ID: 1084720057

View in Genome Browser
Species Human (GRCh38)
Location 11:70899727-70899749
Sequence CTGAGCCAGCACAACCATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 223}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084720057_1084720063 11 Left 1084720057 11:70899727-70899749 CCCTGATGGTTGTGCTGGCTCAG 0: 1
1: 0
2: 1
3: 20
4: 223
Right 1084720063 11:70899761-70899783 GCCTCCCTGCCCACAGGCCCAGG 0: 1
1: 1
2: 12
3: 92
4: 805
1084720057_1084720062 5 Left 1084720057 11:70899727-70899749 CCCTGATGGTTGTGCTGGCTCAG 0: 1
1: 0
2: 1
3: 20
4: 223
Right 1084720062 11:70899755-70899777 CACTAGGCCTCCCTGCCCACAGG 0: 1
1: 0
2: 0
3: 20
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084720057 Original CRISPR CTGAGCCAGCACAACCATCA GGG (reversed) Intronic
907208108 1:52793120-52793142 GTGAGCCAGCACACCCAGCCTGG + Intronic
907425956 1:54379463-54379485 CTGAGACAACAGAACCCTCAGGG + Intronic
907928914 1:58980785-58980807 ATGAGCCAGCATACCCAGCATGG - Intergenic
907936658 1:59047842-59047864 GTGACCCAGCACAAACCTCAGGG - Intergenic
908824314 1:68118591-68118613 GTGAGCCACCACAACCAGCCGGG - Intronic
910547454 1:88433722-88433744 CTGACCCAGCACAGTCATAATGG + Intergenic
912199148 1:107436693-107436715 CTGAGCCATTACAACGATCATGG - Exonic
915845185 1:159255598-159255620 CAGAGCCAGCTCAGCCTTCAGGG - Intergenic
916455402 1:164965991-164966013 CTGAGCCAGCACGCCCAGCCTGG - Intergenic
919242349 1:194931319-194931341 CTGAGCCAGAACCACCTACATGG - Intergenic
919287695 1:195585421-195585443 CTGACTCAGCACAGCCATTAAGG + Intergenic
920088180 1:203433114-203433136 GCGATCCAGCACAACCATCCTGG - Intergenic
922531181 1:226346489-226346511 CTGAGCCACCGCATCCAGCAGGG - Intergenic
923255876 1:232220959-232220981 CTGACCCAGAACACCCACCATGG - Intergenic
924078267 1:240363861-240363883 CTGAGCCAGCATGACCAGCATGG - Intronic
924290416 1:242530223-242530245 CTGAGCCAACACGACAACCAGGG - Intergenic
1063396446 10:5692642-5692664 CTGAGCCCGTACAGCCAACAGGG - Intronic
1064322904 10:14322230-14322252 CTGAGGCAGCAGAAGCAGCATGG + Intronic
1069948094 10:72001135-72001157 CAGAGCCAGCCCAACCTTCTAGG - Intronic
1071558239 10:86623609-86623631 CTGAGCCACCACACCCAGCCTGG - Intergenic
1072180988 10:92979645-92979667 GTGAGCCACCACAGCCAGCAAGG - Intronic
1072520622 10:96227105-96227127 GGGAGGGAGCACAACCATCAGGG + Intronic
1073419455 10:103412663-103412685 CTGAGACAGCCCAGCCAACATGG - Intronic
1075379834 10:122010169-122010191 CTGTTCCAGCACAAACAACATGG - Intronic
1075852446 10:125600278-125600300 GTGAGCCAGCACAACCTCCCTGG - Intronic
1075885989 10:125899491-125899513 GTGAGCCAGCACACCCAGCCTGG + Intronic
1076602149 10:131664258-131664280 CTCATCCAGCAAAACCATCTGGG - Intergenic
1078535217 11:12167558-12167580 CTGAGCCAGCGCAGCCATGATGG - Intronic
1078908863 11:15712448-15712470 GTGAGCCAGCACACCCAGCCAGG - Intergenic
1079029854 11:16978439-16978461 CTGAGCAAACCCAACCATGATGG + Intronic
1079385779 11:19978105-19978127 GTGAGCCACCACACCCAGCAAGG + Intronic
1080019708 11:27547284-27547306 CTGACCCAGCATATCCATCCTGG + Intergenic
