ID: 1084711581

View in Genome Browser
Species Human (GRCh38)
Location 11:70847130-70847152
Sequence TGTGGGTCGCAGCACAGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 100}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084711581_1084711586 -4 Left 1084711581 11:70847130-70847152 CCTTGACTGTGCTGCGACCCACA 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1084711586 11:70847149-70847171 CACACCCCAGTACAGGGTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 157
1084711581_1084711594 24 Left 1084711581 11:70847130-70847152 CCTTGACTGTGCTGCGACCCACA 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1084711594 11:70847177-70847199 TGCTAGGGAGACAGAGACACAGG 0: 1
1: 0
2: 3
3: 24
4: 509
1084711581_1084711583 -10 Left 1084711581 11:70847130-70847152 CCTTGACTGTGCTGCGACCCACA 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1084711583 11:70847143-70847165 GCGACCCACACCCCAGTACAGGG 0: 1
1: 0
2: 1
3: 5
4: 87
1084711581_1084711592 9 Left 1084711581 11:70847130-70847152 CCTTGACTGTGCTGCGACCCACA 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1084711592 11:70847162-70847184 AGGGTCCTGGGAGTGTGCTAGGG 0: 1
1: 0
2: 0
3: 14
4: 203
1084711581_1084711587 -3 Left 1084711581 11:70847130-70847152 CCTTGACTGTGCTGCGACCCACA 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1084711587 11:70847150-70847172 ACACCCCAGTACAGGGTCCTGGG 0: 1
1: 0
2: 1
3: 21
4: 210
1084711581_1084711591 8 Left 1084711581 11:70847130-70847152 CCTTGACTGTGCTGCGACCCACA 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1084711591 11:70847161-70847183 CAGGGTCCTGGGAGTGTGCTAGG 0: 1
1: 0
2: 2
3: 47
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084711581 Original CRISPR TGTGGGTCGCAGCACAGTCA AGG (reversed) Intronic
900231241 1:1559387-1559409 TGTGGGTTTCAGGACATTCATGG - Intronic
902989706 1:20178208-20178230 TGTGGGTTGCAGCCCTGCCATGG + Intergenic
905031308 1:34885978-34886000 CGCGGGTCACAGCACAGTCGAGG + Intronic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
906451681 1:45954698-45954720 TGTGGATCTCAGCTGAGTCATGG + Intronic
908403851 1:63794819-63794841 TGTGTATCCCAGCACAGTCCCGG - Intronic
923567451 1:235087130-235087152 TTTGGGTCACAGCCCAGTCGTGG + Intergenic
1064968336 10:21037524-21037546 TGTGGGTCGGGTGACAGTCAGGG + Intronic
1065428100 10:25626745-25626767 TTTGGGTAGATGCACAGTCAGGG - Intergenic
1069081399 10:64092086-64092108 TGTGGGTGGCAGCAGAGACTTGG + Intergenic
1078644574 11:13128603-13128625 TGTGAATCTCAGTACAGTCATGG - Intergenic
1078744923 11:14103426-14103448 TCTGGGTTGCAGGACAGGCAAGG + Intronic
1083791115 11:64986649-64986671 TGTGGATGGCAGCAGAGCCATGG - Intergenic
1083878253 11:65536030-65536052 TGTGGGTGGCAGCAAAGCCCAGG - Exonic
1084564623 11:69921972-69921994 TGAGGGGCCCAGCACAGACAAGG + Intergenic
1084711581 11:70847130-70847152 TGTGGGTCGCAGCACAGTCAAGG - Intronic
1087836228 11:102878061-102878083 TGGGGGTCCCAGCAAAGACATGG - Intergenic
1089680441 11:120116283-120116305 TCTGGTTCACAGCACAGTGAAGG + Intronic
1091372436 11:135072352-135072374 TGTGTGCCACAGCACTGTCAAGG + Intergenic
