ID: 1084711136

View in Genome Browser
Species Human (GRCh38)
Location 11:70844397-70844419
Sequence AGAATGCTGGCTGTGAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 355}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084711136_1084711142 4 Left 1084711136 11:70844397-70844419 CCAGCCTTCACAGCCAGCATTCT 0: 1
1: 0
2: 4
3: 24
4: 355
Right 1084711142 11:70844424-70844446 AAGGGGATCATCTAAAACGCTGG 0: 1
1: 0
2: 0
3: 7
4: 75
1084711136_1084711143 5 Left 1084711136 11:70844397-70844419 CCAGCCTTCACAGCCAGCATTCT 0: 1
1: 0
2: 4
3: 24
4: 355
Right 1084711143 11:70844425-70844447 AGGGGATCATCTAAAACGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084711136 Original CRISPR AGAATGCTGGCTGTGAAGGC TGG (reversed) Intronic
900768837 1:4524540-4524562 AGAATGTTGACTGTGAGGGTGGG - Intergenic
901325109 1:8360930-8360952 AGCCTGCAGGCTGTGAGGGCCGG + Exonic
902309826 1:15573510-15573532 TCATTGCTGGCTGTGAAGTCGGG - Exonic
903529018 1:24015342-24015364 AGAATCCTGGATTTGAAGTCAGG - Intergenic
903999940 1:27333169-27333191 GGAATGCTGGCAGCTAAGGCTGG - Intronic
904121138 1:28198604-28198626 AGAATGCCTGCTGGAAAGGCCGG - Intergenic
904606400 1:31700238-31700260 AGAAGGCAGGTGGTGAAGGCAGG - Intronic
905224032 1:36467681-36467703 AGAATGCATGTTGGGAAGGCTGG + Intronic
905416870 1:37809490-37809512 AGACTGATGGCTGGGAAGGGGGG + Intergenic
906423240 1:45687929-45687951 AGAATGATGGTGGTGAAGGAAGG - Exonic
906865476 1:49413790-49413812 AGAATGCTGACTTTGAAATCGGG + Intronic
907084978 1:51663383-51663405 TGTATGTTGGCTGAGAAGGCAGG - Intronic
908365677 1:63421015-63421037 AGAATGATAGCTAAGAAGGCAGG - Intronic
909204724 1:72740971-72740993 AGAATGCTGGTTTTGACAGCAGG - Intergenic
910863047 1:91762096-91762118 ACCATGCAAGCTGTGAAGGCTGG + Intronic
912729531 1:112090050-112090072 AGAATCCTGGCAGAGAAGTCAGG + Intergenic
913243603 1:116852071-116852093 AGAATGCAGGCTTTGGAGTCAGG + Intergenic
913533019 1:119746575-119746597 AGAAGGCTGGCTGTGAGCTCAGG + Intergenic
914713232 1:150234189-150234211 AGAATCCTGGCGGGGGAGGCGGG + Intronic
915449958 1:155997896-155997918 AAAAAGCTGGCTGGGCAGGCTGG - Intronic
916170133 1:161995739-161995761 AGAATGCTAACAGTGAAGACAGG - Intronic
916607305 1:166355710-166355732 AGGATGCAGGATATGAAGGCAGG + Intergenic
916804343 1:168243949-168243971 GGAATGCTGGCTGACAAGACAGG - Exonic
917528093 1:175807459-175807481 AGAATTATGGCTCTGAAGGCAGG - Intergenic
918181280 1:182087530-182087552 AGAATGCTGGTAGTGCATGCAGG - Intergenic
918237699 1:182596732-182596754 AGAATGAAGGCTGTCCAGGCAGG + Intergenic
921286625 1:213615387-213615409 AGATTGCAGGCACTGAAGGCTGG - Intergenic
923690144 1:236184703-236184725 AGAATGCTTGGTTTGAAGCCTGG - Intronic
924087658 1:240469703-240469725 AGGATCCTGGGTGGGAAGGCTGG - Intronic
924265109 1:242273831-242273853 AAGATGCTGGCCTTGAAGGCTGG + Intronic
1063392860 10:5661429-5661451 AGCATGCTGGCTTTGAATCCAGG + Intronic
1063888891 10:10608639-10608661 GGAATGCTGTCTGTGAGGTCAGG - Intergenic
1064335041 10:14432423-14432445 AGGAAGCTGGCTGAGAAAGCTGG + Intronic
1064413693 10:15130417-15130439 AGAATGCAGGCTGGGAACACTGG + Intronic
1066456737 10:35578795-35578817 AGAATGCTGACTCAGGAGGCAGG + Intergenic
1066719703 10:38324659-38324681 AAGATGCTGGCCTTGAAGGCTGG - Intergenic
1067071513 10:43136184-43136206 TGAATGCTGGCTGGTGAGGCTGG + Intergenic
1067152795 10:43750441-43750463 AGAATGGTGGTTGTCAGGGCTGG - Intergenic
1067746395 10:48939474-48939496 AGAGCTCTGGCTGTGAAGTCAGG - Intronic
