ID: 1084712347

View in Genome Browser
Species Human (GRCh38)
Location 11:70851796-70851818
Sequence TCCAACTGGACCCCAAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084712347_1084712349 -10 Left 1084712347 11:70851796-70851818 CCAGAGCTTGGGGTCCAGTTGGA 0: 1
1: 0
2: 1
3: 16
4: 162
Right 1084712349 11:70851809-70851831 TCCAGTTGGACCATGCGTGGAGG 0: 1
1: 0
2: 0
3: 6
4: 169
1084712347_1084712352 19 Left 1084712347 11:70851796-70851818 CCAGAGCTTGGGGTCCAGTTGGA 0: 1
1: 0
2: 1
3: 16
4: 162
Right 1084712352 11:70851838-70851860 CTCTTGCTAATCATCCTGAGTGG 0: 1
1: 0
2: 1
3: 13
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084712347 Original CRISPR TCCAACTGGACCCCAAGCTC TGG (reversed) Intronic
901656086 1:10770538-10770560 GCCAACTGGGCCCCTAGCTGCGG + Intronic
901814950 1:11788635-11788657 GCCAACTGTCCCCAAAGCTCAGG + Exonic
903918013 1:26778619-26778641 GCCAAGTGGAACCCAAGCTTAGG - Intronic
904200472 1:28816189-28816211 TCCCACCAGACCCTAAGCTCCGG - Intronic
904270909 1:29349484-29349506 TCCATGTGGCCCCCAAGCCCAGG - Intergenic
904277632 1:29394742-29394764 TCCCACGGGTCCCCATGCTCAGG - Intergenic
905316641 1:37085906-37085928 TGCAACTGCACCCCCAGCCCTGG + Intergenic
905625928 1:39490937-39490959 TCCAGCTGGGCCAGAAGCTCTGG - Intergenic
906609357 1:47191040-47191062 TCCACCTGGCCCTCCAGCTCAGG + Intronic
907584071 1:55600657-55600679 TCCTAGTGGACCCAAAGCTCAGG + Intergenic
909537145 1:76749871-76749893 TCCTACTGGACCATGAGCTCTGG - Intergenic
912455147 1:109792140-109792162 CCCACCTGGATCCCAAGTTCTGG - Intergenic
913316395 1:117557526-117557548 TAGAAGAGGACCCCAAGCTCTGG - Intergenic
915004368 1:152622994-152623016 TCCAGCTGTGCCCCAAGCTCTGG - Exonic
915948118 1:160169114-160169136 TCCCACTGGCCGCCAAGCTCTGG + Intronic
915955274 1:160215560-160215582 TCCAATTGGAGCCCAAGCACTGG + Intergenic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
1063548679 10:7007320-7007342 TTCATCTGGACCCCAAACCCTGG + Intergenic
1064856440 10:19773538-19773560 TCCAGCTTGAATCCAAGCTCTGG + Intronic
1072007719 10:91270477-91270499 TCCAAAGAGTCCCCAAGCTCTGG - Intronic
1072502334 10:96030331-96030353 TCCTACTCTACCCCAAGCTCTGG + Intronic
1073105012 10:101027563-101027585 ACCCACTGGACCAGAAGCTCTGG + Intronic
1073107926 10:101043130-101043152 TCCTCCTGGATCCCAAGCCCAGG + Intergenic
1073445603 10:103578540-103578562 TCCAACAGAACCCCAAGTTCTGG - Intronic
1075180238 10:120204602-120204624 TCCCACTGTACCACAATCTCAGG + Intergenic
1076691414 10:132225499-132225521 CCCATCTGGAACCCCAGCTCGGG + Intronic
1076876349 10:133218085-133218107 TCCAGCTGGACGCCATGCCCCGG - Intronic
1077516761 11:3006890-3006912 TCAAACCGCACCCCAAGCTCGGG + Exonic
1084560777 11:69904503-69904525 TCCACTGGGACCCCAAGCCCTGG - Intergenic
1084712347 11:70851796-70851818 TCCAACTGGACCCCAAGCTCTGG - Intronic
1086397778 11:86433851-86433873 TCCAGCTGGCCCACAAGCGCCGG + Intergenic
1088154208 11:106783921-106783943 TCCAGCTGGAGCCCAAGTTTGGG - Intronic
1088389639 11:109299923-109299945 TCCAACTGGACACCATTCTAGGG - Intergenic
1088582154 11:111326849-111326871 TCCAACTGGACAGCCAGCTCAGG + Intergenic
1090272798 11:125399757-125399779 TCCAACTCCACCTCGAGCTCTGG + Intronic
1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG + Intronic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1107477811 13:40756927-40756949 TCAAACTGAATCCGAAGCTCTGG + Exonic