1080210423 11:29779552-29779574 CTGAGGCATCACAAGCCTCAGGG + Intergenic
1080574221 11:33583589-33583611 CAGAGCCTGCAGAAACATCAGGG + Intronic
1082295908 11:50441065-50441087 CTAAGCCAGCTCAACAAACATGG + Intergenic
1083081754 11:60101321-60101343 GTGAGCCACCACAACCAGCCCGG - Intergenic
1083342189 11:61965991-61966013 CTGAGCCACCGCACCCAGCAGGG - Intronic
1084720057 11:70899727-70899749 CTGAGCCAGCACAACCATCAGGG - Intronic
1087315207 11:96594153-96594175 CTGAACTAGCAAAACCATAAAGG - Intergenic
1088332058 11:108664618-108664640 CTGAGGAAGTACAACCACCATGG + Intergenic
1088920445 11:114257001-114257023 GTGACCCAGCACGACAATCATGG - Intergenic
1090073259 11:123562065-123562087 ATGAGCCAGCACACCCAGCCAGG - Intronic
1090276882 11:125426475-125426497 GTGAACCAGCACAGCCAGCACGG + Intronic
1092284754 12:7122293-7122315 CTAAGGGAGCACAAGCATCAGGG - Intergenic
1093768872 12:22997068-22997090 GTGAGCCACTACAACCAGCATGG + Intergenic
1096763881 12:53867233-53867255 CTGAGTCAGAGCAAGCATCAGGG + Intergenic
1097247943 12:57616905-57616927 CTGAGTCAGCACCACCCCCATGG - Exonic
1098038832 12:66334177-66334199 GTGAGCCACCACACCCAGCAGGG - Intronic
1098107768 12:67088690-67088712 ATGAGCCAGCAAACCCAACAGGG - Intergenic
1098208160 12:68134625-68134647 CTGAGCCAGCACCAAGAGCATGG + Intergenic
1098526780 12:71495513-71495535 CTGAGCAAGCAAAACCAGCTAGG - Intronic
1100594583 12:96060972-96060994 GTGAGCCACCGCAACCAGCAAGG - Intergenic
1103177420 12:118876854-118876876 CTGAGCAAGAACAAGCAGCAAGG + Intergenic
1109309236 13:60672448-60672470 CTGAGCCACACCACCCATCATGG - Intergenic
1110638224 13:77790952-77790974 CTGAGCCACCTCACCCTTCATGG + Intergenic
1112567402 13:100563248-100563270 CTGATCCAGAACACCCAGCACGG + Intronic
1113430113 13:110242716-110242738 CAGAGCCAGCACAGCCACCCTGG + Exonic
1113845032 13:113382482-113382504 CTAAACTAGCACAACCATTATGG - Intergenic
1114907797 14:27151952-27151974 CTGAGCCAACCCACCCATCTGGG - Intergenic
1115245362 14:31288803-31288825 CTGAGCCACCACACCCAGCCTGG - Intergenic
1116280172 14:42896518-42896540 ATGAGCCACCACACCCAGCAAGG + Intergenic
1117824431 14:59687271-59687293 CTGAGCCACCCCACCCTTCATGG + Intronic
1118378304 14:65196466-65196488 GTGAGCCAGCACATCCAGCCGGG - Intergenic
1118589329 14:67389686-67389708 CTGAGACAGCAGACTCATCAGGG + Intronic
1120138963 14:80905955-80905977 CTGACCCAGTGCCACCATCAAGG + Exonic
1121094039 14:91203334-91203356 CTGATCCATCTCAAACATCAGGG - Intronic
1122882072 14:104694708-104694730 CTGAGCCTGCGCACCCAGCACGG - Intronic
1202872088 14_GL000225v1_random:174470-174492 GTGAGCCAGCACACCCAGCCTGG - Intergenic
1123813307 15:23951127-23951149 ATGAGCCATCAAAGCCATCAAGG + Intergenic
1125501281 15:40241520-40241542 CTGGGCCAGGACAACCGCCAGGG - Intronic
1125700716 15:41680880-41680902 CTGAGCCAGCTCAACCTCTAGGG - Intronic
1129249145 15:74298991-74299013 CTGAGCCACCACACCCAGCCAGG + Intronic
1130720457 15:86381513-86381535 TTGAGCCAGAACAAGCCTCAAGG - Intronic
1130967499 15:88708230-88708252 CTGATCCAGGTCAACCAGCAAGG - Intergenic