1067975497 10:51020486-51020508 AGAATGTAAGCTGTGAAGGCAGG - Intronic
1068210739 10:53916875-53916897 AGATTCCTGGCTCTCAAGGCAGG + Intronic
1069174254 10:65270855-65270877 AAACTGCTGACTCTGAAGGCAGG - Intergenic
1069408871 10:68131672-68131694 AGAATACCGCCTATGAAGGCTGG - Intronic
1069633392 10:69911154-69911176 AGAATGAAGGCTGAGATGGCTGG - Intronic
1069750256 10:70740938-70740960 ACCTTGCTGGCTGGGAAGGCTGG - Intronic
1069963821 10:72096883-72096905 AGAATGGTGGCTGCGGGGGCTGG + Exonic
1070215501 10:74375519-74375541 AAAATGCTGATTGTGAAGACAGG - Intronic
1071160809 10:82743144-82743166 ATATTCCTGGCTGTGATGGCAGG + Intronic
1072126690 10:92451679-92451701 ACAATGCTGACTGTGCGGGCTGG + Exonic
1072794242 10:98342229-98342251 AGAATGCAGGCGGGGGAGGCAGG - Intergenic
1073581417 10:104669414-104669436 AGAATGATGGTTGTCAGGGCTGG - Intronic
1073801593 10:107047274-107047296 AGAATGCTGGCTGGGCATGGTGG - Intronic
1074133889 10:110610147-110610169 ACAATGATGGCGGTAAAGGCTGG + Intergenic
1074298642 10:112213526-112213548 AGACTGACAGCTGTGAAGGCAGG - Intronic
1074571825 10:114631579-114631601 AGAATGATGGCTGGGATGGGGGG + Intronic
1074980921 10:118619503-118619525 AGAAGGCAGGCTGGGGAGGCAGG + Intergenic
1075674327 10:124285755-124285777 AAAATGATGGCTGTCAGGGCTGG + Intergenic
1075789626 10:125074501-125074523 AAATTGCTGGGTGTGATGGCGGG - Intronic
1075879743 10:125840574-125840596 AGCAAGCTTGCTCTGAAGGCTGG + Intronic
1076243251 10:128926379-128926401 AGAATGCTGGCTTTGACTGCAGG - Intergenic
1077699345 11:4426057-4426079 AGAAACCTGGGTGTGAAGGGGGG - Intergenic
1078142603 11:8702928-8702950 AGAGGGCTGCCTGTGAAAGCGGG + Intronic
1079431600 11:20394977-20394999 AGAACGTGGGCTGGGAAGGCAGG + Intronic
1079521995 11:21339227-21339249 GGAATTCTCCCTGTGAAGGCAGG + Intronic
1079879167 11:25903088-25903110 AGAATGATGGCTGCCAGGGCTGG - Intergenic
1082769351 11:57194489-57194511 AGAAGGCTGGCTGTTGAAGCTGG - Intergenic
1083610972 11:64004150-64004172 TGAATGCTGGCCGTGGAGGCTGG - Intronic
1083953891 11:65971800-65971822 AGAATGATGGGTGTGAGGACAGG + Intronic
1084700400 11:70783168-70783190 AAAATGCTGGTTCTGGAGGCTGG - Intronic
1084711136 11:70844397-70844419 AGAATGCTGGCTGTGAAGGCTGG - Intronic
1085004500 11:73073053-73073075 AGAATGCTGCTAGTGAAGGAAGG - Intronic
1086496321 11:87407681-87407703 AGAATACTGGCTTTGAATCCTGG + Intergenic
1087108777 11:94440080-94440102 AGAATGCAGGCTCTGGAGTCAGG - Intronic
1090804918 11:130196876-130196898 AGCAGGCTGGCTGTGAGCGCTGG + Intronic
1091038376 11:132254261-132254283 AGAATGCTGGGGATGAAGACGGG - Intronic
1091565769 12:1646875-1646897 AGAATTCTCGCTGGAAAGGCAGG - Exonic
1093459681 12:19396827-19396849 AGAAAGATGGCTTTCAAGGCTGG + Intergenic
1094163429 12:27417457-27417479 AGAATGCAGGCTTTGGAGTCAGG + Intronic
1094747268 12:33359113-33359135 AGAATGCCAGTTGTGAAGGAAGG - Intergenic
1095632764 12:44397851-44397873 AGAATCCTGGCTGGCAAGGCTGG - Intergenic
1096483012 12:51955177-51955199 AGAATGGTGACTGTGAACACAGG + Intronic
1099829465 12:87821932-87821954 AGGGTGCTGGAAGTGAAGGCAGG + Intergenic
1099878295 12:88436216-88436238 AGAAAGCTGGCAAGGAAGGCAGG - Intergenic
1101784171 12:107867522-107867544 AGAATGGTGGTTGTGAGGGTCGG - Intergenic
1101841636 12:108331744-108331766 CGGTTGCTGGCTTTGAAGGCTGG + Intronic
1102715279 12:114965686-114965708 AGAATGCTGGCTGCCCAAGCTGG - Intergenic
1102863221 12:116354288-116354310 TGAATGCTGGCTGTGCAGCTGGG - Intergenic
1103121556 12:118384535-118384557 AGAGTGCAGGCTGTGAGGCCAGG + Intronic
