ID: 1084720180

View in Genome Browser
Species Human (GRCh38)
Location 11:70900557-70900579
Sequence GAGAATCCCGGAATCACTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 54}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084720180_1084720184 -2 Left 1084720180 11:70900557-70900579 CCCCTAGTGATTCCGGGATTCTC 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1084720184 11:70900578-70900600 TCCTTCCAAAGAAAAGCCCTAGG 0: 1
1: 0
2: 3
3: 30
4: 269
1084720180_1084720187 12 Left 1084720180 11:70900557-70900579 CCCCTAGTGATTCCGGGATTCTC 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1084720187 11:70900592-70900614 AGCCCTAGGAGCTTAAGCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 134
1084720180_1084720190 26 Left 1084720180 11:70900557-70900579 CCCCTAGTGATTCCGGGATTCTC 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1084720190 11:70900606-70900628 AAGCCCAGGCACCTCCCTGCTGG 0: 1
1: 0
2: 3
3: 29
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084720180 Original CRISPR GAGAATCCCGGAATCACTAG GGG (reversed) Intronic
905042961 1:34975537-34975559 GAGAATCTCAGAAACACTTGAGG + Intergenic
905512011 1:38529385-38529407 GAGAACCACGAAATCACCAGAGG - Intergenic
912200878 1:107456164-107456186 AAGCATCCTGGAATCACTTGGGG + Intronic
916564443 1:165961184-165961206 GAGTATCCCCGAAGCCCTAGTGG + Intergenic
918324280 1:183394885-183394907 GAGCATCCAGAAATCACTAGAGG - Intronic
920817689 1:209350272-209350294 GAGAATCCTGGAAGTACTTGAGG - Intergenic
1066105918 10:32156856-32156878 GAGAATCCCTGGAACACAAGAGG + Intergenic
1070325647 10:75387169-75387191 GAGAATCCCGGAATAACTGAAGG + Intergenic
1071000441 10:80825315-80825337 TAGAATCCCGTACTCTCTAGGGG + Intergenic
1078753357 11:14186100-14186122 GACAAGCCAGGAATCACTAATGG - Intronic
1082187719 11:49204817-49204839 GCGAATCCTGCAATCATTAGAGG + Intronic
1084720180 11:70900557-70900579 GAGAATCCCGGAATCACTAGGGG - Intronic
1086678593 11:89640580-89640602 GGGAATCCTGCAATCATTAGAGG - Intergenic
1094133477 12:27099488-27099510 GAGGATCCCAAAATCAATAGAGG + Intergenic
1095966881 12:47873870-47873892 GAGACTGCCTGAATCCCTAGAGG - Intronic
1096001080 12:48131186-48131208 GAGCATCCAGGACTCACTAATGG + Intronic
1096520462 12:52181896-52181918 GGGAATGCCTGAATCACTGGCGG + Intronic
1102044399 12:109820945-109820967 GAGAATCCCGGATTCAAAGGCGG + Intronic
1103446682 12:120999505-120999527 GTGAAGCCCGGACTCACTGGAGG - Exonic
1104182438 12:126395627-126395649 GATAATCCAGAAAGCACTAGTGG + Intergenic
1108454295 13:50597521-50597543 GAGAAACCTAGAATCACTAGTGG - Intronic
1111241874 13:85484201-85484223 GAGAATCCCTTGAACACTAGAGG + Intergenic
1113423139 13:110185598-110185620 GAAAATCCCGGAATGAGAAGAGG - Intronic
1115283157 14:31687771-31687793 GAGACTTCCAGCATCACTAGTGG - Intronic
1142698066 17:1644386-1644408 AGGAATCAAGGAATCACTAGGGG - Intronic
1143285399 17:5785360-5785382 GAGACTCCAGGAATCTCTTGGGG - Intronic
1155815918 18:30309884-30309906 GAGAAACCCAGAATTATTAGAGG + Intergenic
928602308 2:32915504-32915526 TAGAATCACAGAACCACTAGCGG - Intergenic
940215639 2:151300706-151300728 GAGAATGGAGGGATCACTAGTGG - Intergenic
941777872 2:169412647-169412669 GGGAAACCAGGAATTACTAGGGG - Intergenic
943188969 2:184652267-184652289 TAGAAACCAGGAACCACTAGAGG + Intronic
946774529 2:223123931-223123953 GAGAAGCCCGGAATCCAGAGGGG + Intronic
948814773 2:240504259-240504281 GAGAGTCCCTGAAACCCTAGGGG - Intronic
949050047 2:241892854-241892876 GCAAATCCCTGAGTCACTAGCGG + Intergenic
1177468429 21:21521242-21521264 CAGAATCACGGACTCACTAAAGG + Intronic
1181621234 22:24092774-24092796 GGGCATACTGGAATCACTAGGGG - Intronic
1181892767 22:26078585-26078607 GAGAATTCTGGATTCAGTAGAGG + Intergenic
1182070367 22:27459227-27459249 GATAATCCAGGAAGCACTGGTGG - Intergenic
952347263 3:32500156-32500178 GAGAAACCCGTAATCAGAAGAGG - Intronic
961279771 3:125757075-125757097 CAGAATCTCTGAATCACTATTGG - Intergenic
967355975 3:188572010-188572032 GAAAATCCTGGAGTCAATAGTGG + Intronic
970326293 4:14928417-14928439 GAGAATTCCCAAATTACTAGAGG + Intergenic
975602011 4:76111298-76111320 GAGACTTCCGGCCTCACTAGTGG - Intronic
981960169 4:150528040-150528062 AAGAATTCCTGAATCACTTGAGG - Intronic
983318127 4:166158523-166158545 GAGAATCCCCGAATTTCTAATGG + Intergenic
985009660 4:185569359-185569381 TAGAATCCCGGAATGACTGGAGG + Intergenic
1002417295 5:179127212-179127234 GAGATTTCAGGAATCACCAGGGG + Intronic
1006838520 6:37013827-37013849 GAGATGCCCGGAATCACTCAAGG - Intronic
1008195280 6:48511523-48511545 GAGAAACAGGGAGTCACTAGAGG - Intergenic
1022134556 7:27435194-27435216 GAGAAGCCCAGAGTCACCAGTGG + Intergenic
1023271062 7:38463098-38463120 GAGAGGACCCGAATCACTAGAGG + Exonic
1029382644 7:100223590-100223612 GAGAACCTCGGCATCACCAGTGG - Exonic
1031656989 7:124368381-124368403 GGGAAGCGCAGAATCACTAGAGG + Intergenic
1038909797 8:31950113-31950135 GAGACACACTGAATCACTAGGGG + Intronic
1050928521 9:11296787-11296809 GAGAATCCCGGAAAGAATGGTGG + Intergenic
1187369138 X:18689818-18689840 GAGAATCCAGGATTCAATATAGG - Intronic
1190625755 X:52336960-52336982 GTGGAGCCTGGAATCACTAGTGG + Intergenic
1195146020 X:102018265-102018287 GAAAATTCCTGCATCACTAGTGG - Intergenic
1196711933 X:118771480-118771502 GAGAATACAGGAATCTCCAGAGG - Intronic