17:73202759-73202781 CAGGGTCTTGCCCTTCTCCCAGG - Intronic
1151993986 17:77597043-77597065 AAGGCACCTCCCCATCTCCATGG - Intergenic
1152029737 17:77834607-77834629 AGGGCAGCTTCCCTTCTGCCAGG - Intergenic
1152450418 17:80375318-80375340 AAGGCTCCTTCCCTTTTGGTGGG + Intronic
1159043554 18:63347146-63347168 ATTACTTCTTCCCTTCTCCCTGG + Intronic
1159289609 18:66398635-66398657 ATAGCTCCTTCTCTTCTCCTGGG - Intergenic
1160184836 18:76667863-76667885 AAAGCTGCTTCACTGCTCCCGGG + Intergenic
1160371531 18:78376216-78376238 GAGGCCTCTTCCCTCCTCCCTGG + Intergenic
1160572431 18:79827315-79827337 AAGCCTCCTTTCGTTTTCCCTGG + Intergenic
1161972391 19:7589983-7590005 AAGCCTCCTTCTATTCTCCTTGG + Intergenic
1162490330 19:10987644-10987666 CTGGCCCCTTGCCTTCTCCCAGG + Exonic
1162809512 19:13155583-13155605 CAGGCCCCCTCCCTTCGCCCTGG - Intergenic
1163421580 19:17216324-17216346 AGGGCTCCTTCCCTGGTCCCTGG + Intronic
1164593319 19:29517993-29518015 TGGGTTCCTTCCCTGCTCCCAGG - Intergenic
1164599726 19:29552719-29552741 ATGGCTGCTGCCCTTCCCCCTGG - Intronic
1166193716 19:41193233-41193255 TCGGCTCCTTCTCCTCTCCCAGG - Exonic
1167306576 19:48713414-48713436 ACTCCTCCTCCCCTTCTCCCAGG - Exonic
925983986 2:9200327-9200349 AAAACACCTCCCCTTCTCCCAGG + Intergenic
926766361 2:16325838-16325860 AGGGCTCATTCCACTCTCCCAGG + Intergenic
927495078 2:23546637-23546659 GAGGCTTCTCCCCCTCTCCCGGG + Intronic
928399700 2:30969030-30969052 CTGGCTCCTTCCCCTCTGCCTGG - Intronic
929801182 2:45104506-45104528 AATGCTCATTTCCTTCTACCTGG - Intergenic
930895793 2:56444549-56444571 ACAGTTCCTTCCATTCTCCCAGG - Intergenic
931053971 2:58447659-58447681 GAAACTCCTTCCATTCTCCCTGG - Intergenic
931965679 2:67531613-67531635 ATAGCTTCTTCCCTTCTCCCAGG + Intergenic
932313553 2:70764468-70764490 AACTCCCCTTCCCTTCACCCAGG + Intronic
932415770 2:71573143-71573165 TAGGTTCCTTCCTTTCTCCTTGG + Intronic
932571812 2:72942230-72942252 TAGGCTCCTGCCCTTTTCCCAGG + Exonic
933751120 2:85602576-85602598 TGGGCTCCTTCCCTTCCTCCGGG - Intronic
933758564 2:85659614-85659636 CAGGCTCTTCCCCTGCTCCCTGG - Intronic
934025746 2:88000335-88000357 ATGGCTCCTGCCCTTGTCCAGGG - Intergenic
934107334 2:88707560-88707582 AAGGCTTCTCACATTCTCCCTGG + Intronic
935392237 2:102565307-102565329 AAGGCTCCTACCCACCTCCGTGG - Intergenic
936057074 2:109269334-109269356 GAGGCTCCCTCTGTTCTCCCGGG - Intronic
936438440 2:112529054-112529076 AGAGCTCCTTCCCCTCTCCCCGG + Exonic
937834936 2:126462347-126462369 AAGCCTCCTTCCTTTCTCCTGGG - Intergenic
938179057 2:129163251-129163273 AATGCTCTTTCCCTTCTTCTTGG - Intergenic