1103306953 12:119972813-119972835 AGAATGGTGGTTGTCAGGGCTGG + Intergenic
1103507672 12:121452777-121452799 AGACTTCTGACTCTGAAGGCAGG + Intronic
1103747214 12:123133347-123133369 AGAATGCTGGCTGTAGAGTCAGG + Intronic
1105250776 13:18697431-18697453 AGAGGGCTGGCTCTGTAGGCCGG - Intergenic
1105815581 13:24033437-24033459 GGAATGCTGGCTGTGCAGAGAGG + Intronic
1105829960 13:24155430-24155452 AGAATACTGCTTGTGAAGGATGG + Intronic
1106594439 13:31124454-31124476 AGGATGCTGGCTGCAGAGGCAGG - Intergenic
1107246136 13:38296939-38296961 AGAATGATGGCTGCCAGGGCTGG + Intergenic
1107806873 13:44161519-44161541 AGAATGCTGGCTTTGGATTCTGG - Intergenic
1108587813 13:51886077-51886099 AGAATGATGGGTGTGATGGAAGG - Intergenic
1110749357 13:79094800-79094822 AGAAAGCTGTCTCTGAGGGCAGG - Intergenic
1111582544 13:90242303-90242325 AGAGTGCAGGATGTGAAGCCAGG + Intergenic
1111762029 13:92478473-92478495 ATAATGATCGCTGTGATGGCAGG - Intronic
1113586945 13:111472206-111472228 AGAATCCTGTGTGTCAAGGCAGG - Intergenic
1113878352 13:113608415-113608437 AGAGCCCTGGCTGTGCAGGCGGG + Intronic
1114069393 14:19095786-19095808 AGAAAGCTGGCTGTTGAGGTGGG + Intergenic
1114092868 14:19304216-19304238 AGAAAGCTGGCTGTTGAGGTGGG - Intergenic
1114994731 14:28333942-28333964 AGACTGCTGGGTGTGATTGCGGG - Intergenic
1115401265 14:32963471-32963493 AAAGTGCTGGCTGTGAGGGGAGG + Intronic
1115662518 14:35511307-35511329 AGAAAGCTGGGTGTGATGGCTGG - Intergenic
1115713799 14:36079864-36079886 AGAATGCATGCTGTCAAGGAGGG + Intergenic
1115891779 14:38038473-38038495 AGAATGCTTTCTGTGATAGCTGG + Intronic
1116756544 14:48955725-48955747 GGATAGCTGGCTGTGATGGCAGG - Intergenic
1118172773 14:63405073-63405095 AGGAAGCTGGCTCTGAATGCAGG + Intronic
1119203425 14:72776327-72776349 AGAATGCTGTCTGGGGAGCCTGG - Intronic
1120009323 14:79395511-79395533 AAAATGCAGGCTGTGAGGCCGGG + Intronic
1120857929 14:89228968-89228990 AGCATGCTGGCTGTAAAAACGGG + Intronic
1120918023 14:89727302-89727324 AGCATGCTACCCGTGAAGGCAGG - Intergenic
1121010652 14:90518249-90518271 AAACTGCTGGCTGGGCAGGCAGG + Intergenic
1121473770 14:94175222-94175244 AGAGTGCTGGCTGGGAAGCGAGG - Intronic
1121798107 14:96752412-96752434 TGAATGCTTGTTCTGAAGGCAGG + Intergenic
1121942079 14:98080604-98080626 AAAATGCTGGCTCTGAATGAGGG + Intergenic
1122367359 14:101202016-101202038 TCATTGCTGGCTTTGAAGGCGGG - Intergenic
1123448665 15:20346768-20346790 AGAATGGTGGCTGAGCAGGAGGG - Intergenic
1125457773 15:39878287-39878309 AGAATGATGGCTGTCAGGGGTGG - Intronic
1126531126 15:49712257-49712279 ATAATGCTGGCTGTGAGGGTTGG + Intergenic
1128734350 15:70044350-70044372 AGGATTCTGGCTGAGCAGGCTGG - Intergenic
1128812288 15:70581292-70581314 AGAATCCTGGGTTTGAAGGATGG - Intergenic
1129386191 15:75197369-75197391 AGAAAGCTCTCTGTGGAGGCAGG + Intronic
1129761241 15:78130510-78130532 GGAAAGCTGGCTCTGGAGGCAGG + Intronic
1130004365 15:80080291-80080313 AGAAAACTGGTTGTGTAGGCCGG - Intronic
1130117002 15:81014156-81014178 AGGATGCTGGCTGTGCAGCTGGG - Intronic
1130486722 15:84402263-84402285 GGATTGCTGGCTGTGGAGACAGG - Intergenic
1131422000 15:92314440-92314462 AAAATGCTGGCTCTGGAGTCAGG - Intergenic
1132279873 15:100603075-100603097 AGAGTGCTGGCTGGGAGGGTAGG + Intronic
1132310565 15:100854460-100854482 AGAATGCTGGCTGTGTGTGCAGG + Intergenic
1132716078 16:1290415-1290437 AGGCTGCTGGCTGTGCGGGCAGG - Intergenic
1133405409 16:5520418-5520440 TGAATGGTGGCTGAGAAGACAGG - Intergenic
