ID: 1084712725

View in Genome Browser
Species Human (GRCh38)
Location 11:70853900-70853922
Sequence CTTTATAAGAAGAAGGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 640
Summary {0: 1, 1: 0, 2: 7, 3: 58, 4: 574}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084712725_1084712731 -9 Left 1084712725 11:70853900-70853922 CCCCCCTCCTTCTTCTTATAAAG 0: 1
1: 0
2: 7
3: 58
4: 574
Right 1084712731 11:70853914-70853936 CTTATAAAGACATCAGCCATTGG 0: 1
1: 12
2: 62
3: 284
4: 635

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084712725 Original CRISPR CTTTATAAGAAGAAGGAGGG GGG (reversed) Intronic
900513936 1:3072599-3072621 GTTTCTACGAAGAAGGAAGGAGG - Intronic
901165627 1:7219733-7219755 CCTTATAAGAAGAGGAAGAGGGG + Intronic
901651082 1:10743614-10743636 TTCTATAAAAATAAGGAGGGAGG + Intronic
901825365 1:11857975-11857997 TTTGATAAGAAGTAGGAGGTGGG + Intronic
902344899 1:15809183-15809205 CTTTATTGGATGGAGGAGGGTGG + Intergenic
902566072 1:17312214-17312236 CTTTAGGAGACCAAGGAGGGTGG + Intronic
902567259 1:17320250-17320272 CTTTATAAGAGGGAGGCAGGAGG - Intronic
902666180 1:17940259-17940281 CCTTATAAGAAGGAGGCAGGAGG - Intergenic
903017187 1:20368840-20368862 ATTTGAAAGAAGAAAGAGGGTGG + Intergenic
903099397 1:21015068-21015090 GTTTAAAAAAAAAAGGAGGGGGG + Intronic
904292308 1:29495926-29495948 CTTTATAAGAAGAGGAAGAGAGG - Intergenic
904345926 1:29869452-29869474 CTTTCTAAGGATATGGAGGGTGG - Intergenic
905308735 1:37035313-37035335 CTTTCTCAGGAGAATGAGGGAGG - Intergenic
906855400 1:49298641-49298663 ATTTTCAAGAAGGAGGAGGGAGG - Intronic
907740150 1:57157609-57157631 CTTTGTAAGAAGAGGAAAGGAGG - Intronic
908064239 1:60385352-60385374 CTTTATAAGAGGAAAGCAGGAGG - Intergenic
909253659 1:73390571-73390593 AGTTAGAAGAAGAAGGAGGAAGG - Intergenic
909684766 1:78335441-78335463 CTTTCTTAGAGGAAGGAGAGTGG + Intronic
910347672 1:86259032-86259054 CTTTATGAGGAGCAGCAGGGAGG + Intergenic
910898331 1:92092102-92092124 CTGTATAAGAAGACTTAGGGCGG + Intronic
910997511 1:93123763-93123785 CTTTATTAAAAAAAGGGGGGGGG - Intronic
912477130 1:109945971-109945993 CCTTATAAGAGGAAGGCAGGGGG - Intergenic
912553559 1:110499999-110500021 ATTTATAAGAAGATGGTGGGAGG - Intergenic
912668713 1:111606378-111606400 TTTTATAAGAAGAAGGTAGCTGG + Intronic
912838420 1:113017414-113017436 CTCTATAGGAAGGAGGAAGGGGG - Intergenic
915119431 1:153619459-153619481 CTTTCTGAGAAAGAGGAGGGTGG - Intronic
916147987 1:161758687-161758709 CTTTGGAAGACAAAGGAGGGTGG + Intergenic
916292760 1:163184649-163184671 CCTTGTAAGAAGAAGGCAGGAGG + Intronic
916323195 1:163529092-163529114 CTTAATAAGAAGATGAAGAGAGG + Intergenic
916409489 1:164531497-164531519 CTTTGGGAGATGAAGGAGGGAGG - Intergenic
917063479 1:171066305-171066327 CTTTATAAGAGGAATATGGGAGG + Intergenic
917280066 1:173371510-173371532 TTTGATAAGGAAAAGGAGGGGGG - Intergenic
918459929 1:184765921-184765943 CTTAATAAGAAGAAGGTGATGGG - Intergenic
918555000 1:185788314-185788336 CTTTGTAAGAAGGAGAAGGTTGG - Intronic
918768967 1:188528570-188528592 CTTTATAAGAGGAAGGCCGAGGG - Intergenic
919243295 1:194942734-194942756 TTTTATAAGTGGTAGGAGGGAGG + Intergenic
919516525 1:198532276-198532298 CTTTAAGAAAAGAAGGAGGAAGG + Intronic
919596080 1:199563917-199563939 TATTATAAGAAGTAGCAGGGAGG + Intergenic
919664923 1:200282753-200282775 CTTTCTCAGCAGCAGGAGGGAGG + Intergenic
920089930 1:203445206-203445228 CTTTACAAGAAGAAGGCAAGAGG + Intergenic
920165658 1:204033938-204033960 CCTTATAAGTAAAAAGAGGGAGG - Intergenic
920509095 1:206537472-206537494 CTTTATAACTAGAAGCAGGCAGG + Intronic
920807624 1:209250051-209250073 GTTTATAAAAAGAAAGGGGGAGG + Intergenic
920818566 1:209358500-209358522 CCTTATAAGAAGAAGTTAGGAGG - Intergenic
921125098 1:212170512-212170534 CTTTATAAGAAGAGGAAAAGGGG + Intergenic
921546206 1:216478009-216478031 CTTTATAAGAAGGAGGCAGAGGG + Intergenic
922342415 1:224668658-224668680 CTGGACCAGAAGAAGGAGGGAGG + Intronic
922663825 1:227452408-227452430 CTTTAAAAAAAAAAGGGGGGGGG - Intergenic
922786365 1:228284355-228284377 CTTTAAAAGAAGATGAAGAGAGG - Intronic
922844780 1:228676132-228676154 CTTTAAAAAAAAAAGGGGGGGGG - Intergenic
922858359 1:228794544-228794566 CTTTATAAGAGGGAGGAAGGGGG - Intergenic
924955045 1:248917947-248917969 CTGTATCAGGAGAAGGTGGGTGG + Exonic
1064651677 10:17516001-17516023 CCTTATAAAAAGAGGAAGGGAGG - Intergenic
1065134551 10:22654994-22655016 CTTTAGAAGGCCAAGGAGGGAGG + Intronic
1066255269 10:33672493-33672515 CTTTGGGAGAATAAGGAGGGAGG + Intergenic
1066587538 10:36952905-36952927 CTGTATATGGAGAAGGAGGTGGG + Intergenic
1067058820 10:43067433-43067455 CCCTAGGAGAAGAAGGAGGGGGG + Intergenic
1068048628 10:51919668-51919690 CTTTAAAAAAAAAAGGTGGGGGG - Intronic
1068743591 10:60502682-60502704 CCCTGTAGGAAGAAGGAGGGAGG + Intronic
1069869524 10:71524688-71524710 CCTTATAAGAAGCAGGTAGGAGG + Intronic
1069963369 10:72092556-72092578 CTTTATAAGAAGAGGGAATTTGG - Intergenic
1070357073 10:75650702-75650724 CTTTAAAAGGAAAGGGAGGGAGG + Intronic
1070629443 10:78074475-78074497 CCTTATAAGAAGGAGGCAGGAGG + Intergenic
1070690461 10:78521196-78521218 GCATATAAGAGGAAGGAGGGAGG + Intergenic
1071436645 10:85653742-85653764 TTTTATAAGGAGAAGAAGAGAGG + Intronic
1071865598 10:89727252-89727274 CTTTAAAAAAAAAAGGGGGGGGG - Intronic
1072134447 10:92530528-92530550 CTTTAGAAGACCAAGGTGGGAGG - Intronic
1072652038 10:97303393-97303415 CTTTACAAGAAGAGGAAGAGAGG + Intergenic
1073208009 10:101778837-101778859 TTTGATAAGATAAAGGAGGGAGG - Intronic
1073373820 10:103015608-103015630 CTTTAGAAGGCCAAGGAGGGTGG + Intronic
1073642939 10:105271277-105271299 CTTTATAAGAAGAAGAAACTAGG + Intergenic
1073904491 10:108262115-108262137 GTCTATCAGAAGATGGAGGGTGG - Intergenic