1095990118 12:48028707-48028729 TGTGGGTCCCTGCCCAGTGAAGG - Intergenic
1102191928 12:110995164-110995186 AGCAGGTGGCAGCACAGTCACGG - Intergenic
1104714986 12:131010760-131010782 TCTGGGGGACAGCACAGTCACGG + Intronic
1107219092 13:37959634-37959656 TCTGGGTTGCAGCACAGAGAGGG - Intergenic
1109529023 13:63615888-63615910 TCAGCGTCACAGCACAGTCAGGG - Intergenic
1111913252 13:94335060-94335082 TTTGGGCCGCAGCACACTCCTGG - Intronic
1113840571 13:113357766-113357788 GGTGAGTCCCAGCACAGGCAAGG + Intronic
1117323640 14:54648358-54648380 TGTGGGTTGAAGTACAGTGAAGG + Intronic
1118056604 14:62085613-62085635 TGTGGGCTGCAGCATAGTTAAGG - Intronic
1118557877 14:67046041-67046063 TCTGGGTCACAGCTGAGTCAAGG - Intronic
1118721617 14:68598583-68598605 TTTGGGTCTCAACACAGTCCCGG - Intronic
1119194579 14:72708112-72708134 TGTGGGTCACAGCCCAGAGAAGG + Intronic
1124568507 15:30838054-30838076 TGTGGTTCTTAGCACAGGCAAGG + Intergenic
1126982404 15:54258981-54259003 TGAGGGTTTCAGCACAGTCAGGG + Intronic
1132511242 16:342642-342664 CGTCTGTCTCAGCACAGTCACGG - Intronic
1133699487 16:8295703-8295725 AGTGGGTCACAGCACAAACAGGG - Intergenic
1138270028 16:55689379-55689401 TCAGGGTCTCAGCTCAGTCATGG + Intronic
1145044561 17:19603088-19603110 AGTTGGTTGTAGCACAGTCAGGG - Intergenic
1145287708 17:21518849-21518871 TCTGGGTCACAGCCAAGTCAAGG - Intergenic
1146321754 17:31852245-31852267 TGTGGGGCACAGCACACCCAAGG + Exonic
1147598363 17:41731199-41731221 TGTGGGTCTCAGGCCAGGCACGG - Intronic
1148072749 17:44917628-44917650 TGTGAGTCCCAGCACAGAGAGGG + Intergenic
1151533942 17:74726649-74726671 GGTGGGTGGGGGCACAGTCATGG + Intronic
1151656137 17:75496891-75496913 TGGGGTTAGCAGTACAGTCAAGG + Intronic
1152684791 17:81688660-81688682 TGAGGGTCGCAGGACACTCCAGG - Intronic
1159523691 18:69560025-69560047 TGTGGGATGCAGTTCAGTCATGG + Intronic
1161171823 19:2815977-2815999 TGTTGGAGGCAGCACAGGCAGGG - Intergenic
1162267399 19:9586990-9587012 TGTGGGTCGCTGCTCAGAAAGGG + Intergenic
1162272292 19:9626093-9626115 TGTGGGTCGCTGCTCAGAAAGGG + Intronic
1162328405 19:10012011-10012033 TGGGGGTCCCAGCACGGTGAGGG - Intergenic
1166225434 19:41392200-41392222 CGTGGGTAGCAGCACAGACATGG - Intronic
924984938 2:262662-262684 TGAGGCTCTCAGCAGAGTCAGGG + Intronic
926133870 2:10323092-10323114 TGGTGGCTGCAGCACAGTCATGG - Intronic
926738347 2:16091200-16091222 TGTGGGTCACTTCACGGTCAAGG + Intergenic
927852902 2:26511072-26511094 TGTGGGTCGCAGCTTCCTCAGGG + Intronic
935252172 2:101273242-101273264 TGCGGAGAGCAGCACAGTCACGG + Intronic
936345029 2:111669027-111669049 TGTGGGTCGCAGGACACTCTTGG - Intergenic
936463663 2:112728875-112728897 TGTGTGTGGCAGCACAGTGCAGG - Intronic
938486803 2:131719913-131719935 GGTGTGACCCAGCACAGTCATGG - Intergenic
938986195 2:136578937-136578959 TGTGGGTCCAAGCAGAGACATGG - Intergenic
943511866 2:188836281-188836303 TGTGGGGAGCAGCACAGCAATGG - Intergenic
947309909 2:228790301-228790323 TGAGTGTAGCAGCACAGTCCAGG + Intergenic
1171095026 20:22324681-22324703 TATGGGTGGCTGCACAGTCATGG + Intergenic
1173441054 20:43076705-43076727 TGTGGGCAGCAGCACCATCATGG - Intronic