1135875828 16:26199213-26199235 AAAATGATGGCTGCGAAGCCTGG - Intergenic
1138641832 16:58393679-58393701 AGAAAGCTGGGTGTGGTGGCCGG + Intronic
1140485490 16:75290050-75290072 GCAATGCTGGCTGAGAAGGTAGG + Intergenic
1140798391 16:78462094-78462116 AGAATGCTGCTCTTGAAGGCAGG + Intronic
1141136706 16:81470342-81470364 AGCCTGCTGGCTGTGGTGGCTGG + Intronic
1141724379 16:85777432-85777454 AGATGGCTGGCTCTAAAGGCAGG + Intronic
1141770572 16:86087307-86087329 AGACTGCTGGCGGTGAAGGGTGG + Intergenic
1141901809 16:86996034-86996056 AGAAGGATGGTTGGGAAGGCTGG - Intergenic
1142096123 16:88240872-88240894 AGAGGGCTGGCGGTGCAGGCTGG - Intergenic
1142720367 17:1771747-1771769 AAGATGCTGGCTGGGAAGTCAGG + Intronic
1143600999 17:7945921-7945943 AGAATGCTGGCTCTGAAAAGAGG - Exonic
1145905702 17:28514959-28514981 AGCATGCTGGCTTTGAAGCCCGG + Intronic
1146016903 17:29241168-29241190 AGCAAGCAGGCTGTGGAGGCTGG + Intergenic
1146064940 17:29627005-29627027 AGAGTGCTGGATGGGAGGGCAGG + Exonic
1146188582 17:30745331-30745353 AAAAGGCTGGGTGTGATGGCAGG - Intergenic
1147023879 17:37563830-37563852 AAAAAGCTGGCGGGGAAGGCTGG - Intronic
1147047951 17:37768675-37768697 AGAATGTTGTCTGTGAAGGCAGG - Intergenic
1147225019 17:38969707-38969729 AGAATGGTGGCTCTGAGGGATGG + Intergenic
1148666147 17:49376505-49376527 TGACTGCTGGCTTTGAAGGTGGG + Intronic
1148872534 17:50667299-50667321 AGGATGCTGCCTGGGGAGGCCGG + Intronic
1150665407 17:67131233-67131255 AGCATTTTGGCTGTGAAAGCTGG - Intronic
1150667538 17:67156398-67156420 AGAAGCCTGGCTGTGAAAGGAGG - Intronic
1152211733 17:79006045-79006067 AGCGTGCTGTCTGTGGAGGCAGG - Intronic
1152301894 17:79499754-79499776 AGAATGCTTGCTCTGGTGGCAGG + Intronic
1152985211 18:314721-314743 ACAATCCCGGCTATGAAGGCAGG + Intergenic
1152988784 18:343432-343454 AGAATGCTGGCAGTGGAGAAGGG - Intronic
1153447997 18:5195920-5195942 AGAATGCTAGCTGGGGAGGGAGG - Intronic
1154022218 18:10674184-10674206 AGAATGTTGGTTCTGAAGTCAGG + Intronic
1154438074 18:14361495-14361517 AGGGTGCTGGCTCTGTAGGCCGG + Intergenic
1156401828 18:36746175-36746197 AGAGTGCTGGCTGTGTATTCAGG - Intronic
1156680377 18:39581292-39581314 TCAATGCTGGCTGTGCAGGAAGG + Intergenic
1157712997 18:49862900-49862922 AGGATGCTGGCTGGGGAGGGGGG - Intronic
1158841752 18:61395189-61395211 AGAATGCAGGCTCTGGAGCCAGG + Intronic
1159015404 18:63098307-63098329 AGGATGACGGCTGTGAAGACAGG - Intergenic
1159874456 18:73794778-73794800 TGCATGCTGGTTGTGAAGCCAGG - Intergenic
1160571388 18:79819626-79819648 AGCCTGCTGGCTGTGAGGCCTGG - Intergenic
1161381437 19:3967153-3967175 AAAATGCGGGCTGGGAAGCCGGG + Intronic
1163471505 19:17500073-17500095 TGAATGCAGGCTGGGAAGGTGGG + Intronic
1165529472 19:36386134-36386156 TGAATGCTGTCTGTGATGGAAGG - Intronic
1167582750 19:50356061-50356083 AGGATGCTGGCTTTGAAGAAGGG - Intronic
1168676381 19:58280845-58280867 ACAATGCAGGCTTTGAAGACAGG - Intronic
925296293 2:2779770-2779792 AGGATGCAGGGTGTGAAGCCTGG - Intergenic
925296391 2:2780205-2780227 AGAGTGCAGGGTGTGAAGCCTGG - Intergenic
925584399 2:5449128-5449150 AGAATGCTGGATTTCAAGGGAGG + Intergenic
925738662 2:6986134-6986156 AGGATGCTGGCTGGGACAGCTGG - Intronic
925845668 2:8031136-8031158 AGAATGTTGGAGGTGAAAGCAGG + Intergenic
926561034 2:14417781-14417803 AGAATGCTGGTTTTCAAGTCTGG - Intergenic
928312411 2:30221798-30221820 AGAAGGCAGGCTGCGAAGGTGGG + Intergenic
928363550 2:30684861-30684883 AGCATGCTGACTATGAATGCAGG - Intergenic
928438691 2:31273360-31273382 ATCATGATGGCTGGGAAGGCAGG - Intergenic