938724046 2:134091234-134091256 AAGGATTCCTCCCTCCTCCCTGG + Intergenic
939327489 2:140712482-140712504 AAGGCTCCTCCTATGCTCCCTGG + Intronic
942084693 2:172433001-172433023 AAGGCTGCTTACCTGCTCCGGGG + Intronic
943073177 2:183165669-183165691 AATACCCCTCCCCTTCTCCCAGG + Intergenic
943562034 2:189475419-189475441 AAGGATCCTCCCCATCTCCAAGG - Exonic
944661304 2:201923998-201924020 AACTCTCCCTCCCTTCTCACAGG - Intergenic
946022154 2:216648183-216648205 ACGGCTCCTTCCCTTCCCTTGGG + Intronic
946226265 2:218265616-218265638 CACTCTCCTCCCCTTCTCCCAGG + Exonic
946334879 2:219029903-219029925 AGAGCTCCTTCCCTGCTCCTAGG - Intronic
946399414 2:219460787-219460809 CAGGCGCCTTCCCCTCCCCCAGG + Intronic
947918416 2:233849384-233849406 GAGGCTCCTTCCTTTTCCCCAGG - Intronic
947979332 2:234395775-234395797 AAAGCTGCTTCCTTTCTCCTGGG - Intergenic
948395726 2:237643599-237643621 AGGCCTCCCTCCCTTCTCCCAGG + Intronic
1169194487 20:3675859-3675881 ATGGCTGCTTCCCCCCTCCCAGG + Intronic
1169199484 20:3701300-3701322 CAGGCTCCCTCCACTCTCCCTGG + Intronic
1169743791 20:8922467-8922489 GAAGCTCCATCTCTTCTCCCTGG - Intronic
1170978596 20:21189773-21189795 AACGCTCCTTCTCTTTACCCAGG - Intronic
1171120475 20:22564256-22564278 AGACCTCCTTCCCTTCTCCTGGG + Intergenic
1173243340 20:41317280-41317302 GAGGCTCCGCCCCTTCCCCCCGG - Intronic
1173302502 20:41816688-41816710 CAGCCTCATTCCCATCTCCCAGG + Intergenic
1174843190 20:53919031-53919053 ATTCCTCCTGCCCTTCTCCCTGG - Intergenic
1175332415 20:58174714-58174736 AAAGCTCCTTCCTTTCTTTCAGG + Intergenic
1176089881 20:63314050-63314072 CAGGCACCCTCCCTTCTCCTAGG + Exonic
1179780169 21:43694539-43694561 AAGGCTGCTCGCCTTCTCCGTGG + Exonic
1180728329 22:17962464-17962486 AAGGCTCCTGTCCTCCTCCCAGG - Intronic
1181313976 22:21960265-21960287 GAGGCTCCCTGGCTTCTCCCTGG - Intronic
1182091132 22:27595688-27595710 CTGGCCGCTTCCCTTCTCCCTGG + Intergenic
1182552298 22:31106963-31106985 AAGTCTCTTTTCCTTCTCCTGGG - Intronic
1182930653 22:34171000-34171022 AAGGCTCTTTCCTTGCTCCTTGG + Intergenic
1183498439 22:38163640-38163662 AATGCTCCTTCCCAACTCCTTGG - Intronic
1184112117 22:42401549-42401571 AAGGCTCCCTCCCTCCTCCACGG - Intronic
1184757676 22:46526128-46526150 GTGGCCCCTTCCATTCTCCCAGG + Intronic
949312753 3:2718604-2718626 AACTATCCTTCCCTACTCCCAGG - Intronic
949547002 3:5081038-5081060 AAGGCTTCTTGCTTCCTCCCTGG + Intergenic
950658382 3:14451506-14451528 AAGGCTTTGACCCTTCTCCCTGG - Intronic
951259929 3:20495559-20495581 AAGGCTCATTGCATACTCCCTGG + Intergenic