1073905695 10:108276730-108276752 CTTTATAACTAGAAGTGGGGTGG + Intergenic
1075618995 10:123911976-123911998 CTTTAGAACAGAAAGGAGGGGGG + Intronic
1075916304 10:126170424-126170446 CTTTAAAAAAAAAAAGAGGGCGG + Intronic
1076008514 10:126967726-126967748 CCTTATAAGAGGAAGACGGGAGG - Intronic
1076107041 10:127831913-127831935 CTTTATAAGAAGAAGAAATTAGG + Intergenic
1077386684 11:2272540-2272562 CTTGACAAGGGGAAGGAGGGAGG - Intergenic
1077904376 11:6518303-6518325 CTTTGGAAGACCAAGGAGGGTGG - Intronic
1078319249 11:10318942-10318964 CTTTATAAGAAGACTATGGGAGG + Intronic
1078365605 11:10703992-10704014 CTTTAGAAGGCCAAGGAGGGAGG + Intergenic
1078976219 11:16480650-16480672 CATAATAAAAAGAAGGTGGGGGG - Intronic
1079065351 11:17286278-17286300 CTTTGTGAGGACAAGGAGGGTGG - Intronic
1079270758 11:18983571-18983593 CTACATAAGAAGAAGCAAGGAGG + Intergenic
1081706642 11:45185906-45185928 CTTAATAAGAGGGAGGTGGGAGG + Intronic
1083152086 11:60798205-60798227 CTTTTCAAGAACAGGGAGGGTGG + Intronic
1083792109 11:64992558-64992580 CCTTATAAGAAGAGGGAAGGAGG + Intronic
1083967865 11:66053680-66053702 CTTTAAAAAAAAAAGGGGGGAGG + Intronic
1084712725 11:70853900-70853922 CTTTATAAGAAGAAGGAGGGGGG - Intronic
1084738712 11:71123501-71123523 CATCATAAGGAGAGGGAGGGAGG + Intronic
1084893898 11:72251307-72251329 CTTGATAAGAGGGAGAAGGGGGG - Intergenic
1084911742 11:72395215-72395237 CTTTCTGAGAACAAGGAGAGTGG + Intronic
1085206765 11:74738657-74738679 CATTATAACAAGAAGCAGAGTGG - Intergenic
1085380575 11:76113775-76113797 ATTTATAAGAGGAAGAAGGTTGG + Intronic
1087157790 11:94921848-94921870 CATTATAAGGAGAAGGCAGGAGG - Intergenic
1087608563 11:100406722-100406744 CCTTATAAGAAGAAGAAATGTGG + Intergenic
1088211231 11:107458601-107458623 ATTTACAAGAAGAAGAAGGCTGG + Intergenic
1088477805 11:110261801-110261823 CTATTTAAAAAGAAGGAAGGTGG - Intronic
1089073094 11:115716366-115716388 CTTTCTAAGGGGAAGGAGAGAGG + Intergenic
1089440361 11:118510904-118510926 CTCTCTAGGAAGAAGAAGGGAGG + Intronic
1089757038 11:120694835-120694857 CTTTATAAAAAGAAGAAGACAGG + Intronic
1090468564 11:126957637-126957659 GTTTCTAAGATGAAGGAGGCAGG + Intronic
1090905490 11:131070938-131070960 CTTAATAAGGGGAAGGAGGTAGG - Intergenic
1094574692 12:31674469-31674491 CCTTAAAAGTAGAAGGAGAGAGG - Intronic
1094649791 12:32364412-32364434 CTTTGTAAAATGAAGGAGGTAGG - Intronic
1095576839 12:43749885-43749907 GTCTATAAGAGGTAGGAGGGAGG + Intronic
1097792531 12:63829966-63829988 GTTTTTAGGAAGATGGAGGGAGG + Intergenic
1097883461 12:64706589-64706611 CATTACAGGAAGAAGGAGAGGGG + Intergenic
1097981100 12:65738828-65738850 CTTAAAAAAAAGAAAGAGGGAGG - Intergenic
1098085200 12:66834923-66834945 CTTTAAAAAAAAAAGGGGGGGGG + Intergenic
1098591450 12:72218765-72218787 CCTTATAAGAAGAAGGGAGAGGG - Intronic
1098960457 12:76734778-76734800 CTTTATAGGATGAATTAGGGAGG + Intergenic
1099182924 12:79488280-79488302 CTTAAAAAGTAGAAGGAGGCCGG + Intergenic
1099781544 12:87202147-87202169 CTTTATAAGAAGAATAAGTCAGG + Intergenic
1100086067 12:90912619-90912641 CTTTATAAAATAAAGGAGTGTGG - Intronic
1100146162 12:91680257-91680279 CTTTGTAAGACGAAGGCGGGCGG - Intergenic
1100587194 12:95991114-95991136 ATAAATAAGAAGAAGGAAGGAGG + Intronic
1100606310 12:96154681-96154703 CCTTATAAGAAGAAAGAGAGAGG + Intergenic
1100696408 12:97098787-97098809 CTTTAGAAGAAAGAGGCGGGTGG - Intergenic
1101890704 12:108712274-108712296 CCTTTTAAGAAGATGGAGGCCGG + Intronic
1102231852 12:111268091-111268113 CATTATAAGAGAAAGGAGGTTGG - Intronic
1102367712 12:112353584-112353606 CTTTGGGAGAACAAGGAGGGTGG + Intronic
1102641983 12:114374863-114374885 ATCAATAAAAAGAAGGAGGGAGG + Intronic
1102898700 12:116619421-116619443 CCTTGTAAGAGGGAGGAGGGAGG + Intergenic
1102919558 12:116781645-116781667 CCTTATAAGAGGAAGGCAGGAGG - Intronic
1103205643 12:119126666-119126688 GTTGATGAGAAGAAGGAGGAAGG + Intronic
1103256542 12:119546398-119546420 CTTTATATGAAGGAGGAAAGAGG + Intergenic
1103951359 12:124553205-124553227 CTTTATAAGAAGGAGGCAGGAGG - Intronic
1103970809 12:124670303-124670325 CTTTATAAGAGGGAGGCAGGAGG - Intergenic
1104337786 12:127916556-127916578 CCTTATTAGAAGGAGGAAGGAGG + Intergenic
1107649643 13:42531688-42531710 CTTTAGAAGAAGAGGGAGATGGG - Intergenic
1108214285 13:48168776-48168798 CTTTAGGAGACCAAGGAGGGTGG + Intergenic
1108303868 13:49110876-49110898 CTTTTTAAGAAGCAGGGGTGGGG + Intronic
1109075168 13:57824668-57824690 TTATATAAGAAGCAAGAGGGAGG - Intergenic
1109273581 13:60280484-60280506 CTTCATAAGAAAAAGAAGGCCGG + Intergenic
1109530304 13:63634338-63634360 CCTTATAACAAGGAGCAGGGTGG - Intergenic
1110577349 13:77074004-77074026 CTTTAAAAAAAAAAGGGGGGGGG - Intronic
1110605336 13:77425740-77425762 CTTTATAAGCAGAAGTCAGGAGG + Intergenic
1110700387 13:78540626-78540648 CTCTGCAAGAAGAAGGAGGATGG - Intergenic
1110758290 13:79201604-79201626 CTATATAAGAAGGAGCAGGGAGG - Intergenic
1111168676 13:84496535-84496557 CTTTACTTGAAGGAGGAGGGAGG + Intergenic
1111794143 13:92896163-92896185 CTTTTTAAGAAGAGGAAGAGAGG - Intergenic
1111901935 13:94210089-94210111 CTTTGTGAGACTAAGGAGGGAGG - Intronic
1112834493 13:103497633-103497655 CTTTATAAGAGGGAGGTGGAAGG - Intergenic
1113072475 13:106434902-106434924 CTTTGGGAGATGAAGGAGGGTGG - Intergenic
1113102921 13:106739796-106739818 TTTTTTAAGAAGAAGAAAGGGGG + Intergenic
1113285230 13:108839176-108839198 CTTTATAAGAAGAGGAAGAGAGG - Intronic
1114062259 14:19028313-19028335 TTTTAAAAGAAGCAGAAGGGAGG + Intergenic
1114100000 14:19371680-19371702 TTTTAAAAGAAGCAGAAGGGAGG - Intergenic
1114189962 14:20433272-20433294 CTTCATAATAAAAAGGTGGGGGG + Intronic
1114234139 14:20810111-20810133 CTTTAGAAGAATAAGGAAGTGGG + Intergenic