928477631 2:31646674-31646696 AGTATGCTGGCTATGACTGCTGG - Intergenic
929086625 2:38174177-38174199 AGAATGGTGGTTGTCAGGGCTGG + Intergenic
929906490 2:46050621-46050643 CCAGTGCTGGCTGGGAAGGCAGG - Intronic
931579624 2:63759125-63759147 AGAAGGCATGCTGGGAAGGCAGG + Intronic
932297959 2:70642467-70642489 AGTCTGCTGGCTGCAAAGGCAGG + Intronic
933217267 2:79644597-79644619 AGGATGCTGGCTGTAAAGCTGGG - Intronic
933915562 2:86989173-86989195 AGAATGCTGGCTGTTAAAAATGG - Intronic
934007431 2:87780729-87780751 AGAATGCTGGCTGTTAAAAATGG + Intronic
934698306 2:96416466-96416488 AGGATGCTGGATGAGAAGCCTGG - Intergenic
934880518 2:97972814-97972836 ATGCTGCTGGCTTTGAAGGCAGG + Intronic
935646173 2:105337219-105337241 AGAATTCTGGCTCCGAGGGCCGG - Intergenic
935771072 2:106421642-106421664 AGAATGCTGGCTGTTAAAAACGG + Intronic
935909008 2:107874293-107874315 AGAATGCTGGCTGTTAAAAACGG - Intronic
935995688 2:108769747-108769769 AGAATGCTGGCTGTTAAAAACGG - Intronic
936130789 2:109839421-109839443 AGAATGCTGGCTGTTAAAAATGG - Intronic
936213908 2:110532064-110532086 AGAATGCTGGCTGTTAAAAATGG + Intronic
936423045 2:112386624-112386646 AGAATGCTGGCTGTTAAAAATGG + Intronic
937246538 2:120497539-120497561 ACAATGCAGGCTGTGAAGGAAGG - Intergenic
940308800 2:152255083-152255105 AGAATGCTGACAGTGAGGGTGGG + Intergenic
941870339 2:170377696-170377718 AGTATGTTGGCTGCCAAGGCTGG - Intronic
942487172 2:176451975-176451997 AGCATCCTGTGTGTGAAGGCTGG + Intergenic
943266649 2:185740039-185740061 ACAATGCTGGATGGAAAGGCTGG - Intronic
944175194 2:196821102-196821124 ACAATGCTGGCCTTGAGGGCTGG + Intergenic
944443503 2:199765888-199765910 AGAAAGCAGGGTGTCAAGGCAGG - Intronic
946091524 2:217229082-217229104 AGAATGCATGTTGTGTAGGCAGG + Intergenic
946174294 2:217913133-217913155 AGGATGCTGGCAGTGGAGCCTGG + Intronic
946236557 2:218327836-218327858 AGAGTGGTGGCAGTGGAGGCAGG - Intronic
946302640 2:218833220-218833242 AGGAAGAGGGCTGTGAAGGCTGG + Intergenic
946788655 2:223275734-223275756 ACAATACTGGCTTTGAAAGCTGG + Intergenic
946920388 2:224574981-224575003 AGAATCTTGGCTGTGAAAGGAGG + Intronic
947500028 2:230664960-230664982 AGGGTGGTGGCTGTGGAGGCGGG - Intergenic
947681895 2:232041545-232041567 AGAATTCTGGCTCTCAAGGCTGG - Intronic
948404019 2:237704033-237704055 AGAGCGCTGACTGTGCAGGCAGG - Intronic
948732567 2:239976389-239976411 AGGAGGATGGCTGTGAAGGCCGG - Intronic
948783635 2:240339972-240339994 AGAATCCTGGCTCTGGAAGCTGG - Intergenic
1169001440 20:2170830-2170852 AGAATGCTGGCTCTGGAGACAGG - Intronic
1169021923 20:2336568-2336590 AGGATGCTGGCTCTGATGCCGGG + Intronic
1170783967 20:19451629-19451651 TGAATGTTGGCTGCAAAGGCAGG + Intronic
1171159802 20:22910874-22910896 AGCATGCTGGCTGGCAAGGCTGG - Intergenic
1172032477 20:31991525-31991547 AGAAAGCTTGCTGTGGAGGCTGG - Intronic
1173732163 20:45336617-45336639 AGACTCCTGGCTCTGAAGTCAGG - Intronic
1174169850 20:48609440-48609462 AGAGAGCTGGCTTTGAAGCCTGG + Intergenic
1175140044 20:56854219-56854241 AGAGTGCTGGCAGGGAAGGAAGG - Intergenic
1178415753 21:32403776-32403798 AGAATGGTGGCTGCCAGGGCTGG + Intergenic
1178613544 21:34109479-34109501 AAAATGCAGGCTGTGAATGATGG - Intronic
1179152193 21:38818502-38818524 AGTACGCTGGGTGTGGAGGCCGG - Exonic
1179489206 21:41729344-41729366 AGACTGGTGGCTGTAAGGGCTGG - Intergenic
1179611928 21:42557585-42557607 AGAGTCCTAGCTGTGAAGCCGGG + Intronic
1179907841 21:44433503-44433525 AGAATGGTGGCTGGCAAGGGCGG + Intronic
1180487864 22:15818349-15818371 AGAAAGCTGGCTGTTGAGGTGGG + Intergenic