952233515 3:31455718-31455740 AAGGCTCCTCCCCCTGGCCCCGG - Intergenic
953958418 3:47248383-47248405 CAGGCTCCTTCCAGTCTACCAGG + Intronic
954563956 3:51582618-51582640 AAGGTTCGTTTCCTTCTCCATGG - Intronic
955033791 3:55246520-55246542 AAAGCTGGTTCCCATCTCCCTGG + Intergenic
955169414 3:56548790-56548812 ATGGCCCCTGCTCTTCTCCCAGG - Intergenic
955949260 3:64225605-64225627 AGGCTTCCTTCCCCTCTCCCTGG - Intronic
956053828 3:65277602-65277624 AATGCTCTGTCCCTTCTTCCTGG + Intergenic
958160458 3:89811853-89811875 AGGTCTCCTTCCCTGCTCTCTGG - Intergenic
959372648 3:105547746-105547768 AATGGTTCTTCCCTTCTCCATGG - Intronic
960379245 3:116939435-116939457 AAGGCAGCTACACTTCTCCCTGG + Intronic
962318035 3:134370932-134370954 ACGGCTCCTTCAGTTGTCCCTGG - Exonic
964235728 3:154524530-154524552 GAGGCTACTTCCCTGCTCCAAGG - Intergenic
965638707 3:170810932-170810954 AAATCTCCTTCCCTTTTCTCTGG - Intronic
966631321 3:182078449-182078471 AAGGCTCCTTCCCGCATCACTGG - Intergenic
966748197 3:183297982-183298004 AAGGGACATGCCCTTCTCCCAGG - Intronic
967694362 3:192514604-192514626 ATGCCCCCTTCCCTTCTTCCGGG - Intronic
967987468 3:195106449-195106471 CTTGCCCCTTCCCTTCTCCCGGG + Intronic
968230574 3:197002849-197002871 AAGGCTTCTCCCCGTCGCCCCGG + Exonic
969027519 4:4185602-4185624 ATGGCTCCTTTTCTTCTCCTTGG + Intergenic
969305728 4:6325363-6325385 CATGCTGCTTCCCTTGTCCCAGG - Intronic
970583521 4:17494270-17494292 CAGGCTCCTGCCCTTCAGCCTGG + Intronic
971546103 4:27889743-27889765 AATGCTCCTTTTCTTTTCCCAGG + Intergenic
974549011 4:63348845-63348867 CAGGCTCCTGCCCTGCTCACAGG - Intergenic
975050898 4:69863542-69863564 TTGGGTTCTTCCCTTCTCCCAGG + Intergenic
975709581 4:77146959-77146981 GAGGCTCCTTCTTTTCTGCCTGG - Intergenic
975746934 4:77484098-77484120 AAGTTTCCTTCCCTTCTACAGGG + Intergenic
976178012 4:82373825-82373847 AAGGCTCCTGCGCCTCTCCCTGG + Exonic
976744391 4:88389009-88389031 AAGACTCCTTTCCTCCACCCAGG - Intronic
977767018 4:100810882-100810904 AAGCCTCCATCCTTTCTCACAGG + Intronic
978022780 4:103834223-103834245 TTGGCACCTTGCCTTCTCCCTGG + Intergenic
980854654 4:138424811-138424833 AAGGCTCTTTCTGATCTCCCTGG + Intergenic
984771055 4:183436470-183436492 GAGCATCCATCCCTTCTCCCTGG + Intergenic
984901947 4:184593215-184593237 AAGGCTCATTTACTTCTCGCGGG - Intergenic
985731305 5:1550523-1550545 TAGGCTCCCTGCCTTTTCCCTGG + Intergenic
986446320 5:7824583-7824605 GGGGCTCCTGCCCTCCTCCCAGG + Intronic
987100686 5:14588898-14588920 AAGGCTCATTCCATCGTCCCTGG - Intronic
987367047 5:17158263-17158285 GAGGCTCCTTCATTTCTTCCTGG + Intronic