1114298407 14:21351594-21351616 CTTTAAGAGAAGAAGGGGGGAGG - Exonic
1114423810 14:22605762-22605784 GTTTATGAGAAGCAAGAGGGAGG - Intronic
1115184841 14:30674641-30674663 CTCAAAAAAAAGAAGGAGGGAGG + Intronic
1117626861 14:57649456-57649478 CTTTATAAGAAGCAGGCAGGAGG - Intronic
1117873545 14:60225612-60225634 CCTTATAAGAGGAAGGCAGGAGG - Intergenic
1118436196 14:65772862-65772884 TTTTTGAAGAAGCAGGAGGGTGG + Intergenic
1118850861 14:69582304-69582326 ATTAAGAAGAAAAAGGAGGGGGG - Intergenic
1119678184 14:76572082-76572104 CTTAATAAGAAGATGCAGGCTGG - Intergenic
1120219822 14:81719547-81719569 CCTTATAAGAGGAAGGCGGGTGG - Intergenic
1120552799 14:85891865-85891887 CTTTATAAGAAGAGGAAGAGGGG - Intergenic
1120887454 14:89462983-89463005 CTTTTTAAGAAGAGGAAGAGAGG - Intronic
1121006072 14:90491475-90491497 CGTTAAAAGAAGAAGAAGGAGGG + Intergenic
1121744106 14:96274538-96274560 CTTTATGAAATGAAGGAGGGAGG + Intergenic
1121880853 14:97499256-97499278 ATTTAGAAGAAGAAGGAAGAAGG + Intergenic
1121917041 14:97844709-97844731 CTTTGTAAAAGGAAGGAAGGAGG + Intergenic
1122539736 14:102491455-102491477 CTTTGGAAGACTAAGGAGGGAGG - Intronic
1124721954 15:32118126-32118148 CTTGATAAGAAGAGGAAGAGAGG + Intronic
1124787088 15:32691722-32691744 CTTTACGAGAAGATGAAGGGAGG + Exonic
1126506656 15:49412710-49412732 CTTAATTAGAAAAATGAGGGAGG + Intronic
1127531555 15:59848272-59848294 ATTTCTAAGAACAAGGAGAGAGG - Intergenic
1127729828 15:61789547-61789569 CTTTATATAAGGAAGGAGGCAGG - Intergenic
1128552969 15:68609991-68610013 TTTTATCAAGAGAAGGAGGGTGG - Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1130208614 15:81901933-81901955 CTTTATAAGAAAGAGGAGAAAGG + Intergenic
1131133307 15:89913529-89913551 CTGTGCAGGAAGAAGGAGGGAGG - Intergenic
1131350008 15:91691284-91691306 CTTTGGAAGACCAAGGAGGGCGG + Intergenic
1131510324 15:93046212-93046234 CTTTATAAGAAGGAGGCAGAGGG + Intronic
1131648980 15:94378276-94378298 CTTTAAGAGGACAAGGAGGGAGG + Intronic
1132710860 16:1266610-1266632 CCTTATAAGAGAAAGGAGAGGGG + Intergenic
1133210383 16:4260344-4260366 CTTTATATTAAGAAGCAGAGAGG + Intronic
1133475963 16:6122147-6122169 CTTTAGAAGACCAAGGTGGGCGG - Intronic
1133652883 16:7829601-7829623 CTTTAAAAGAGGAAGGTGGGTGG - Intergenic
1134637389 16:15802852-15802874 ATTTATAAGAGAAAGGAGGCCGG + Intronic
1134811601 16:17171902-17171924 CTTTAGGAGAGGAAGGAGGCTGG + Intronic
1135085061 16:19468627-19468649 CTTTATAAGAGGCAGGCAGGAGG + Intronic
1135568932 16:23533436-23533458 GTTTGAAAGTAGAAGGAGGGCGG - Intronic
1135935836 16:26779266-26779288 GTTTAAAAAAAGAAGGTGGGGGG + Intergenic
1136926448 16:34379737-34379759 TTTGATAAGTAGAAGGAGGAGGG - Intergenic
1136978126 16:35032070-35032092 TTTGATAAGTAGAAGGAGGAGGG + Intergenic
1137892581 16:52178145-52178167 CTTTATAAGGACAAGAAGGGAGG + Intergenic
1137979809 16:53060098-53060120 CTTTGGAAGACCAAGGAGGGAGG + Intronic
1138520268 16:57567154-57567176 CGCTATAGGCAGAAGGAGGGAGG + Intronic
1138542761 16:57698441-57698463 CTTTAGAAGGAAAAGGTGGGAGG + Intronic
1140400305 16:74666015-74666037 CTTTATAACAGGAAAAAGGGAGG + Intronic
1140999426 16:80294760-80294782 CTTTGTAAGAGGAAGGCAGGAGG - Intergenic
1141005832 16:80350703-80350725 CTTTATAAGAGGGAGGCAGGAGG - Intergenic
1141018710 16:80474815-80474837 CTTTATAAGTGGAAGAAGGAAGG - Intergenic
1141191065 16:81824925-81824947 CTTTAAAAGAGGAAGGTAGGAGG + Intronic
1141585320 16:85029640-85029662 CTTTATGAGAGAAAGGAGGGAGG - Intronic
1141731352 16:85825099-85825121 CCTTATAAGAAAAAGCAGAGAGG - Intergenic
1141888953 16:86913684-86913706 CTTCATATGAAGAGGGAGGGTGG - Intergenic
1143049566 17:4113336-4113358 CTTTAGAAGAAGAAATAGTGTGG - Intronic
1143366983 17:6414852-6414874 CCTTATAAAAAGAAGGAGTTTGG + Intronic
1143539091 17:7558889-7558911 CTTGAAAATAAAAAGGAGGGAGG - Exonic
1143643155 17:8211093-8211115 TTTTATAAAAAGAAGAAGGCCGG - Intergenic
1144394697 17:14832845-14832867 CTTTAAAAGAAAAAGCAGGCCGG - Intergenic
1146064699 17:29625035-29625057 CTCTTTAAAGAGAAGGAGGGTGG - Intergenic
1146290189 17:31601170-31601192 CTTTATAAGAGGGAGGCAGGAGG + Intergenic
1146316436 17:31810833-31810855 CTTTATTAGAAGATGCAGTGTGG + Intergenic
1146366024 17:32228584-32228606 CTTTAGGAGACGAAGGCGGGCGG + Intronic
1147210458 17:38870027-38870049 GTTTATTAGGGGAAGGAGGGCGG + Exonic
1147752697 17:42745939-42745961 CTTAAAAAGAAGAGGGAGGCCGG - Intergenic
1148094620 17:45043815-45043837 CTATACAAGTGGAAGGAGGGAGG - Intronic
1148113673 17:45162165-45162187 CTTTCTGAGAGGAAGGAGGGAGG + Intronic
1148972777 17:51498815-51498837 CTTAATAAGAAGGAAGAGGGAGG - Intergenic
1149333108 17:55606808-55606830 ATTTTTAAGAAGCAGGAGGAAGG - Intergenic
1149620469 17:58041073-58041095 GTTTAAAAGAAGAGAGAGGGGGG - Intergenic
1149893163 17:60408160-60408182 ATTTATACCAAGAAGCAGGGGGG + Intronic
1150459055 17:65331931-65331953 CTTTATAAGAGGGAGACGGGAGG + Intergenic
1150979236 17:70122998-70123020 ATTTAAGAGCAGAAGGAGGGAGG - Intronic
1152260452 17:79263930-79263952 CTTTATAAGAGAAAGGAGGGAGG + Intronic
1152341018 17:79724920-79724942 CTTTGGAAGACGGAGGAGGGTGG + Intergenic
1152826530 17:82469473-82469495 CTCTATAAGCAAATGGAGGGAGG - Intronic
1153095985 18:1404029-1404051 CTTTTTTATAAGAAGGATGGTGG - Intergenic
1153691347 18:7597096-7597118 CTTTAGAAGGACAAGGAGGGTGG - Intronic
1154227193 18:12516169-12516191 CTTTATCAGAGGAAGGAGCAGGG - Intronic
1154464294 18:14629282-14629304 TTCCAGAAGAAGAAGGAGGGAGG - Intergenic
1155337373 18:24778443-24778465 ATTTATAAGAATAAGGAGTTGGG - Intergenic
1156253177 18:35371611-35371633 CTTTATAAGAAGAGGAAGAAAGG - Intronic
1156307818 18:35895231-35895253 CTTTATAAGATGAGAAAGGGAGG + Intergenic
1157149746 18:45204918-45204940 GTTTGTATGAAGAAAGAGGGAGG + Intergenic