1112395238 13:99023991-99024013 TCCAACTGACCCCTCAGCTCAGG + Intronic
1112416335 13:99206273-99206295 TCCAACTGTCCCCCCACCTCTGG - Intronic
1113897701 13:113776339-113776361 TCCCACAGGCCTCCAAGCTCAGG - Intronic
1116043460 14:39714373-39714395 TCCAACTAAACACCAAGATCTGG - Intergenic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1118817805 14:69325140-69325162 TTCAACTTGACCACAAGCCCAGG - Intronic
1123021970 14:105402966-105402988 TCCATCTGGACCCCAAGAGAGGG + Intronic
1123578671 15:21696849-21696871 ACCAAATGGACAGCAAGCTCAGG + Intergenic
1123615298 15:22139331-22139353 ACCAAATGGACAGCAAGCTCAGG + Intergenic
1125200209 15:37096122-37096144 TCCAATTCGCCCCCAGGCTCAGG + Intronic
1128683898 15:69669758-69669780 TCTGACTGGACCCAAATCTCTGG + Intergenic
1130140675 15:81223752-81223774 ACCAACTGGGCCTCCAGCTCTGG - Intronic
1130912532 15:88281020-88281042 AGCAACTGGACCCCAAACTGGGG + Intergenic
1202987541 15_KI270727v1_random:431094-431116 ACCAAATGGACAGCAAGCTCAGG + Intergenic
1137547126 16:49411889-49411911 TCCCCCTGGCCCCCAAGCTCAGG + Intergenic
1140039836 16:71398897-71398919 TCCAACTGGTCTTCCAGCTCAGG + Intergenic
1140127510 16:72130518-72130540 TCCAACAGGTGCCCAGGCTCAGG - Exonic
1142912899 17:3111103-3111125 TCCCATTGGACCCCAGGCCCTGG - Intergenic
1147422384 17:40328310-40328332 TGCCACTCCACCCCAAGCTCAGG - Intronic
1147953289 17:44118905-44118927 TCCAAATGGACCCCACCCTTGGG - Intronic
1150221226 17:63496964-63496986 TACAACTGGACGCCGAACTCCGG + Exonic
1151785528 17:76273143-76273165 TCTGGCTGGAGCCCAAGCTCAGG + Intergenic
1152716345 17:81902498-81902520 TGCAACTGCACCCCAGGCTGCGG + Exonic
1155593211 18:27452443-27452465 TCCCACTGTATCCCAGGCTCTGG - Intergenic
1156977998 18:43248765-43248787 TCCAACTGGCAACAAAGCTCAGG - Intergenic
1157041864 18:44049289-44049311 TCCAAATGTATCCCAAGTTCAGG - Intergenic
1159066270 18:63570921-63570943 TCCAACTGGACCTCCGCCTCGGG - Intergenic
1159804167 18:72935605-72935627 TCCAGCTCGACCCCAGTCTCAGG + Intergenic
1161165345 19:2784003-2784025 TCCAAACGGACCCCAGGCACAGG + Intergenic
1161398811 19:4058765-4058787 TCCAGCCGGACCCAAAGCCCAGG + Intronic
1161633651 19:5373362-5373384 TGCAGCTGAACCCCCAGCTCCGG - Intergenic
1162079162 19:8208722-8208744 TCCAACAGGGCCCCAGACTCGGG + Intronic
1162363836 19:10236034-10236056 TCCAAGTGCGCCCCAAGATCTGG - Intergenic
1162829302 19:13274699-13274721 TCAAAATGGCCCCCAAGTTCTGG - Intronic
925438591 2:3863942-3863964 TCCAACTGCACCCCTATCCCAGG - Intergenic
926630895 2:15135453-15135475 TCCCACTGCACCCCAAGCACGGG - Intergenic
928394748 2:30934842-30934864 CCCAACTCTGCCCCAAGCTCTGG + Intronic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
931702146 2:64917982-64918004 TCCAACTGGATACAAAGCTGAGG - Intergenic
932418772 2:71589153-71589175 TCGAGCTGGGTCCCAAGCTCTGG - Intronic
936718175 2:115214932-115214954 GCCAACAGGACAGCAAGCTCAGG - Intronic
940071947 2:149698558-149698580 TCCCACTGGACCATTAGCTCTGG - Intergenic
940996457 2:160155289-160155311 TCTTACTGGCCCCCAACCTCTGG - Intronic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
943801789 2:192069203-192069225 TACAACTGCCCCTCAAGCTCTGG + Intronic
944096320 2:195972866-195972888 CCCAACTGGACTGCAAACTCAGG - Intronic