988606720 5:32684832-32684854 AAGGCACCAGCCATTCTCCCAGG - Intergenic
990720248 5:58686870-58686892 AAGGCTTCTACCCTCCTCCAAGG - Intronic
992257302 5:74933953-74933975 GAGGCTCCTTGACTTCTCCTAGG + Intergenic
993754497 5:91711072-91711094 AAGACTCCCTTCCTCCTCCCAGG - Intergenic
995374543 5:111459195-111459217 AATGTTCCTTCTCTTCTCTCTGG - Intronic
996370440 5:122747317-122747339 AAGGGTCCATCCTTTCTTCCTGG + Intergenic
997718555 5:136060083-136060105 AAGGCTCTTTCCATTTTGCCTGG - Intronic
997750777 5:136343452-136343474 AAGGGTCCTTCCCTATTCCTTGG + Intronic
998044338 5:138974212-138974234 AAGGCTGCCTTCCCTCTCCCTGG - Intronic
999751382 5:154630518-154630540 AATGCTCTTCCCATTCTCCCAGG + Intergenic
1000126877 5:158254054-158254076 ATCCCTCCTTTCCTTCTCCCAGG - Intergenic
1001098367 5:168794014-168794036 AAGCCAACTTCCCATCTCCCTGG - Intronic
1001310084 5:170604182-170604204 ATGGAACCCTCCCTTCTCCCCGG - Intronic
1001423732 5:171609184-171609206 ATGGCTCCTTCCCATCTTTCAGG + Intergenic
1001515209 5:172350627-172350649 AAGGCTTCTTCCCTTGGGCCTGG - Intronic
1003018894 6:2492798-2492820 AAAGTTCCGTGCCTTCTCCCTGG + Intergenic
1003780804 6:9423514-9423536 AAGAATCCTTTCCTACTCCCTGG - Intergenic
1005717191 6:28561091-28561113 AATTCTCCTGCCCTTCTCCTGGG - Intergenic
1006154606 6:32007492-32007514 AAGGCTCCTTCCCAGCAACCTGG + Intergenic
1006160918 6:32040227-32040249 AAGGCTCCTTCCCAGCAACCTGG + Intronic
1006316821 6:33296325-33296347 TTGGCTGATTCCCTTCTCCCAGG - Exonic
1006367630 6:33624794-33624816 ATGCCCCCTTCCCATCTCCCAGG - Intronic
1006734981 6:36267260-36267282 AAGGTTCCTTTCATTCGCCCTGG - Intronic
1006933363 6:37700573-37700595 AGGGCTCTTTCCCTTCTCTGAGG - Intergenic
1007280775 6:40710679-40710701 AAGCCTCTTTCCCTTTTCACTGG - Intergenic
1007575700 6:42924199-42924221 AAGACTCATTCGCTTCTCCCTGG + Intronic
1007610796 6:43147552-43147574 AAGGCTCTGCCCTTTCTCCCAGG + Intronic
1007818466 6:44541887-44541909 AAGGGTCCTCCCTCTCTCCCTGG - Intergenic
1007943480 6:45804024-45804046 AAGGGTCCATCCTTTCTTCCTGG + Intergenic
1009417452 6:63431349-63431371 AATGCTCTTTCTCTTCTGCCTGG - Intergenic
1010449515 6:75987256-75987278 AACGATCCTTCCCATCTTCCTGG - Intronic
1012436468 6:99220048-99220070 CAGGCTACTTCCTTGCTCCCTGG + Intergenic
1013063787 6:106662822-106662844 AATGCCCATTCCCTTCCCCCTGG - Intronic
1013481196 6:110554215-110554237 CAAGCTCCTTCTTTTCTCCCAGG - Intergenic
1015718530 6:136216407-136216429 AATGCTCCTTCCAGTCTGCCGGG - Intergenic
1016834806 6:148466467-148466489 AAGCCTCCCTCCCCTCTCTCTGG + Intronic