1157872840 18:51246383-51246405 CTTTATAAGAAGAGGAAGGCCGG + Intergenic
1158696521 18:59708845-59708867 CCCTATAAGAAGAAGGAAGGTGG - Intergenic
1158942842 18:62421641-62421663 ATAGATAAGAAGAAGGAGAGGGG - Intergenic
1159133043 18:64302958-64302980 CATCCTAAGAAGAAGGATGGGGG + Intergenic
1159969258 18:74628821-74628843 CTTTTGAAGGACAAGGAGGGAGG - Intronic
1161530140 19:4783823-4783845 CTTTGGGAGGAGAAGGAGGGAGG + Intergenic
1161848757 19:6727780-6727802 CTTTATAAGAGGGAGGTGGGAGG - Intronic
1162539848 19:11288265-11288287 CTTTATAAGACATAGGAGAGGGG - Intergenic
1163023987 19:14498948-14498970 CTTTAAAAGAAAAAAGAGGCCGG + Intergenic
1163096809 19:15064627-15064649 CTTTATTAGCAGAATGAGGATGG - Intergenic
1163162120 19:15470938-15470960 CTCGAAAAGAAGAAGGAGGCCGG - Intronic
1163543256 19:17924641-17924663 CTTTGGAAGACCAAGGAGGGAGG - Intergenic
1164540031 19:29115326-29115348 CTTCATAAGAGGAGGGAGTGGGG + Intergenic
1165810167 19:38607258-38607280 TTGTATAAGAAGATGGAAGGAGG + Intronic
1166189351 19:41165475-41165497 CTTTGTAAGGCGAAGGTGGGCGG + Intergenic
1166208623 19:41290669-41290691 CTTTATCAAAAAAAGGGGGGCGG - Intronic
1167199020 19:48051091-48051113 CCTTATAAGAGCAAGGCGGGAGG + Intronic
1168050444 19:53825760-53825782 CTTTATAAGAAGAAGACAGGAGG + Intergenic
1168341455 19:55625580-55625602 CTATAAAAGAAGAAGAAAGGAGG - Intergenic
925550590 2:5069837-5069859 CTTTATAAGAAGAGGGGATGAGG - Intergenic
925915818 2:8604986-8605008 TTTAATAAGTAGAAGGAGGCAGG - Intergenic
925916297 2:8609019-8609041 CCTTATAAAAAGAGGGAGAGAGG - Intergenic
925934170 2:8737314-8737336 CTTAATAAGAGGAAGAAGAGAGG + Intronic
926084013 2:10009901-10009923 CTTTCCAAGCAGGAGGAGGGAGG + Intergenic
926142942 2:10379256-10379278 ATTTACAAGCAGAAAGAGGGAGG - Intronic
926814236 2:16784476-16784498 CCTTATAAGAAGAAGAAACGTGG + Intergenic
927144919 2:20157272-20157294 CTTTGAAAGGAGCAGGAGGGAGG + Intergenic
927642650 2:24855195-24855217 CTTCCTAAGAAGAAGGGGGTGGG - Intronic
927922709 2:26985794-26985816 CTTTATAAGCAGGAGGACAGAGG + Intronic
928290880 2:30036373-30036395 CTTTTCATGAAGAAGTAGGGAGG - Intergenic
928849290 2:35723809-35723831 CTTTGGAAGGCGAAGGAGGGAGG - Intergenic
929145898 2:38706862-38706884 CTTTAAAAAAAAAAGGGGGGCGG + Intronic
929195650 2:39181679-39181701 CCTTATAAGAAGAGGGAAGATGG + Intronic
930203397 2:48565346-48565368 CTGTATAAGAAGTCGGAGGCTGG - Intronic
931019990 2:58033343-58033365 CTTTCTAAGAAGGAAGAAGGAGG + Exonic
931330059 2:61271560-61271582 CTTTAAAAGGAGAAGAAAGGAGG + Intronic
931993185 2:67811182-67811204 CTTCATAAAATGAATGAGGGAGG - Intergenic
932312589 2:70755701-70755723 TTTTATGAGGAGAGGGAGGGAGG - Intronic
932689579 2:73900917-73900939 CTTTATAAGAAGAGGGAATTAGG - Intronic
933492767 2:83008712-83008734 CTTTATAAGAAGAGAGAGAGAGG + Intergenic
934122556 2:88854206-88854228 CCTTATAAGAAGAAGGAGATTGG - Intergenic
934164581 2:89282534-89282556 CCTTATAAAAAGAAGAAGGTGGG - Intergenic
934168869 2:89322269-89322291 CTTTATAATAGGGAGGAGTGGGG + Intergenic
934198422 2:89860315-89860337 CTTTATAATAGGGAGGAGTGGGG - Intergenic
934202693 2:89899990-89900012 CCTTATAAAAAGAAGAAGGTGGG + Intergenic
934960900 2:98671805-98671827 CTTTATGAAAGGAAGGAGGGAGG + Intronic
935433370 2:103002276-103002298 CTGTATGTGAATAAGGAGGGTGG + Intergenic
935550510 2:104448377-104448399 CTTTATTGGAAGAAGACGGGTGG - Intergenic
935859436 2:107312134-107312156 ATTTATAAGAAGGAGCATGGAGG + Intergenic
936826043 2:116582263-116582285 TTTTATAAGAAGAGAGAGAGGGG + Intergenic
938078260 2:128353614-128353636 CTTTACAAGAAGAGGAAGGGAGG + Intergenic
938479622 2:131648498-131648520 TTTTAAAAGAAGCAGAAGGGAGG + Intergenic
938747804 2:134296571-134296593 CTTTATAAGACTAAGGAAAGTGG - Intronic
939566633 2:143793300-143793322 TTTTAAAAGAAGATTGAGGGCGG - Intergenic
939743554 2:145940202-145940224 CCAAATAAGAAGGAGGAGGGAGG - Intergenic
939756654 2:146121583-146121605 CTTTAGGAGACCAAGGAGGGCGG + Intergenic
939856156 2:147361203-147361225 CTTTATAAAAACTATGAGGGAGG + Intergenic
940450095 2:153826242-153826264 ATTTATAAGAAGAGGAAGAGAGG - Intergenic
940502898 2:154516626-154516648 CTAAATATGAAGAAGGTGGGTGG - Intergenic
940740477 2:157502225-157502247 CTGTATAAGAAGCATGAGTGGGG + Intergenic
940866308 2:158820813-158820835 CTTTATAAGGAGAAGAAGGGAGG + Intronic
941242412 2:163055660-163055682 CTTTATAAAAAGAGGGACGTTGG - Intergenic
941342599 2:164326909-164326931 CCTTATAAGATGAAAGAGGCAGG - Intergenic
941457352 2:165725090-165725112 ATTGAGAAAAAGAAGGAGGGAGG + Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942544928 2:177053687-177053709 CTTAAAAAGAAGCAGGAGGCCGG - Intergenic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
944001353 2:194842488-194842510 CTTTATAAGCACAAGATGGGGGG - Intergenic
944270225 2:197775097-197775119 CTTAATAAGTAGAAAGAGTGAGG + Intronic
944832646 2:203548433-203548455 CTTTATAAGAGGGAGGCAGGGGG - Intergenic
945588115 2:211692676-211692698 CTTTATAAGAGGAAGGTAGAGGG - Intronic
945695591 2:213099207-213099229 CTTTATAAAAGAAAGGAGGATGG - Intronic
945940709 2:215946658-215946680 CTTTGTAAGATGAAGCAGGTTGG - Intronic
946013486 2:216585190-216585212 CTTTATAAGAAGAAGAAATGAGG + Intergenic
946197606 2:218044591-218044613 GTTTATCAGAGGATGGAGGGTGG - Intronic
946546337 2:220748667-220748689 ATTTGTATGAAGAAGGAGGAAGG + Intergenic
946775538 2:223136342-223136364 CTTTGTGAGAAGATGGAGGCTGG + Intronic
947280654 2:228450021-228450043 CTTTATAAGAAGAAGAAATTTGG + Intergenic
947692825 2:232155225-232155247 CTTTAGAAAATTAAGGAGGGGGG - Intronic
947737173 2:232461679-232461701 CTCAAAAAAAAGAAGGAGGGAGG + Intergenic
947737202 2:232461927-232461949 TTTTTTAAAAATAAGGAGGGAGG + Intergenic
947844272 2:233231693-233231715 CTTTATAAGAAGAGGAAGAAAGG - Intronic