944644367 2:201763440-201763462 GCTAACTGGCCCCCAACCTCTGG + Intronic
946744117 2:222828890-222828912 TCCAACTAGACTCTAAGTTCAGG - Intergenic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
948691830 2:239711129-239711151 CCCACCTGGACCTCCAGCTCAGG + Intergenic
949041185 2:241850646-241850668 TCCAACCAGCCCCCAAGTTCAGG + Exonic
1171342732 20:24443480-24443502 TCCAAATGCACCCCAGGCTAAGG + Intergenic
1171953727 20:31443220-31443242 TCCATCTGGTCCCCAAGTTAAGG + Intronic
1172699417 20:36843751-36843773 TCTAAGTGGACCCCAAGCTCAGG + Intronic
1174294934 20:49539365-49539387 TCCACCAGGAACCCAAGCTCTGG + Intronic
1176108533 20:63400756-63400778 TCCAGCGGGACCACCAGCTCTGG + Intergenic
1178525567 21:33325395-33325417 TCAAACTCGACACAAAGCTCTGG - Intronic
1178704876 21:34864743-34864765 TCCTCCTGGAACCCAAGCCCTGG - Intronic
1180756700 22:18167276-18167298 CCCAACTGTACCTCAAACTCTGG + Exonic
1181047803 22:20223848-20223870 TCCAGCTGGGCCCCAGGCTCAGG + Intergenic
1181075065 22:20370156-20370178 CCCAACTGTACCTCAAACTCTGG - Exonic
1181469337 22:23128164-23128186 TTCAACTGCACCCCAAAATCTGG + Intronic
1183332206 22:37227716-37227738 TACAACTGAACACCAGGCTCTGG + Intronic
1184341575 22:43889158-43889180 CACAACTGAACCCCAAGCTTAGG + Intronic
1184768877 22:46586627-46586649 TCCTACTGCACCCAGAGCTCTGG + Intronic
1185128150 22:49023120-49023142 CCCCACTGCACCCCAAGCCCGGG + Intergenic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
950897523 3:16467154-16467176 TCCCACTGGTTCCCAGGCTCAGG - Intronic
952164121 3:30727788-30727810 ACCAACTGGATCAGAAGCTCTGG - Exonic
952244845 3:31576142-31576164 ACCACCTGGACCCCAAGCAATGG + Intronic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
953135506 3:40178349-40178371 ACCAACTGGTCCCGAAGCTTTGG - Intronic
953906838 3:46872597-46872619 TCTCTCTGGACCCCAAGGTCAGG - Intronic
957922618 3:86765348-86765370 TGTAACTGGAGCTCAAGCTCTGG - Intergenic
957968903 3:87358215-87358237 TCTAACTGGACTGTAAGCTCAGG - Intergenic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
960607839 3:119526547-119526569 TCAAACTGGACATCAAGTTCAGG - Intronic
962758219 3:138484680-138484702 TCCAGCTGGCCCGCAAGCACCGG - Intergenic
962961111 3:140311819-140311841 TCCACCTGGAGCCCAGGATCTGG - Intronic
966908033 3:184541964-184541986 CCCATCTGTACCCCAAGTTCAGG + Intronic
966924035 3:184633127-184633149 TACAACTGCACCCCCAGCTTTGG + Intronic
968702519 4:2063643-2063665 TCCAGCTGGACACCAAGCCAGGG - Intronic
970566355 4:17335718-17335740 TCCAACTGGACTCCACGCTGGGG - Intergenic
971935824 4:33145735-33145757 TGGAAGAGGACCCCAAGCTCTGG - Intergenic
977027838 4:91842787-91842809 TTCACCTGGGCACCAAGCTCTGG - Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
985979626 5:3451719-3451741 TCCACCTGGATCCCCACCTCAGG + Intergenic
986671939 5:10150402-10150424 TCCATCTGGACACCAAGCCCGGG - Intergenic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
988452495 5:31357288-31357310 TCCAACAGGAGGCAAAGCTCAGG + Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
994974713 5:106787610-106787632 ACCAATAGGACCCCAATCTCAGG + Intergenic
998483018 5:142478689-142478711 TCCGCCTTGACCCCAAGTTCAGG + Intergenic
999238863 5:150115842-150115864 TCCACCTGGAGCTCAAGCTGGGG + Exonic
999430469 5:151521349-151521371 TGCATCTGGACCCCAAGGTTGGG - Exonic