1017667760 6:156738144-156738166 AAGCCTCCCTTCCTTCTACCAGG + Intergenic
1017784789 6:157746642-157746664 AAGGCTCCTTCCTCTCTTTCCGG - Intronic
1019337362 7:491715-491737 GAGGCTGCTCCCGTTCTCCCTGG - Intergenic
1020044428 7:5030618-5030640 ATGGCTCCTCTCCTTCTTCCTGG + Intronic
1022111804 7:27236532-27236554 AAAGCCCCTTCCCCTCTCCTGGG - Intergenic
1022353591 7:29588996-29589018 CAGGCTTCTTCCCCTCTCACTGG - Intergenic
1022746336 7:33176071-33176093 AAGTCTCCCTCCCTTGTACCAGG - Intronic
1023631833 7:42172686-42172708 AAAACTCATCCCCTTCTCCCAGG - Intronic
1024536776 7:50441581-50441603 AAGACTCCCTCCATTCACCCAGG + Intergenic
1024589713 7:50870819-50870841 AAGGCTTCCTCCCTTCACTCTGG - Intergenic
1024929699 7:54657270-54657292 AAGACTCCTCCCCTTCTGGCTGG + Intergenic
1027131837 7:75596807-75596829 AGGGCCCCTTCCCTCCTCCCAGG + Intronic
1028504555 7:91556944-91556966 CAGGCTCCTTGTCCTCTCCCAGG + Intergenic
1028567052 7:92245632-92245654 ATTCCTCCTTCCCTCCTCCCAGG + Intronic
1028896631 7:96048667-96048689 AGGGACCCTTCCTTTCTCCCAGG + Intronic
1029345417 7:99975378-99975400 CAGCCTCCTTCCCTTATCCTAGG + Intronic
1029514925 7:101018345-101018367 AGGACTCCCTCCCTTCTCCTGGG + Intronic
1029941422 7:104484439-104484461 AAGGCTTTTGACCTTCTCCCGGG - Intronic
1032198011 7:129800354-129800376 GAGGCTGCTTCCCAGCTCCCTGG - Intergenic
1032792777 7:135254628-135254650 AGGGCTTCTCCCCTTGTCCCAGG + Intronic
1033241962 7:139687910-139687932 AAGGATCTTTGCCTTCTCTCTGG - Intronic
1034263860 7:149772394-149772416 CAGGCTGCTTCCCAGCTCCCGGG + Intronic
1036496763 8:9277172-9277194 CAGGCTCCTTCCCCTCTGGCAGG + Intergenic
1036682694 8:10886974-10886996 ATGGCTTTTTCCTTTCTCCCAGG - Intergenic
1036710988 8:11078487-11078509 AAGGCTTCTTCCCATCTGCCAGG + Intronic
1037518705 8:19659357-19659379 TGGGCTCCTTCCCTTATCCTAGG + Intronic
1037934275 8:22904164-22904186 CAGGCTGCTTCCCGGCTCCCTGG + Intronic
1038493716 8:27987442-27987464 AGGGCTCCTTCCCCACCCCCAGG + Intronic
1039921173 8:41895730-41895752 AAGGCGCCTTCTCCTCTACCCGG - Intronic
1041798926 8:61776897-61776919 GAGGCACCTTCTTTTCTCCCTGG + Intergenic
1042360823 8:67881088-67881110 AAGGATCCTACCCTTATCTCTGG - Intergenic
1044828287 8:96219863-96219885 AGGGTTCCTTCCCTCCACCCAGG - Intergenic
1046945097 8:119967025-119967047 AAGGGTCCTGCCCTACACCCAGG - Intronic
1047488345 8:125353360-125353382 ACGGCTCCTAGCCTTCTCCTTGG + Intronic
1048786186 8:138052892-138052914 AATGCCCCTTCCATTCTCACTGG + Intergenic
1048816885 8:138342449-138342471 AAAGCACCTTCCCTTTTCTCTGG - Intronic