947943933 2:234083568-234083590 CCTTATAAGAAGAGGAAGAGGGG - Intergenic
947960994 2:234237208-234237230 CTTTATAAGAAGGGGAAGAGAGG + Intergenic
948103012 2:235390362-235390384 CTTTATAAGAGGCAGGAGGTCGG - Intergenic
948478460 2:238236260-238236282 CTTTAAAAGTAGAAGTAAGGAGG + Intergenic
948737778 2:240020712-240020734 CTTGATAAGATGACGGGGGGAGG - Intronic
1168937442 20:1678208-1678230 CCTTATAAGAAGGAGGAGGCAGG - Intergenic
1169190910 20:3658803-3658825 CTTTGGAGGAAGAAGGAGGCAGG + Intergenic
1170095963 20:12646375-12646397 CTTTATAAGAAGAGGAAGAGAGG + Intergenic
1170236720 20:14114591-14114613 TTTTATAAGAAGATTGAGGAAGG + Intronic
1170380778 20:15757779-15757801 CCTTATAAGAAGAGGAAGAGAGG - Intronic
1170491333 20:16878450-16878472 CTTCATTGGATGAAGGAGGGTGG - Intergenic
1170715488 20:18827633-18827655 CTTTATAAGCAGAGGAAGAGAGG + Intronic
1170744942 20:19090997-19091019 CCTTAAGAGAAGAAGGAGAGAGG + Intergenic
1170925611 20:20720618-20720640 ATTTATAAAAAGACAGAGGGGGG - Intergenic
1171000687 20:21412836-21412858 CTGTCTAAAAAAAAGGAGGGAGG - Intergenic
1171965801 20:31529486-31529508 CTTTACAAGGCCAAGGAGGGTGG - Intronic
1172161412 20:32871151-32871173 ATTTAAAAGAAGAAGTAGAGAGG - Intronic
1172310830 20:33917211-33917233 CTTTATAAGAAGAGGAAGAGAGG + Intergenic
1172475899 20:35237413-35237435 CCTTATAAGAGGAAGGCAGGGGG - Intronic
1173019394 20:39254411-39254433 CACGAGAAGAAGAAGGAGGGAGG - Intergenic
1173404339 20:42752037-42752059 GAGTATAAGAAGAGGGAGGGAGG - Intronic
1173626154 20:44474469-44474491 CCTTATAAGAAGAGGGAAGCAGG + Intergenic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1173914701 20:46698338-46698360 CCTTAAAAGTAGAAGGAGGCAGG - Intergenic
1173925560 20:46778705-46778727 CTTTGCAGGAAGAGGGAGGGAGG - Intergenic
1173997936 20:47353785-47353807 CTTGATGAGAAAAAGAAGGGGGG + Intronic
1174060603 20:47830177-47830199 TTTTATAAGAAGAAAGAAGTAGG - Intergenic
1174062633 20:47843476-47843498 CTTTATAAGAGGAGGGCAGGAGG + Intergenic
1174071295 20:47901193-47901215 TTTTATAAGAAGAAAGAAGTAGG + Intergenic
1174075652 20:47934146-47934168 CCTTATAAGAGGACGGAAGGAGG - Intergenic
1174152758 20:48497468-48497490 TTTTATAAGAAGAAAGAAGTAGG - Intergenic
1174241375 20:49138039-49138061 CTTTTTAAGGACAAGGTGGGTGG + Intronic
1174590647 20:51641969-51641991 CTTTATGAGAGGAAAGTGGGAGG + Intronic
1174975530 20:55328857-55328879 CATTCTGAGAAGATGGAGGGAGG - Intergenic
1175299937 20:57935585-57935607 CTTTACAAGAAGAGGAAGAGAGG - Intergenic
1176674051 21:9760642-9760664 CTTAGTAGGAGGAAGGAGGGGGG - Intergenic
1177442115 21:21139132-21139154 CTTTATAAGAAAAAGGCAGAGGG + Intronic
1177952855 21:27560535-27560557 CTTTATATGAAGAAGGAATTTGG + Intergenic
1178174169 21:30077197-30077219 CTTATTAAGAGGAAGGAAGGAGG + Intergenic
1178490854 21:33050611-33050633 CTCCATAAGGAGAAGGAAGGAGG - Intergenic
1178642357 21:34355349-34355371 CCTTATAAGAAGCAGGCAGGGGG + Intergenic
1180480751 22:15750939-15750961 TTTTAAAAGAAGCAGAAGGGAGG + Intergenic
1181746648 22:24959697-24959719 CTGTACGAGAAGAAGGAAGGGGG + Intronic
1181988471 22:26818565-26818587 CTTTATAAGAAGCAGGCAGAGGG + Intergenic
1182041181 22:27240014-27240036 CTTAATCAGAAGAAGGTGAGAGG - Intergenic
1182096442 22:27629214-27629236 CCTTATAAGAGGAAGGCAGGAGG - Intergenic
1182440444 22:30360666-30360688 CTTTGGAAGACCAAGGAGGGTGG + Intronic
1182821477 22:33220526-33220548 CTTCAAATGAAAAAGGAGGGAGG - Intronic
1183868179 22:40720739-40720761 CCTTATAAGAAGTGGGAGGCCGG - Intergenic
1184571027 22:45325091-45325113 CGTCATAGGAAGAAGAAGGGAGG + Intronic
1185051265 22:48555531-48555553 CTTTATGGGAAGAGGGAGAGAGG + Intronic
1185211173 22:49571373-49571395 GTTTTTAAAAAGCAGGAGGGTGG + Intronic
949476180 3:4448035-4448057 CTTTAAAAAAAAAAGTAGGGCGG + Intronic
949824522 3:8151500-8151522 GTATATAACAAGAAGGAGGAAGG + Intergenic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
950403648 3:12790516-12790538 ATTCAGAAGAAGAAGAAGGGTGG + Intergenic
950772079 3:15320014-15320036 CTTTATTGGAAGAAGAAAGGGGG - Intronic
950847771 3:16031461-16031483 CTTAATAAAAAGGAGGAGGTAGG + Intergenic
951969170 3:28423846-28423868 CTATTTGAGAGGAAGGAGGGTGG - Intronic
952325654 3:32318374-32318396 CTTTATGAGAGGAGGAAGGGTGG - Intronic
952836190 3:37604207-37604229 CTTTAAATGGAGAAGGAGTGGGG + Intronic
953477492 3:43218049-43218071 CTTCTTTAGAAGAAGGGGGGCGG - Intergenic
954504134 3:51052260-51052282 CTTTAAAAGACCAAGGTGGGTGG + Intronic
955148201 3:56341216-56341238 CTTTGTAAGATGGAGGAAGGTGG - Intronic
955513540 3:59705230-59705252 CTGTATAAGAAGAAAAAGTGTGG + Intergenic
955572095 3:60319021-60319043 CTTTGTAAGAAGAGGAAGGCAGG - Intronic
956330451 3:68101160-68101182 CTGTATCAGAGGATGGAGGGTGG - Intronic
957245498 3:77711359-77711381 CTTTATAAGAAAAAGGCAGAGGG - Intergenic
957812365 3:85241348-85241370 CTTTATAAGAAGAAATAGTCTGG + Intronic
958414302 3:93855561-93855583 CTTTATAAGGAGAGGAAGAGAGG - Intergenic
959119024 3:102211114-102211136 TTTTATAAACAGAAGGAAGGTGG + Intronic
960892045 3:122459434-122459456 CTTTGTAGGAAGAGGGAGGTAGG - Intronic
961471667 3:127117504-127117526 GTTTTTGGGAAGAAGGAGGGAGG - Intergenic
961626469 3:128267263-128267285 CTTTATAAGGACAAAGAGGGTGG - Intronic
962079542 3:132122694-132122716 CTTTATAAAATGAATTAGGGAGG - Intronic
963306272 3:143656932-143656954 TTTTCTAAGAAGGAGGATGGAGG + Intronic
963580612 3:147122548-147122570 CTGTATATGCAGAAGGAGAGTGG - Intergenic
963783599 3:149511047-149511069 CTCTACAAAAAGAAGGAGGCTGG - Intergenic
963985330 3:151586849-151586871 CATTATAAGAAAATGGAGAGGGG + Intergenic
964431742 3:156614355-156614377 CTTCATAATAGGAAGGAGGCTGG + Intergenic
965565402 3:170111248-170111270 CTTTAAAACAAGAAGAAGGAAGG + Intronic