1180964590 22:19780285-19780307 AGAATGCTGGCTGCCAGGGGAGG - Intronic
1181677680 22:24467406-24467428 AGAATGCTGGCTGAGGAACCAGG + Intergenic
1181881072 22:25980437-25980459 AGAATCCTGGCAGGGAAAGCTGG + Intronic
1182579765 22:31299722-31299744 AAAATGTAGGCAGTGAAGGCTGG + Intergenic
1183078677 22:35442595-35442617 AGGGTGCTGGCTTTGAAGACGGG - Intergenic
1183227298 22:36559219-36559241 GGAAAGCTGGGTGTGCAGGCTGG + Intergenic
1184029935 22:41886735-41886757 AGAAGTCTGGCTGGGAGGGCCGG + Intronic
1184770440 22:46594084-46594106 AGGATGCTGGGTATCAAGGCTGG - Intronic
1185292261 22:50032990-50033012 AGGGCGCTGGCTTTGAAGGCCGG + Intronic
1185417116 22:50716323-50716345 GGAAAACTGGCTGTGAAGGGGGG - Intergenic
949329500 3:2906155-2906177 AGAATGCTGGTTGTCAGGGTCGG + Intronic
949876387 3:8628642-8628664 AGAAGGCTGGGTGACAAGGCAGG + Intronic
951376089 3:21919719-21919741 AGAATGCTGGTTCTGCAGGATGG - Intronic
951421574 3:22492294-22492316 AGAATGATGACTGTCAGGGCTGG + Intergenic
951562617 3:23983203-23983225 GGAATGCTGTCTGTGAATACAGG + Intergenic
952718249 3:36504197-36504219 AGAATGCTGCATGGGGAGGCAGG + Intronic
955289694 3:57679815-57679837 AAAATACAGGCTGGGAAGGCGGG + Intronic
955333401 3:58065854-58065876 TAAATGCTGGCTGTGAATGGAGG - Intronic
956740036 3:72268557-72268579 TGAATGCAGGATGAGAAGGCAGG + Intergenic
959496982 3:107062963-107062985 ACAGTGCTGGCTTTGAAGGATGG + Intergenic
961021198 3:123508630-123508652 AGAATGCTTGCTGTAAAGCTTGG - Intronic
962731331 3:138286237-138286259 AGAAGTCTGGCTTTGAAGGTTGG - Intronic
963478397 3:145835607-145835629 AGAATTGTGGCTGTGGGGGCTGG - Intergenic
964186753 3:153954852-153954874 ACAATGCTAGCTCTAAAGGCAGG - Intergenic
964950892 3:162291567-162291589 AAAATGCTGGCCGTGGTGGCAGG - Intergenic
965111318 3:164427565-164427587 AGAATGATGGCTTTTATGGCAGG + Intergenic
965518451 3:169647912-169647934 ATAATGCTGGCTGGGACGTCAGG - Intronic
966000464 3:174943471-174943493 TGAATGCTGGCTGTGAATCATGG + Intronic
966716675 3:183019906-183019928 AGACTGCTGTTTTTGAAGGCAGG - Intronic
966819444 3:183913590-183913612 AGCATGCTGGCAGCTAAGGCTGG + Intergenic
966933470 3:184690715-184690737 AGGAGACTGGCTGGGAAGGCTGG - Intergenic
967117657 3:186356277-186356299 AGGAAGCTGGCTGAGAGGGCCGG + Intronic
967122123 3:186391511-186391533 TGGATGCTGGCCTTGAAGGCTGG + Intergenic
968884291 4:3319011-3319033 AGGCTGCTGGCTGGGTAGGCAGG + Intronic
969855327 4:9994642-9994664 ATAATGCTGGCTGAGAAGTGAGG + Intronic
970316306 4:14831513-14831535 AGAATGCTGGCAGGTTAGGCTGG + Intergenic
970953877 4:21787994-21788016 AGAGAGATGGCTTTGAAGGCAGG + Intronic
971070642 4:23087736-23087758 AGAATGGTGGGTGGGATGGCTGG - Intergenic
971351426 4:25859529-25859551 AGCATGCTCCCTGTGAGGGCAGG + Intronic
973581965 4:52352775-52352797 AGGATGCTGGCTGTGCAGGATGG + Intergenic
973720005 4:53713592-53713614 AGAATGCTGGCAGTGGATCCTGG + Intronic
974081721 4:57220823-57220845 AGAAAGCTGTCTGTGAAGCTGGG + Intergenic
975154202 4:71053293-71053315 AGAATGCTGGCTATAAATCCTGG + Intergenic
975405297 4:73981832-73981854 AGAAGCCAGGCTGTGAGGGCTGG - Intronic
976132851 4:81903550-81903572 ATAATGATGGCTAGGAAGGCAGG + Intronic
977121353 4:93105691-93105713 AGACTGCTGGCTTTGAAGATGGG - Intronic
977967947 4:103177404-103177426 AGAATGGTGGCTATGAAACCTGG - Intronic
978046798 4:104139609-104139631 AGAAGGCTGGCTTTGATGTCAGG - Intergenic
979010957 4:115367030-115367052 AGAATACTGGCTTTGAAGGATGG - Intergenic