1132332296 15:101021204-101021226 CTGGGCCAGCAGAGCCAGCACGG - Intronic
1133261113 16:4550893-4550915 CTGAGCCAGCAAAACCCAAATGG + Intergenic
1133849109 16:9485439-9485461 CACAGCCAGCACAATCCTCATGG - Intergenic
1133952528 16:10408424-10408446 GTAAACTAGCACAACCATCATGG - Intronic
1134030045 16:10984764-10984786 CTGAGTCAGCAGAATCAGCAGGG + Intronic
1134423304 16:14114559-14114581 CAGAGCCAGCACAAGCATGGTGG - Intronic
1134587896 16:15428021-15428043 CTGAGCCAGGACAAGCAGCCAGG + Intronic
1135681686 16:24462692-24462714 GTGAGCCACCACACCCAGCAGGG - Intergenic
1136225575 16:28858101-28858123 TTGAGCCAGCCCAACCCCCAGGG - Intronic
1136266246 16:29120916-29120938 CAGAGCCAGCCCAACCCTCAAGG + Intergenic
1139772857 16:69293227-69293249 CTGAACCAGAACAATCACCAGGG + Intronic
1141628434 16:85273977-85273999 GTGAGCCACCACACCCATCCAGG + Intergenic
1141817761 16:86424687-86424709 CTGAGCCTGCACATTCTTCAGGG + Intergenic
1142055056 16:87988830-87988852 CAGAGCCAGCCCAACCCTCAAGG + Intronic
1143063964 17:4228697-4228719 GTGAGCCACCACACCCAGCAAGG + Intronic
1143065326 17:4242783-4242805 CTGAACCAGGAAGACCATCATGG + Intronic
1144344617 17:14338723-14338745 GTGAGCCAGCACACCCAGCCTGG + Intronic
1150701123 17:67447647-67447669 CTGAGCCACCACGCCCATCCTGG + Intronic
1151495323 17:74454909-74454931 CTGTGCCAGCACCCACATCAGGG - Intergenic
1151508941 17:74546622-74546644 CTGAGCCAGCACACACCCCAGGG + Intergenic
1151553648 17:74835933-74835955 CAGGGCCAGCACAATCATGACGG - Exonic
1152486901 17:80600502-80600524 CAGCGCCAGCACCTCCATCAGGG - Intronic
1152768562 17:82154021-82154043 CAGAGCCAGCACCAACACCATGG + Intronic
1154503717 18:15011142-15011164 CTAAACCAGCACAACCATTTTGG + Intergenic
1154949293 18:21192530-21192552 ATAAACTAGCACAACCATCATGG + Intergenic
1156563702 18:38159367-38159389 CTGTGGCAGCAGAATCATCAGGG - Intergenic
1157237530 18:45978573-45978595 CTCAGCCAGCACCACAATCCAGG + Intergenic
1157482244 18:48062883-48062905 CTGTGCCAGGACAAGCATCTTGG - Intronic
1159157194 18:64600538-64600560 CTGAGGAAGCACCACAATCATGG + Intergenic
1160101080 18:75920373-75920395 GTGAGCCACCACATCCATCCAGG - Intergenic
1162193872 19:8968474-8968496 TTGAGCCACCACACCCAGCAAGG - Intronic
1162272411 19:9627046-9627068 GTGAGCCATCACATCCAGCATGG + Intronic
1162279319 19:9682448-9682470 GTGAGCCATCACATCCAGCATGG + Intergenic
1162742539 19:12781755-12781777 CTGTGCCACCACAATCACCATGG + Intronic
1162786580 19:13038786-13038808 CTGCGCCACCACCACCATCCTGG - Intronic
1163525624 19:17819393-17819415 ATGAGCCACCACATCCAGCAAGG + Intronic
1164018518 19:21274955-21274977 TTGAGCCAGCACACCCAGCCAGG - Intronic
1164628020 19:29742231-29742253 ATGAGCCACCACAACCAGCCTGG - Intergenic
1168123225 19:54266632-54266654 CTGAGCAAGCTCCACCCTCAAGG - Intronic
1168331341 19:55571325-55571347 CTGAGCCACCACACCCAGCCTGG + Intergenic
924989829 2:303702-303724 CTGAGCCTGCACAATCTCCAAGG + Intergenic
926296820 2:11574866-11574888 CTGTGCCAGCACAAACAGTAAGG - Intronic
930194806 2:48498629-48498651 CTGGGCCAGCCCAACCAGCTGGG - Exonic