965636349 3:170785334-170785356 CTTTAGAAGACCAAGGTGGGAGG + Intronic
966509810 3:180749322-180749344 CTTTAAGAGCAGAAGGAGGGTGG + Intronic
967276971 3:187785412-187785434 CTTTAGAAGACCAAGGAGGGAGG - Intergenic
967337461 3:188360469-188360491 CTTCATGAGAAGAAAGAGAGAGG - Intronic
967839105 3:193990384-193990406 CTTTATAAGAAGAAGAAGAGAGG - Intergenic
968075825 3:195815767-195815789 CTGTGTAAGAAGAAGGAGGCCGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968076255 3:195817343-195817365 CCTTGTAAGGAGAAGGAGGCCGG - Intergenic
968076280 3:195817431-195817453 CCTGGTAAGAAGAAGGAGGCTGG - Intergenic
968825236 4:2891150-2891172 CTTTTTAAGATAAAGGAGGCTGG + Intronic
969033527 4:4231957-4231979 CTTTATAAGAAGAGGAAAAGAGG - Intergenic
969233503 4:5848819-5848841 CTTTATAAGGAGAAGAAGAGAGG - Intronic
969305913 4:6326247-6326269 GTGTGTAAGAAGAAGCAGGGAGG + Intronic
970010574 4:11454576-11454598 GTGTATCAGAAGAAGGAGGCTGG + Intergenic
970274776 4:14386511-14386533 CTTTAGAAGAGGGAGGATGGAGG - Intergenic
970560693 4:17279352-17279374 CTCTATAAGGAGAAGGAGATGGG - Intergenic
970705405 4:18795573-18795595 TTTTATAAGGAGAAGAAGAGAGG - Intergenic
970719243 4:18966957-18966979 ATTTGTAGGAAGAAAGAGGGAGG + Intergenic
970760466 4:19480259-19480281 GTTAATAGGCAGAAGGAGGGAGG - Intergenic
970926716 4:21460607-21460629 CTTTATAAGAAGAGGAAGAGAGG - Intronic
971040561 4:22747386-22747408 CTTTAGAAGACCAAGGAGGTTGG + Intergenic
971446712 4:26758139-26758161 TTTTATAAGAACAAGGAGAAGGG - Intergenic
971806650 4:31367007-31367029 CTCTGTAAGATGAAGGAGGAAGG + Intergenic
971893803 4:32563159-32563181 CTTTATAAGAGGAAGGTAGTGGG - Intergenic
972364520 4:38361760-38361782 CTTTATAAGAAGAAGAAGAGAGG + Intergenic
972388010 4:38586521-38586543 CCTTAAAAGAAGGAAGAGGGAGG - Intergenic
972636239 4:40886533-40886555 CTGTAAAAGAATAAGGAGGAAGG + Intronic
973598605 4:52518338-52518360 CTTTGGAAGAACAAGGCGGGTGG - Intergenic
973604930 4:52577121-52577143 CTTTATGAGATGAAGCAGTGTGG - Intergenic
974873933 4:67679164-67679186 CTTTATATGAGAAAGGTGGGAGG + Intronic
975077297 4:70226992-70227014 ATTTAGAAGAAGAAAGAGGCAGG - Intronic
975257750 4:72257590-72257612 ATTTGTGTGAAGAAGGAGGGTGG - Intergenic
976897000 4:90125396-90125418 CATTGTAAAAAGAAGGAGGGAGG + Intergenic
976997552 4:91454427-91454449 CCTTATAAGTAGAAGGTGGAGGG - Intronic
977019603 4:91743085-91743107 CTTTATAAAATGAATTAGGGAGG + Intergenic
977269856 4:94903751-94903773 CCTTATAAGAAGAAGGTGTTAGG + Intronic
977971237 4:103217022-103217044 CTTAAAAAGAAGATTGAGGGAGG + Intergenic
978042396 4:104084188-104084210 CTTTGTAAGAACAAAGATGGAGG + Intergenic
978291167 4:107142512-107142534 CTTTATAAGAAGAGGAAGAAAGG + Intronic
978737654 4:112102406-112102428 CTTTATAAAGATAAGGTGGGGGG + Intergenic
979089400 4:116462191-116462213 CATTATGAGAAGAGGAAGGGAGG - Intergenic
979230621 4:118345324-118345346 ATTTGTAAGAAGGAGGAGGAGGG + Intronic
980770497 4:137365520-137365542 CAATATAAGAGAAAGGAGGGAGG + Intergenic
981956046 4:150475651-150475673 CTTTAGAAGGCTAAGGAGGGAGG + Intronic
982494591 4:156074945-156074967 TTTTGTAAGAAAAAGGGGGGGGG - Intergenic
983196340 4:164811036-164811058 CTGTCTAAAAAGAAGGAAGGAGG + Intergenic
983634519 4:169883522-169883544 CTTTATAAGAAGAAGAAGAGAGG + Intergenic
984256111 4:177391952-177391974 CTGTATAGGAAGTTGGAGGGGGG + Intergenic
984364833 4:178785135-178785157 CTTTTGAAGAAGAAGTAGGAAGG - Intergenic
984444406 4:179817003-179817025 TTTTAAAAGAAGAAGGTTGGAGG + Intergenic
984549021 4:181138824-181138846 GATTAAAAGAAGAAGGGGGGTGG - Intergenic
984942541 4:184946270-184946292 CTTTTTCAGAAGATGGAGGCTGG - Intergenic
985101672 4:186464226-186464248 GTCTTTAAGAAAAAGGAGGGGGG + Intronic
985362786 4:189193148-189193170 CTTTGGGAGGAGAAGGAGGGTGG - Intergenic
986231582 5:5869101-5869123 CTTTATAAGAGGAAGGCAGAGGG - Intergenic
986396455 5:7335588-7335610 CTTTATAAGGAGAGGAAGAGAGG - Intergenic
986468506 5:8050689-8050711 CTGTATAAGAAGGAGAAGGAAGG + Intergenic
986577821 5:9230683-9230705 TTTTATAAAATGATGGAGGGTGG + Intronic
987036093 5:14019816-14019838 CTTTGTAGGAAGGAGGAAGGTGG + Intergenic
988258579 5:28852213-28852235 CTTTATAAGAAGGAGAAGTTGGG + Intergenic
988443934 5:31263581-31263603 CTTTATAAGAAGAGGAAGAGAGG - Intronic
990611036 5:57457083-57457105 CTTTATCAGAAAAAGGATGTAGG - Intergenic
990708654 5:58558374-58558396 CTTGATCAGAAGAAGGAGGAAGG - Intergenic
990747730 5:58978067-58978089 ATTTACAAGAAGTAGGAGAGAGG - Intronic
991479465 5:67061704-67061726 CTTGTTAAGCAGAAAGAGGGAGG - Intronic
991960058 5:72035354-72035376 CTTTGAAAGAAGGAGGAGGAGGG - Intergenic
992233242 5:74684060-74684082 CTTTGGAAGGCGAAGGAGGGCGG - Intronic
992233572 5:74685726-74685748 CTTAAGAAGCAGTAGGAGGGTGG - Intronic
992318750 5:75588820-75588842 CCTTATAAGAAGGAGGCAGGAGG - Intronic
992444841 5:76824162-76824184 CTTTAAAAAAAAAAGGGGGGGGG - Intronic
993204533 5:84863058-84863080 GTTTATCAGAAGAATGAGAGTGG + Intergenic
994175391 5:96705074-96705096 CTTTAGAAGGCCAAGGAGGGAGG + Intronic
994184440 5:96802819-96802841 CCTTATAAGAAGATGGAGACTGG + Intronic
994195544 5:96918882-96918904 CCTTAAAAGAAGGAGGTGGGGGG - Exonic
994673043 5:102785252-102785274 CTTAATAAGAAAAGGGAGGGGGG + Intronic
997828633 5:137129989-137130011 CTTTGAAAGAAGGATGAGGGGGG - Intronic
999230748 5:150060535-150060557 CTTCATAAGAGGTAGGCGGGGGG + Intronic
999537672 5:152535308-152535330 CTTTATAAGAGGAGGAAGAGAGG + Intergenic
999966556 5:156816461-156816483 TTTTATAAGAGGAAGGCGGTTGG + Intergenic
1000019249 5:157304409-157304431 TTTAATAAGAAGAAGGTGAGAGG - Intronic
1000153906 5:158531735-158531757 CTTTAAAAGAAAGAGGAGAGAGG + Intergenic
1000285592 5:159823692-159823714 CTTTATAAGAAGTGAGAGAGAGG - Intergenic