979559241 4:122083505-122083527 AGGCTGCTGGCTTTGAAGGTGGG + Intergenic
980386395 4:132091581-132091603 AGAATGATGGCTATAATGGCGGG - Intergenic
981055655 4:140358551-140358573 AGAACCCAGGCTGAGAAGGCTGG - Intronic
981441148 4:144783688-144783710 AGAATGCTGGTTATAGAGGCTGG - Intergenic
981791977 4:148548387-148548409 AGAATGGTGGCTGCAAGGGCTGG + Intergenic
981911826 4:149990799-149990821 AGAATGATGGTTGTCAGGGCTGG + Intergenic
982192618 4:152873690-152873712 TGAACTATGGCTGTGAAGGCTGG - Intronic
982268035 4:153558056-153558078 AGAATGCTGGCTGAGCACGGTGG - Intronic
982604907 4:157502921-157502943 AGGTTGCTGTCTGTGTAGGCTGG - Intergenic
983098533 4:163595725-163595747 AGAATAGTGGCTGCCAAGGCTGG + Intronic
983848374 4:172547201-172547223 AGAATGCAGGCCTTGAAGGTGGG + Intronic
985899684 5:2778941-2778963 TGAGAGCTGGCTGTGAATGCAGG - Intergenic
986535906 5:8786812-8786834 AGAATGCTGGCTTAGAAAACTGG - Intergenic
986652828 5:9981231-9981253 GGAAGACTGGCTGTGAAGGATGG + Intergenic
987221984 5:15800206-15800228 AGAATGATGGATATGAAAGCAGG + Intronic
989091679 5:37740550-37740572 AGAATGTTGGTTTTGAGGGCAGG + Intronic
989598494 5:43180346-43180368 AGAGTGCAGTCTGTGAAGTCAGG - Intronic
989603996 5:43226693-43226715 AGCATGATGCCTGTGATGGCAGG + Intronic
990026100 5:51191531-51191553 AGAAGGCTGACTTTGGAGGCAGG - Intergenic
991000688 5:61779755-61779777 AAAATGCTGGGTGTGAATGGAGG + Intergenic
991061765 5:62383537-62383559 AAAAATCTGGCTGTGCAGGCCGG - Intronic
992136985 5:73756016-73756038 AGAATGTGTGCTGTGGAGGCAGG + Intronic
993784290 5:92109437-92109459 AGAATTTTGGCTCTGAAGCCAGG + Intergenic
995421929 5:111977547-111977569 AGAAGGCTGGCTGTGATGGGAGG - Intronic
997481383 5:134187381-134187403 AGATTGCTGAATGTGATGGCAGG + Intronic
997691917 5:135833024-135833046 AGAATGCTGGCTCTGTGGCCAGG - Intergenic
999852733 5:155560308-155560330 AAAATGCTGGATGTTAAGGAAGG + Intergenic
1001090662 5:168737920-168737942 AGAATACTCTCTGTGAAGGTAGG - Intronic
1001259829 5:170218926-170218948 AGATGGCTGGCTGGGTAGGCTGG + Intergenic
1001576089 5:172764782-172764804 AGGATGAAGGCTATGAAGGCAGG - Intergenic
1003873457 6:10418735-10418757 AGAATGGTGGGTGAGGAGGCAGG - Intronic
1004091538 6:12507661-12507683 AGAACACTGGCTTTGAAGGGTGG + Intergenic
1004564982 6:16787915-16787937 AGAATCCTGGCTGTAAAGTAAGG + Intergenic
1005212728 6:23486613-23486635 AGAATGCTGGCTGTCAGGGCTGG + Intergenic
1005715539 6:28543936-28543958 AGAATGCTGCCAGTCAAGGATGG - Intergenic
1006914455 6:37585369-37585391 AGAATCCTGGCAGAGGAGGCAGG - Intergenic
1007055066 6:38874654-38874676 AGAATGCTGGCTGGGCATGGTGG - Intronic
1010497194 6:76549321-76549343 AAAATGCTGGCTGTTAATGTGGG - Intergenic
1011025802 6:82868022-82868044 AGAATGGTGGCTGAGAAGAATGG - Intergenic
1012383936 6:98655088-98655110 AGAATGATGGCTGATAAGGCTGG - Intergenic
1012995051 6:105964579-105964601 AGAATGATGGATGTGAAGTGGGG - Intergenic
1016886609 6:148965072-148965094 AGAACCCAGACTGTGAAGGCAGG - Intronic
1019691904 7:2419879-2419901 AGAATGGTGGTTGTGGGGGCAGG - Intronic
1023711259 7:42995328-42995350 ATAAGGCTGGATGTGATGGCTGG + Intergenic
1024253644 7:47524038-47524060 AGCTTGCTGGCTGTGAATCCTGG - Intronic
1024971136 7:55071534-55071556 ACAATTCTGCCAGTGAAGGCAGG - Intronic
1026576392 7:71574977-71574999 AGGACTCTGGCTGTGTAGGCTGG - Intronic
1026664783 7:72332852-72332874 AGGAAGCTGGCTCTGAAAGCCGG - Intronic
1027400389 7:77799632-77799654 AGAATGCTGGCTGTCAACACTGG - Intronic
1029130659 7:98328205-98328227 GGAAGGCTGGCTGAGGAGGCCGG + Intronic