930739282 2:54813486-54813508 CTGTGCCAGAAGAACCAGCAAGG - Intronic
932055591 2:68440239-68440261 CTGAGCCTACACAACCCTCATGG + Intergenic
933162955 2:79045734-79045756 CTGACCCAGCACAATCATAGTGG + Intergenic
933721362 2:85399390-85399412 CTGAGGCAGGACAACCAGGAAGG + Intronic
936820213 2:116510914-116510936 CTGAGCCAACCCACCCATTATGG - Intergenic
937959390 2:127443609-127443631 GTGAGCCACCACACCCAGCATGG + Intronic
938251519 2:129819441-129819463 GTGAGCCAGCACACCCAACCAGG + Intergenic
938502897 2:131841300-131841322 CTAAACCAGCACAACCATTTTGG + Intergenic
938943955 2:136193550-136193572 CTGAGCCAGGAAACCCAGCAAGG - Intergenic
941033397 2:160538704-160538726 CTCAGCCAGCACCACTATCCAGG - Intergenic
941360037 2:164540326-164540348 GTGAGCCACCACAACCAGCTGGG - Intronic
943469732 2:188278805-188278827 CTGAGCCAACACTCCCAGCAGGG + Intergenic
945393605 2:209295296-209295318 GTAAACCAGTACAACCATCACGG + Intergenic
948636473 2:239340988-239341010 CAGAGCCACCATTACCATCAAGG + Intronic
948677595 2:239607906-239607928 CTGAGCCAGCTCACCCGACACGG - Intergenic
948897717 2:240935007-240935029 CTGAGCCAACCCCTCCATCAAGG - Intronic
948951081 2:241252217-241252239 GTGAGCCACCACACCCAGCAGGG - Intronic
1170581489 20:17702790-17702812 CTCAGCCAACAGAACCGTCACGG + Intronic
1172167904 20:32910055-32910077 CTGCCCCAGCACCACCATCAAGG - Intronic
1173447028 20:43128490-43128512 CTGCCCCAGCACAACCACTATGG + Intronic
1173688587 20:44941474-44941496 CTGAGCCATCACAGACATCCAGG - Intronic
1174410691 20:50333096-50333118 CTGAACCACAACATCCATCATGG - Intergenic
1174998544 20:55600255-55600277 CAGACCCACCACAACCTTCAGGG + Intergenic
1175440814 20:58989901-58989923 CTGGGCCAGCACGGACATCATGG - Exonic
1177698842 21:24610143-24610165 GTGAGCCACCACAACCAGCCTGG + Intergenic
1177835175 21:26179650-26179672 ATGAGCCAGCACAACCGGCCAGG + Intergenic
1178468065 21:32866756-32866778 GTGAGCCACCACACCCATCCTGG + Intergenic
1179024152 21:37666420-37666442 CTGAGACAGCACAGCCAGCAAGG - Intronic
1180286008 22:10745022-10745044 GTGAGCCAGCACACCCAGCCTGG + Intergenic
1181100027 22:20532774-20532796 CTGTGGCAGGACAGCCATCAAGG + Intronic
1184726149 22:46347805-46347827 CTGACCCAGCAGAAGCAGCAGGG - Intronic
1185323991 22:50216699-50216721 CTGCGCCAGCATCAGCATCATGG - Exonic
949628583 3:5895951-5895973 ATGAGCCAGCACACCCAACCAGG + Intergenic
951564279 3:23997459-23997481 CTGAGCCAGCGCATCCAGCCCGG - Intergenic
951904411 3:27689331-27689353 CTGGCCCAGCACAACCATAGTGG + Intergenic
958264371 3:91420653-91420675 CTGAGCCACCACAACCAGCCTGG - Intergenic
965802780 3:172511850-172511872 CTGTCCCAGCACAGCAATCAAGG + Intronic
967205663 3:187118538-187118560 ATGAGCCACCACACCCATCTTGG - Intergenic
967306376 3:188063537-188063559 ATGAGCCACCACAACCAGCGAGG + Intergenic
967974733 3:195027359-195027381 CTGATCCAGAACCACCATGAGGG - Intergenic
969463291 4:7340206-7340228 CTGAGCCAGCACCACAACCCAGG + Intronic
971891561 4:32529967-32529989 CAGAGCCAGCACAATCATAGTGG + Intergenic