1176209884 20:63914183-63914205 TGTGGGTCACAGCACCTCCACGG - Intronic
1183449773 22:37886741-37886763 TGTGGGGGAAAGCACAGTCAGGG - Intronic
951610659 3:24489531-24489553 TATGGTTCTCAGGACAGTCAAGG + Intronic
953608890 3:44430917-44430939 TGTGTGTGGCAGGCCAGTCAGGG - Intergenic
955572870 3:60326783-60326805 TGTGGGTCACAGCACAGGAAAGG - Intronic
958771771 3:98434069-98434091 TATGGGAAGCAGCACAGACAGGG + Intergenic
961055920 3:123788904-123788926 TCTGAGTCACAGCACAGCCAGGG + Intronic
967812365 3:193771573-193771595 TGTGTGTCACAGCACAGAAATGG - Intergenic
969265891 4:6063888-6063910 TGTGGGGTGCAGCACAGCAAGGG + Intronic
971105023 4:23515221-23515243 TGTGGGTTCCAGCAAAGTAAAGG - Intergenic
971283226 4:25259858-25259880 TGTGGGTCCCTGGACTGTCAGGG + Intronic
985241782 4:187937946-187937968 TGTGGGACTCAGAACAGCCACGG - Intergenic
991451799 5:66759459-66759481 TGTGGGTCACAGCACATTAGTGG - Intronic
991697212 5:69284387-69284409 TGTGGGTAGCAGGACTGTAAAGG + Intronic
1002692997 5:181063891-181063913 TCAGGGTCCCAGCACGGTCAGGG + Intergenic
1006980551 6:38144488-38144510 TGCTGGGCGCAGCACAGTGATGG - Intronic
1006987645 6:38187143-38187165 TGTGGCTCTGAGCACAGTCTTGG + Intronic
1009379957 6:63015067-63015089 TTTGGGTAGCAGAACAGACACGG + Intergenic
1013205506 6:107941450-107941472 TGTGGATAGTGGCACAGTCATGG - Intronic
1016283628 6:142448326-142448348 TGATGATCCCAGCACAGTCATGG - Intergenic
1017880692 6:158560491-158560513 TGTGGCTCGCAGCCCCGTCCCGG - Intronic
1018027457 6:159817293-159817315 TGTGGGCTGCTGCCCAGTCAGGG - Intronic
1018711351 6:166500075-166500097 TGGGGGACGCAGCCCAGCCAAGG + Intronic
1019195609 6:170280761-170280783 TGTGGGTCACGTCACAGACACGG + Intergenic
1019697039 7:2451783-2451805 TGTGGGTGGCTGTACAGTCCCGG + Intergenic
1022508956 7:30923217-30923239 TGTGGGGCCCAGCTCAGGCATGG - Intronic
1023962237 7:44936482-44936504 TCAGGGTCACAGCACTGTCATGG + Intergenic
1024309008 7:47952129-47952151 TCTGGGTCCCATCACACTCACGG + Intronic
1025765978 7:64450584-64450606 TGTGGGTCTTAGCACAGTGCAGG + Intergenic
1029268708 7:99363058-99363080 TGTGGGTAGGACCACAGCCATGG - Intronic
1037733491 8:21548801-21548823 TGTTGGTGGCAGCACAGGCAGGG - Intergenic
1040868894 8:52079650-52079672 TGTGGGTCCCAGCACAGGAGAGG - Intergenic
1041391586 8:57351717-57351739 AGAGGGAGGCAGCACAGTCAGGG - Intergenic
1047790358 8:128197411-128197433 TCCAGGTGGCAGCACAGTCAAGG + Intergenic
1049184577 8:141243013-141243035 TGTGGCTCCCAGCAAAGTCTTGG - Intronic
1050382381 9:5042955-5042977 TGAGGGTCGGAGCACAGCCTCGG - Intronic
1055649258 9:78391301-78391323 TGTGTGTTGCAGGACAGGCAGGG + Intergenic
1055649265 9:78391412-78391434 TGTGTGTTGCAGGACAGGCAGGG + Intergenic
1055649272 9:78391523-78391545 TGTGTGTTGCAGGACAGGCAGGG + Intergenic
1058917821 9:109584580-109584602 TATGGGTCCCAGAACAGACATGG - Intergenic
1062731292 9:138111551-138111573 TGTGCCTAGCAGCACCGTCAAGG - Intronic
1186792093 X:13009424-13009446 TGTGTGTCTCAGCAGAGTCGAGG + Intergenic
1194708132 X:97200519-97200541 TGTCAGTCTCAGCACTGTCAGGG - Intronic
1195532096 X:105969009-105969031 TGTTGGGCATAGCACAGTCATGG - Intergenic