1029577194 7:101411414-101411436 AGACTGCAGGCTGGGAGGGCAGG + Intronic
1030220415 7:107092893-107092915 AGAATGTTGGCTGCCAGGGCTGG - Intronic
1030448925 7:109684211-109684233 AGAATACTGGGTGTGAAAGGTGG + Intergenic
1030640385 7:111998527-111998549 ACGATGCCGGCTGTTAAGGCAGG + Intronic
1032570226 7:132988252-132988274 AGAATGCAGGCTCTGAAGTTGGG - Intronic
1032619932 7:133518803-133518825 AGAATGATGGCTGTAAGGGGTGG + Intronic
1035444202 7:158928795-158928817 GGAATCCTGGGTGTGAAGGGGGG - Intronic
1035565279 8:636880-636902 AGAAAGTGGGCTGTGCAGGCTGG - Intronic
1037268805 8:17102064-17102086 AGACTGCTGGCTTTGAATCCAGG - Intronic
1038394744 8:27238455-27238477 AGAGTGATGGCTGTGGAGGTCGG - Intronic
1038434753 8:27527560-27527582 AGAATGGTGGCTGCCAGGGCTGG - Intronic
1038464943 8:27753258-27753280 AGACTGCTGGCTTTGAATTCTGG - Intronic
1038573168 8:28680722-28680744 AGAATGGTGGTTGTGAGGACTGG - Intronic
1038712124 8:29957203-29957225 AGAATCTTGGCTGTGTAGGAGGG + Intergenic
1040817208 8:51520681-51520703 AGTTTGTTGGCTGTGAGGGCAGG - Intronic
1041104970 8:54433003-54433025 AGAATGCTGGCTGCCAGGGCTGG + Intergenic
1041207158 8:55510876-55510898 AGAAGGGTGACTGAGAAGGCTGG + Intronic
1041577328 8:59414078-59414100 AGTATGCTGGCTTTTAAGACTGG - Intergenic
1042566767 8:70119204-70119226 AGAAGGGTGACTGTGAGGGCAGG - Intronic
1043164911 8:76891576-76891598 ATAAAGCTGGCCATGAAGGCCGG + Intergenic
1043351091 8:79361729-79361751 AGAATCCTGGCTGGGGATGCAGG + Intergenic
1044071535 8:87766771-87766793 AGAATGGTGGTTGTGAGGGGTGG + Intergenic
1044562296 8:93624988-93625010 CGAATGCCTGCTTTGAAGGCAGG + Intergenic
1045054452 8:98357307-98357329 AGGATGCTGGCCTTGAAGGTGGG + Intergenic
1048570888 8:135654947-135654969 AGAATCCTGGCTGAGAGGACTGG + Intronic
1048601683 8:135924949-135924971 AGAATCTTGGCTCTGTAGGCAGG + Intergenic
1048635820 8:136294129-136294151 TGAATGCAGGCTTCGAAGGCAGG + Intergenic
1048666263 8:136664872-136664894 TACATGCTGGCTGTGAAGACTGG - Intergenic
1049508689 8:143017343-143017365 GGAATGTTGGCGGTGAGGGCAGG - Intergenic
1050937324 9:11414397-11414419 GGCATGCTGGCTGTGCAGGGTGG - Intergenic
1051698366 9:19792557-19792579 AAAATGCTGGGTGTGGTGGCAGG + Intergenic
1055302730 9:74899101-74899123 AGAATGCTGGCTGGGAGTGGTGG - Intergenic
1055336137 9:75235390-75235412 AGAAGGCCGGCTGTGAAGGCTGG - Intergenic
1055993178 9:82129981-82130003 AAAATGCTGGCTGTGAGTGGTGG + Intergenic
1056444193 9:86648868-86648890 AGCATGATGGCAGTGAGGGCAGG - Intergenic
1058631573 9:106993634-106993656 AGAATGCAGGGAGTGAAGGAAGG - Intronic
1059248938 9:112871078-112871100 AGATGGCTGGCTCTGAAGGGAGG + Exonic
1061259337 9:129471142-129471164 AAAATGCTGGCTGAAGAGGCTGG + Intergenic
1185566201 X:1097293-1097315 AGAAAGGTGGGTGTGAGGGCAGG + Intergenic
1189985059 X:46545991-46546013 AGGTTGCTGGCTCTGAAGCCCGG - Intergenic
1190336220 X:49264040-49264062 TGGATGCTGGCTGGGAAGGCAGG + Intronic
1190474811 X:50815381-50815403 AGAAAGCTGGCTGTGAAGGAAGG - Intergenic
1192114290 X:68396047-68396069 AGATTACTGGCGGTGGAGGCTGG + Intronic
1192317782 X:70066032-70066054 GGAATGCTGGCTGGGAAAGGTGG + Intergenic
1193923813 X:87462009-87462031 AGAAAATTGGCTGTGGAGGCTGG - Intergenic
1195013106 X:100752507-100752529 AGAAGGGTGTCTATGAAGGCAGG + Intergenic
1195065739 X:101236699-101236721 AGAATGCAGGCTTTGGAGTCAGG + Intronic
1197895089 X:131304255-131304277 AGAATGTTGGCAGTCAAGGTTGG - Intronic
1198987653 X:142474411-142474433 AGAATACAGGCTTTGGAGGCAGG + Intergenic