972530790 4:39959618-39959640 GTGAGCCACCACACCCAGCAAGG + Intronic
975064008 4:70038904-70038926 CTGAGCCACCACACCCTTTATGG - Intergenic
977459466 4:97307399-97307421 CTGAGTCATCACAACGTTCATGG + Intronic
977678809 4:99776124-99776146 GTGAGCCACCACACCCATCCTGG - Intergenic
978417934 4:108498262-108498284 GTGAGAATGCACAACCATCATGG + Intergenic
981343658 4:143650772-143650794 ATGAGCCACCACAGCCAGCATGG + Intronic
984184395 4:176525390-176525412 CAGAGCCAGCAGCACCATCTAGG + Intergenic
986183564 5:5416582-5416604 CTGTCCCACCACAGCCATCATGG - Intergenic
986210068 5:5663644-5663666 GTGAGCCACCACACCCAGCATGG + Intergenic
987031451 5:13980242-13980264 CTGAGCCAACATAACCTTAAAGG - Intergenic
988590899 5:32548554-32548576 CACAGCCACCACAACCATCAGGG + Intronic
991510854 5:67375185-67375207 CTCAGCCAGCACAACTATCTGGG + Intergenic
992684550 5:79186875-79186897 GTGAGCCAGCACACCCAGCATGG - Intronic
993529457 5:89006043-89006065 CTGAGCCACCACACCCAGCCTGG + Intergenic
994069314 5:95580689-95580711 CTGGGCCAGCCCAACCTTCCTGG - Intronic
996229127 5:121039663-121039685 GTGAGCAAGCACCACCACCATGG - Intergenic
997778232 5:136630405-136630427 CTGAGCCAGCCCATCAATGAAGG + Intergenic
1002185091 5:177450665-177450687 CTGAGCCACCTCACCCCTCAGGG - Intronic
1003023266 6:2530448-2530470 CTCAGCCAGCACCACTATCCAGG + Intergenic
1004936979 6:20517428-20517450 ATGAGCCACCACAGCCATCCTGG - Intergenic
1006047261 6:31308355-31308377 CTGGGCCCGCACCACCACCAGGG - Intronic
1006618531 6:35346159-35346181 GTGAGCCACCACAACCAGCCTGG + Intronic
1008991070 6:57602331-57602353 CTGAGCCACCACACCCAGCCTGG + Intronic
1009179591 6:60500568-60500590 CTGAGCCACCACACCCAGCCTGG + Intergenic
1011437508 6:87354139-87354161 ATGAGCCACCACACCCAGCAGGG + Intronic
1011451565 6:87498008-87498030 GTGAGCCACCACACCCACCAAGG + Intronic
1011729360 6:90244782-90244804 CTGAGCCATCATCACCCTCATGG + Intronic
1015920182 6:138258517-138258539 CTGAGGAAGCCCAACCATGAAGG - Intronic
1016501746 6:144727806-144727828 GTGAGCCACCACACCCAGCAAGG - Intronic
1018167003 6:161107574-161107596 CTGAGCCCTCACACCCCTCAAGG - Intronic
1019117953 6:169780587-169780609 CTGAGCCGGCCCCTCCATCACGG + Intronic
1021948526 7:25752329-25752351 CTGAGCCCAAACAACCCTCAGGG + Intergenic
1023484015 7:40665154-40665176 CTGAGCCACCACATCCAGCCTGG - Intronic
1024262955 7:47585485-47585507 ATGAGCCATCACAAACACCAAGG - Intergenic
1024727867 7:52220014-52220036 CATAGCCAGCACCACCATCAGGG - Intergenic
1024773530 7:52754883-52754905 CTCATCCAGCACAACCACGAAGG + Intergenic
1027472199 7:78587288-78587310 CTTAGCCAGAACACCCATTAGGG - Intronic
1029530756 7:101123708-101123730 GTGAGCCACCACACCCAGCAGGG + Intergenic
1029606970 7:101605152-101605174 GTGAGCCACCACACCCAGCAAGG + Intergenic
1032670114 7:134074622-134074644 CTGAGCCAGGACCAGCATCCAGG + Intergenic
1034560037 7:151874600-151874622 GTGAGCCATCACACCCATCCCGG - Intronic
1035082296 7:156226907-156226929 CTGAGCCAGCAGAAGAATGAGGG + Intergenic
1035367142 7:158356627-158356649 CTGAGCAGGCACCACCATCCAGG + Intronic