1002330755 5:178438921-178438943 CCCAACTGCACCAAAAGCTCTGG + Intronic
1003806902 6:9736104-9736126 TCCAAGTTGACCCCCAGCACAGG - Intronic
1005380539 6:25229852-25229874 TCCTACAGGCCCCCAAACTCAGG + Intergenic
1005916862 6:30359918-30359940 TCCACCTGGAGCCATAGCTCAGG + Intergenic
1006401757 6:33821780-33821802 TCCTACAGGACCCCAAATTCAGG - Intergenic
1006429652 6:33988017-33988039 TCCAGCTGATCCCGAAGCTCTGG - Intergenic
1007631788 6:43276865-43276887 TCCAACTAGGCCCAAACCTCTGG - Intronic
1012537372 6:100314961-100314983 ACCACCTTGACCCCAAACTCTGG + Intergenic
1014001916 6:116373466-116373488 TTCAACAGGTCCCCAAGATCAGG - Intronic
1014574806 6:123057093-123057115 TCCAAATGGACCCTGAGCTGTGG - Intronic
1017648694 6:156562273-156562295 TCCAACTGGAAACCCAACTCAGG - Intergenic
1019049252 6:169170450-169170472 TCCGAATGAACACCAAGCTCTGG - Intergenic
1019267581 7:127073-127095 TCCCACAGGAGCCCAGGCTCGGG - Intergenic
1019473625 7:1233724-1233746 GCCATCCGGACCCCAGGCTCTGG + Intronic
1019819943 7:3234950-3234972 TCCAAATCTATCCCAAGCTCTGG - Intergenic
1020081228 7:5286938-5286960 TCCAACTGCTCCCCAAGTCCTGG + Intronic
1020093229 7:5353046-5353068 TCCAGCAAGACCCCAACCTCAGG + Intronic
1023844712 7:44114103-44114125 TCCAACTGGGTCTCAAACTCGGG - Exonic
1024153669 7:46598822-46598844 TCCGAATAGACCACAAGCTCCGG + Intergenic
1024270852 7:47640339-47640361 TTCAACTGGACCCGAAGGACAGG + Intergenic
1025197682 7:56945237-56945259 TCCAACTGCTCCCCAAGTCCTGG - Intergenic
1025674265 7:63631701-63631723 TCCAACTGCTCCCCAAGTCCTGG + Intergenic
1030679266 7:112417466-112417488 TGAAACTGGACCCCTATCTCTGG + Intergenic
1030987125 7:116254692-116254714 TGCCACTGCACCCCAAGCCCAGG + Intronic
1031076910 7:117221820-117221842 TCCAACTCTTTCCCAAGCTCTGG + Intronic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1035181182 7:157090651-157090673 TCCCCCAGGACCCCAAGGTCAGG + Intergenic
1036556445 8:9864067-9864089 TCCTATTTGTCCCCAAGCTCTGG + Intergenic
1037590918 8:20311312-20311334 GCCAGCAGGACCCCAAGCCCAGG - Intergenic
1045560001 8:103252269-103252291 TGCAGGTGGACCACAAGCTCAGG + Intergenic
1046675557 8:117104120-117104142 TCCAACTAGACCCCAACTTGGGG + Intronic
1047161634 8:122387008-122387030 TCCAGTTGGCCCCCAGGCTCGGG + Intergenic
1048142120 8:131804744-131804766 TGAAACTGGACACCTAGCTCAGG - Intergenic
1049266709 8:141671499-141671521 GGCAGCTGGACCCCAGGCTCAGG - Intergenic
1051590027 9:18768345-18768367 TCCTACTGGACACCATGCTCTGG - Intronic
1052985999 9:34488453-34488475 TGCAACTGGACCCCATGAACTGG + Intronic
1056796810 9:89664182-89664204 CCCACCTGGACCGCCAGCTCTGG - Intergenic
1058626058 9:106933884-106933906 TCAAACTGAACCCCCAGCTAGGG - Intronic
1060549396 9:124477940-124477962 TCCACCTGGGCCCCACCCTCCGG + Intronic
1060925888 9:127454816-127454838 TCCCTCTGGGCCTCAAGCTCTGG + Intronic
1061630657 9:131870271-131870293 TCCAACAGGAGCCCAGCCTCTGG + Intronic
1062014466 9:134284249-134284271 CCCCCCTGGACCCCATGCTCTGG + Intergenic
1190957993 X:55215530-55215552 TGAAACTAGACCACAAGCTCTGG - Intronic
1192224709 X:69220372-69220394 TCCACCTGGACACCAGGCTCTGG - Intergenic
1194978409 X:100415581-100415603 TCCAAGTGGACCCCAAATGCTGG + Intergenic
1195244582 X:102983856-102983878 TCCCATTGGAGCCCTAGCTCTGG + Intergenic
1196738800 X:119006325-119006347 TTCAACTGGACCCCCAGCCACGG + Intronic