1000575979 5:162975788-162975810 CCTTATAAGCAGAAGCAAGGTGG - Intergenic
1000688688 5:164287240-164287262 GTTTATAAGATGAAGGAATGAGG + Intergenic
1000834004 5:166133591-166133613 CTTTTTAACAGGAAGGATGGGGG + Intergenic
1000925413 5:167187800-167187822 CTTTATAATGGGAAGGAGGGTGG - Intergenic
1001417744 5:171558974-171558996 CTTTATTAGAACAAGGAGCTAGG - Intergenic
1001694960 5:173663192-173663214 CTTTTTCAGGAGAAGGAAGGGGG + Intergenic
1001888586 5:175319072-175319094 CTTTATAAGAAGAGAGAGAGCGG + Intergenic
1002660214 5:180786635-180786657 CGTTTTAGGAAGAAGGAGGAAGG - Intergenic
1004578693 6:16925965-16925987 CTTTATCAGAAAGAGGAGAGAGG - Intergenic
1004690812 6:17990580-17990602 CTTTATTAGAGAAAGGAGAGGGG + Intergenic
1006693079 6:35907403-35907425 CTTTAAAATAAGATGGAGTGAGG + Intronic
1006782469 6:36641331-36641353 CTTTATAAGAAAAGGAAGTGTGG + Intergenic
1006790993 6:36701094-36701116 CTTTCTAATAAAAAGCAGGGAGG - Intronic
1007291690 6:40792049-40792071 CTTTATAAGAATGAGGCAGGAGG + Intergenic
1007754240 6:44088544-44088566 ATTTAAATGAAGAAGGAGGCTGG - Intergenic
1007859444 6:44892283-44892305 CTTTATAAGATGAGGAAGAGAGG + Intronic
1008250623 6:49235448-49235470 CTTCATGAGAAAAAGGAGGAAGG - Intergenic
1008669412 6:53751934-53751956 CTTTATTAGCAGAAGGGAGGAGG + Intergenic
1008677670 6:53837732-53837754 CTTTCTAAAAAGCAGAAGGGAGG + Intronic
1008761608 6:54858810-54858832 CTTTGTCAGAAGAAGAAAGGTGG - Intronic
1008881234 6:56382611-56382633 TTTTATAAGAAGAGGAAGAGAGG + Intronic
1010928358 6:81770663-81770685 CTTTATAAGAAGAAGAGTGAGGG - Intergenic
1011266231 6:85522322-85522344 CTTTAGAAGAAGAACAAGGTTGG - Intronic
1011436575 6:87344446-87344468 TTTTATAAGAAGAGGAAGAGAGG + Intronic
1011735613 6:90308115-90308137 CTTTTTAAGAGGGAGGAGGAGGG - Intergenic
1012558755 6:100551439-100551461 TTTTAAAAGAAAAAGGAAGGAGG + Intronic
1013277519 6:108600020-108600042 TTTTATATGTATAAGGAGGGTGG + Intronic
1013580469 6:111529175-111529197 CTTTATAAGTAGATAGAGTGGGG + Intergenic
1014337136 6:120150699-120150721 CTTCATCAGATGAAGTAGGGAGG - Intergenic
1014484121 6:121978091-121978113 CTTTAAGAGAATAGGGAGGGAGG + Intergenic
1014550415 6:122783984-122784006 GTTTATAAAAAAAAGGGGGGGGG - Exonic
1014584915 6:123186079-123186101 CTTTATAAGATGAGTTAGGGCGG - Intergenic
1014936430 6:127390447-127390469 ATTACTAAGAAGAAGGAAGGAGG + Intergenic
1015648117 6:135418537-135418559 CTTTACAGGAGGAAGGACGGAGG + Intronic
1016005007 6:139080173-139080195 CTTTCTAATCAGAAGGAGGAGGG + Intergenic
1016659861 6:146565824-146565846 CTTTATAAGAAGAGGAAGAGAGG - Intergenic
1017634189 6:156427418-156427440 CTTTCTTACAAGAAGGAAGGAGG - Intergenic
1018306713 6:162464895-162464917 TTTATTAAGAAGGAGGAGGGGGG - Intronic
1020462615 7:8442131-8442153 ATTTATAGGAAGAAGGAGCTAGG - Intronic
1021453074 7:20799341-20799363 ATTTATAAAGAGAAGGTGGGAGG - Intergenic
1021969806 7:25954398-25954420 CTTTAAAAGAAGCAGGCAGGAGG - Intergenic
1022067920 7:26879802-26879824 CTTTATAAGATAGAGGAAGGAGG + Intronic
1022854073 7:34298368-34298390 CTTTGTGGGAAGAAGGTGGGAGG - Intergenic
1023055578 7:36287299-36287321 CTATATAAGAAGGAGGTGGAAGG - Intronic
1023148237 7:37174197-37174219 CTTTATAGGAAAAAGGAAGTGGG - Intronic
1023302183 7:38784627-38784649 CTATATCGAAAGAAGGAGGGGGG + Intronic
1023420851 7:39977999-39978021 GTATTTAAGGAGAAGGAGGGTGG + Intronic
1023576304 7:41631257-41631279 CCTTATAAGAAGAGGAAGAGAGG - Intergenic
1024115649 7:46190566-46190588 CTTTAGAAGGCTAAGGAGGGTGG - Intergenic
1025909828 7:65819411-65819433 CTTTATAAGAGAAAGGAGGTAGG + Intergenic
1026613585 7:71882298-71882320 CTTCATAAGAGGAAGGCAGGAGG - Intronic
1026808625 7:73443864-73443886 TTTGGTAAGAAGGAGGAGGGGGG + Intronic
1027844943 7:83361063-83361085 CTTTATAAGAAGAGGAAGGGAGG - Intergenic
1028965916 7:96800992-96801014 CTTTATAAATTGATGGAGGGAGG + Intergenic
1029532523 7:101134883-101134905 CTTTAGAAGAAGAACCAGGCCGG + Intronic
1029641918 7:101826443-101826465 CTTTAGGAGACCAAGGAGGGAGG - Intronic
1029812042 7:103059014-103059036 CTTTATGAGACCAAGGTGGGAGG + Intronic
1029890950 7:103930261-103930283 CATTATAAGAAGAAGAAATGTGG - Intronic
1029985323 7:104917518-104917540 CATTATTAGAAGATGGGGGGTGG + Intergenic
1030286388 7:107831275-107831297 CCTTATAAGAAGGAGGTGGAAGG + Intergenic
1030996885 7:116370507-116370529 CTTTATAAGAAGAAGAAGAGAGG + Intronic
1031593063 7:123617672-123617694 CTTTATTAGAAAAGGGAGTGTGG + Exonic
1032642362 7:133783983-133784005 CTTTAAGAGCAGAAGGATGGGGG - Intronic
1033766724 7:144501280-144501302 CTTTACCAAAAGAAGGAGAGAGG - Intronic
1035863900 8:3060430-3060452 CTTTGTGAGACGAAGGTGGGTGG - Intronic
1037747373 8:21657567-21657589 TTTTATAAGAAAAAAAAGGGAGG - Intergenic
1038052964 8:23830741-23830763 GCATATAAGAAGAAAGAGGGTGG + Intergenic
1038245109 8:25848157-25848179 CTTTAAAAGAAGAAGGGGCCAGG - Intronic
1038276729 8:26127527-26127549 CTTTATAAGAAGAGGAAGTTTGG - Intergenic
1038430947 8:27499094-27499116 CTTTATAAGAAGTGGAAGTGAGG - Intronic
1039099347 8:33924202-33924224 CTTTATAAGAAGGAGGAAATTGG - Intergenic
1039461473 8:37749147-37749169 GTTTCCAAGAAGAAGGAAGGTGG - Intronic
1040847506 8:51859234-51859256 CTTTAAAAAAAAAAAGAGGGGGG - Intronic
1041093087 8:54321989-54322011 CTAACTAAAAAGAAGGAGGGAGG + Intergenic
1041754679 8:61300916-61300938 GTTTATAAGAAGAAAGTGGTAGG - Intronic
1041958482 8:63583727-63583749 CCTTTTAAGAAGGAGGGGGGTGG + Intergenic
1042127691 8:65555256-65555278 CTTTATAAGAGGGAGGCAGGAGG - Intergenic
1042259886 8:66847619-66847641 CTTTTTAAAAAGAAGGGGAGGGG - Intronic
1042325097 8:67519986-67520008 CTTTATAAGAAAAAGCATGTTGG + Intronic
1042576499 8:70226240-70226262 GTTTATAATAAGAAGGAAGAGGG + Intronic