1049206803 8:141367339-141367361 CAGGCTCCTTCCCCGCCCCCAGG + Intergenic
1049685351 8:143937219-143937241 ACGCATCCTCCCCTTCTCCCGGG + Exonic
1049720439 8:144113079-144113101 CAAGCTCCTTCCTTCCTCCCTGG + Intronic
1052486381 9:29105743-29105765 ATGACTCTTTCCCTTCTTCCAGG - Intergenic
1052860872 9:33437039-33437061 AAGCCTCCTTCCAGTCTCCCTGG + Intergenic
1053158885 9:35799958-35799980 AAGGCCCCTTCCCCTCTCTCTGG - Intronic
1053391418 9:37739171-37739193 CAGGCTCTTCCCCCTCTCCCAGG - Intronic
1055755307 9:79551623-79551645 AAGGCTCTTTCCCTTCCCTTAGG - Intergenic
1056601994 9:88053727-88053749 ATGGCACCTTCCCTCCACCCAGG - Intergenic
1056768038 9:89456984-89457006 AGGGCTCCTTCCTTCCTCACTGG + Intronic
1059639942 9:116206613-116206635 AAGGCACCTCGCCTTCCCCCAGG + Intronic
1061131912 9:128713196-128713218 GAAGCTCCTTCCCTACTCACTGG - Exonic
1061416065 9:130447557-130447579 AGGCCACCTTCCCTCCTCCCAGG + Intronic
1062447760 9:136602755-136602777 ATGGCTCCTGCCCTTTTCCCAGG - Intergenic
1185517958 X:715230-715252 AGGGTTCCTTCCCTCCTCCCTGG + Intergenic
1185517988 X:715335-715357 AGGGATCCTTCCCTCCTCCCTGG + Intergenic
1186270408 X:7880622-7880644 TGAGCTCTTTCCCTTCTCCCAGG - Intergenic
1187018082 X:15350420-15350442 AAGGCTACATCCCCTCTCCAAGG + Intronic
1188311668 X:28624930-28624952 AAGGTTCCTCACCTTCTCCATGG + Intronic
1188734369 X:33694451-33694473 ACTGCTCCTTACCCTCTCCCTGG - Intergenic
1189775245 X:44464742-44464764 AGGGCTCCTTCCCCTCTCACTGG + Intergenic
1190108625 X:47575274-47575296 ACGGATCCTTTCCTTCCCCCAGG - Exonic
1190221209 X:48513514-48513536 ATGGCCCCTCCCCTACTCCCTGG + Intronic
1190641011 X:52482737-52482759 AACCCTCCATCCCTACTCCCTGG + Intergenic
1190646661 X:52530128-52530150 AACCCTCCATCCCTACTCCCTGG - Intergenic
1192322783 X:70105443-70105465 AAGCCCCCTTCCCATCTCCATGG - Intergenic
1192589856 X:72350862-72350884 TAGCCTCCTTCCCTTCCCCAAGG - Intronic
1192617523 X:72643147-72643169 CAGTCTCCTTCCCTTTTCTCTGG - Intronic
1193925902 X:87484180-87484202 AAGTCTCCTTCCCTTCTCTGGGG + Intergenic
1196734735 X:118974058-118974080 TGGGTTCCTTGCCTTCTCCCAGG - Intergenic
1198022967 X:132677318-132677340 GAGGCTCATTTCCTCCTCCCTGG + Intronic
1199980750 X:152919109-152919131 CAGGCTCCTGCCCTGCCCCCCGG - Intronic
1200069827 X:153522691-153522713 GAGGCCCTTTCCCTCCTCCCTGG - Intronic
1200149260 X:153943326-153943348 AAAGGCCCTTCCCTCCTCCCTGG - Intronic
1200983843 Y:9286233-9286255 AAGTCTCCATTCCTCCTCCCAGG + Intergenic
1202152388 Y:21855390-21855412 AAGTCTCCATTCCTCCTCCCGGG + Intergenic