1035684793 8:1515278-1515300 CTGGGCCAGAGAAACCATCATGG + Intronic
1036558637 8:9883295-9883317 CTCAGCCAGCACTACCATCTGGG + Intergenic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1041514649 8:58687455-58687477 CTGTGCCATCACAACGATCACGG + Intergenic
1041727090 8:61028622-61028644 CTGAGCCAGCACAGCCAACATGG - Intergenic
1041823380 8:62064109-62064131 CTGACCCAGCACAGTCTTCATGG + Intergenic
1043932238 8:86104320-86104342 CTGAGCCACCACAACCAGCCAGG + Intronic
1044992834 8:97811766-97811788 CTGAGCCAGGGGAACCATCCTGG + Intronic
1045030021 8:98126129-98126151 GTGAGCCACCACATCCATCCTGG + Intronic
1045458775 8:102408781-102408803 CTGAGACAGCAGAACCATTCTGG + Intronic
1051518722 9:17960158-17960180 CTGCTCTAGCTCAACCATCATGG + Intergenic
1051776182 9:20636742-20636764 CAGTCCCAGCACAACCAGCATGG + Intergenic
1052681625 9:31700507-31700529 CTGAGGAAGCACAATGATCAAGG + Intergenic
1053082809 9:35191622-35191644 CAGAGCCAGCTGATCCATCAAGG - Intronic
1054969251 9:71065965-71065987 CTGAACCAGCACAGCCATCTGGG + Intronic
1055249500 9:74285289-74285311 CTGAGCCAAAACCAGCATCACGG - Intergenic
1058767903 9:108199421-108199443 CTGACCCAGCACAATCATAGTGG + Intergenic
1059525575 9:114988338-114988360 GTGAGCCAGCACATCCAGCCTGG - Intergenic
1060680380 9:125557777-125557799 CAGAGACAGCACTACCCTCATGG - Intronic
1060981048 9:127792182-127792204 CTGAGCCACCACACCCAGCCTGG - Intergenic
1062707837 9:137955023-137955045 CTGAGCCTTCACAGCCGTCATGG - Intronic
1203732359 Un_GL000216v2:102091-102113 GTGAGCCAGCACACCCAGCCTGG + Intergenic
1186160562 X:6773161-6773183 CCAAGACAGCACAACCAACATGG - Intergenic
1186214069 X:7280479-7280501 CTGAAGCAGCCCAAGCATCAGGG + Intronic
1187174502 X:16883890-16883912 CTGATCTCGCACAACCATCTCGG + Intergenic
1188815217 X:34705057-34705079 CTGACCCAGCACAATCATAGTGG - Intergenic
1189335032 X:40165923-40165945 CTGAGCCACCACACCCAGCTAGG + Intronic
1189791582 X:44610221-44610243 GTGAGCCACCGCACCCATCAAGG + Intergenic
1191083298 X:56537333-56537355 CTGAACCAGCTCAAGCAACAGGG + Intergenic
1193697163 X:84723499-84723521 CTGAACCAGCACAATCATAGTGG - Intergenic
1193877762 X:86883472-86883494 CTGACTCAGCACAGTCATCATGG - Intergenic
1195218524 X:102723775-102723797 TTGGGCCAGCTCAACCTTCAGGG + Intronic
1196424464 X:115555886-115555908 CTGAGCCACCACACCCAACCAGG - Intergenic
1196466281 X:115974074-115974096 CTGATCCAGCACAATCATAGTGG + Intergenic
1196780298 X:119377486-119377508 CTCATCCAGCACCACCATCCAGG + Intergenic
1197031653 X:121823731-121823753 CTGAGCCACCCCACCCTTCATGG + Intergenic
1197700107 X:129593284-129593306 CTGAGTCAGCACATTCATCAGGG - Intergenic
1198208500 X:134492919-134492941 GTGAGCCATCAGAAACATCATGG - Intronic
1198822780 X:140666535-140666557 CTCAGCCAGCACCACCATTCTGG - Intergenic
1198996123 X:142576666-142576688 CTGACCCAGCACAATCATAATGG - Intergenic
1199163809 X:144647147-144647169 CTGAGCCAGCACAATCATAGTGG - Intergenic
1201433126 Y:13926199-13926221 ATGAGCCACCACAACCAGCCTGG - Intergenic
1201553850 Y:15248203-15248225 CCGAGATAGCACAACCAACATGG - Intergenic