1043194979 8:77280714-77280736 CTTTGTAAGAAGAAGCAGTTTGG - Intergenic
1044689061 8:94858967-94858989 GTTTAAAATAAGAAGGAGGCTGG + Intronic
1044743748 8:95352748-95352770 CTTTATGAGAAGAAAGGGGGAGG - Intergenic
1044884576 8:96763101-96763123 CTTTATAAGAAGAGGAAAGTTGG - Intronic
1046170906 8:110504370-110504392 GGTTACAAGAGGAAGGAGGGTGG - Intergenic
1046344134 8:112900724-112900746 CTTTAAAAGAAGAAGAATGAGGG + Intronic
1046398352 8:113671253-113671275 CTTTGAAAGATGAAGGAAGGAGG - Intergenic
1047124526 8:121945950-121945972 CTTTATAAGAGGAGGGCAGGAGG - Intergenic
1047649185 8:126901205-126901227 CTTTAAAAAAAGATGGAGGCTGG + Intergenic
1047826096 8:128577423-128577445 TTTTATAAAAAGATGGAGAGAGG + Intergenic
1047907154 8:129484391-129484413 CTTTATGAGATGAGGGTGGGGGG + Intergenic
1048220985 8:132541807-132541829 TATTATAAGAAGATGGAGTGAGG + Intergenic
1048407281 8:134136645-134136667 CTTTATAAAAAGAAGATGAGGGG + Intergenic
1048974830 8:139665373-139665395 CTTTATAAGAGGGAGGCAGGAGG - Intronic
1050042055 9:1506363-1506385 TTTTAAAAGGAGAGGGAGGGAGG - Intergenic
1050751054 9:8937702-8937724 TTTTGTAAGAAGGAGGAGGAAGG - Intronic
1050972037 9:11890091-11890113 CTTTATAGAATGATGGAGGGAGG + Intergenic
1051421968 9:16897712-16897734 CTTTATTAGAAGCAGGAGAATGG - Intergenic
1051972123 9:22901608-22901630 CCTTATAAGAAGAAGAAAGAGGG + Intergenic
1052048008 9:23817353-23817375 CTTTATGAAGAGAAGGATGGGGG - Intronic
1052875607 9:33559988-33560010 ATCTATACGAAGAAGGTGGGTGG - Intronic
1053730914 9:41056107-41056129 CTGGAACAGAAGAAGGAGGGCGG - Intergenic
1054354326 9:64047047-64047069 AGTTATAATAGGAAGGAGGGTGG - Intergenic
1054697599 9:68375983-68376005 CTGGAACAGAAGAAGGAGGGCGG + Intronic
1054908015 9:70427672-70427694 TTTTATAAGAAGGAGGCGGGAGG + Intergenic
1055093659 9:72388306-72388328 CTTTATAAGAAGAGAAAGAGAGG - Intergenic
1055112662 9:72575077-72575099 CTATATAAGTAGAAAGATGGAGG - Intronic
1055618868 9:78102585-78102607 CTTTAGAAGAACAATTAGGGTGG - Intergenic
1055710853 9:79060526-79060548 CTTCATAAGAGGCAGGCGGGAGG - Intergenic
1055725751 9:79226394-79226416 TTTTAAAAGGAGAAGGAGGAAGG - Intergenic
1055824707 9:80309467-80309489 CTTTATGATAAGAATGAAGGTGG - Intergenic
1055905512 9:81289268-81289290 CTTTATAGGATGAATTAGGGAGG + Intergenic
1056849627 9:90071457-90071479 ATTTATAAGAAGAGGAAGAGAGG - Intergenic
1057033075 9:91793395-91793417 CTTTTTATGAAGAAGGAGATAGG - Intronic
1057111188 9:92472713-92472735 CTATATGGGAAGAAGAAGGGGGG + Intronic
1057551175 9:96051771-96051793 CCTTATAAGAAGAGAGAGGAGGG + Intergenic
1058664481 9:107297764-107297786 CTTTATATCAAAAATGAGGGAGG - Intronic
1059633785 9:116153697-116153719 CATTTTGAGAAGAAGGAGGGAGG + Intergenic
1059983584 9:119799530-119799552 CTTTATAAGAGGGAGGCTGGAGG - Intergenic
1060928269 9:127471040-127471062 CTTTAAAAGAAAGTGGAGGGGGG + Intronic
1062215905 9:135389771-135389793 GCTCATATGAAGAAGGAGGGGGG + Intergenic
1185558703 X:1041475-1041497 CTTTATAAGAAGAAGACATGAGG + Intergenic
1185800703 X:3007899-3007921 CTTTATAAGAAGAGGAAATGAGG - Intronic
1186586104 X:10874777-10874799 CTTTATAAGAAGAGGAAGACAGG + Intergenic
1187171893 X:16860269-16860291 CTTTAAAAAAAAAAGGGGGGGGG + Intronic
1187710659 X:22050332-22050354 CTTTGGAAGAACAAGGCGGGTGG + Intronic
1188540172 X:31241094-31241116 CTTTATAACAAGAAGTACAGGGG - Intronic
1189532674 X:41902464-41902486 CCTTATAAGAGGAAGGCAGGAGG - Intronic
1190103442 X:47541037-47541059 GTTTATAACAAAAAGGAGGGTGG + Intergenic
1190139889 X:47833550-47833572 CTTTATAAGAAGAGGAAGAGAGG + Intergenic
1190759198 X:53425689-53425711 TTTTGAAAGAAGAAGGAGTGAGG + Intronic
1190878501 X:54476268-54476290 GTTTCTAGGAAGGAGGAGGGGGG - Intronic
1191755536 X:64588524-64588546 CCTTATAAAAAGAAGGCAGGAGG - Intergenic
1192005852 X:67211418-67211440 CTTTATATAAAGAAGGAGAAAGG + Intergenic
1194825390 X:98556293-98556315 CTTTATTAGAAGCATGAGGATGG - Intergenic
1195485156 X:105396316-105396338 CTTTATTAAAAAAAGGAAGGAGG - Intronic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1195962129 X:110397144-110397166 CTTTGGAACAAGAAGGAGGCAGG - Intronic
1196267485 X:113667429-113667451 CATTATTAGCAAAAGGAGGGTGG + Intergenic
1196283412 X:113851113-113851135 CTTTATAAGAAGAGGAAGACAGG + Intergenic
1196480748 X:116144650-116144672 CTTTAGAAGAAAAATGATGGAGG - Intergenic
1197685561 X:129436096-129436118 CTATATAAAAAGAAGATGGGAGG + Intergenic
1198036294 X:132804501-132804523 ATTCATAAGAAAAAGGGGGGTGG + Intronic
1198406277 X:136315785-136315807 CTTTATAAGAAGAAAAAGTGTGG + Intronic
1198432763 X:136584419-136584441 GGGTATAAGAAGAAGGTGGGGGG - Intergenic
1198877350 X:141241813-141241835 CTTCATGAGAAGAAGGAATGCGG + Intronic
1198908033 X:141584034-141584056 CTTCATGAGAAGAAGGAATGCGG + Intronic
1198908758 X:141590390-141590412 CTTCATGAGAAGAAGGAATGCGG - Intronic
1198918312 X:141697761-141697783 CTTCATGAGAAGAAGGAATGCGG + Intronic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199381613 X:147178741-147178763 CTTTGTAAGAACATGGAAGGGGG + Intergenic
1199384804 X:147211439-147211461 TCTTATAAGTAGAAGGAAGGTGG - Intergenic
1199385672 X:147220402-147220424 CCTTATAAGTAGAAGGAAGGTGG - Intergenic
1199605383 X:149574036-149574058 CTTTATAAGACGAATGGTGGAGG - Intergenic
1199633738 X:149795332-149795354 CTTTATAAGACGAATGGTGGAGG + Intergenic
1199735978 X:150687097-150687119 CTTTACAAGAAGAGGAAGAGAGG - Intergenic
1199737469 X:150696984-150697006 CTTTATCAGAAGAAGGGGGAAGG + Intronic
1199799910 X:151240323-151240345 CTGTATTAGGAAAAGGAGGGAGG - Intergenic
1200291921 X:154883678-154883700 CTTTATAAGAATAGGAAGAGAGG - Intronic
1200338759 X:155379415-155379437 CTTTATAAGAATAGGAAGAGAGG - Intergenic
1200347710 X:155461277-155461299 CTTTATAAGAATAGGAAGAGAGG + Intergenic