ID: 1084723093

View in Genome Browser
Species Human (GRCh38)
Location 11:70921546-70921568
Sequence TGCCGAATTCTGAAATTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084723093 Original CRISPR TGCCGAATTCTGAAATTGGG AGG Intronic
903305841 1:22412580-22412602 TTCCTAATTCACAAATTGGGTGG - Intergenic
903815822 1:26063615-26063637 TGCCAAAGTCTGAGCTTGGGAGG - Intronic
909222838 1:72984472-72984494 TGCCGAAATAAGCAATTGGGGGG + Intergenic
910877142 1:91887694-91887716 TCTCCAATTCTGCAATTGGGTGG - Intronic
911135031 1:94430111-94430133 TGCCAGATTCTGAACTTGTGTGG + Intronic
911861105 1:102950448-102950470 TGCTGAACTCTGAAATAGTGTGG + Intronic
915878137 1:159635017-159635039 TTCAGATTTCTGAAATTGGGAGG - Intergenic
918565235 1:185921900-185921922 TGCCAAAATCTGAAAATGGTCGG + Intronic
918811258 1:189123791-189123813 TGCAAAATTCTGAAATAAGGAGG - Intergenic
920752456 1:208692546-208692568 TGCCAACTTCTGAAATTTTGTGG - Intergenic
1066587453 10:36951957-36951979 TGACTATTTCTGAGATTGGGAGG + Intergenic
1068952320 10:62789901-62789923 TGGGGAACACTGAAATTGGGTGG + Intergenic
1071953267 10:90728891-90728913 TACAGAATTCTGAAAGTGGGAGG + Intergenic
1074262511 10:111868656-111868678 TGCTGACTTCTGTTATTGGGTGG + Intergenic
1074443036 10:113495480-113495502 TGCCGAGATCTGGCATTGGGAGG - Intergenic
1079249169 11:18774554-18774576 TGCCAAATTCCTAGATTGGGTGG + Intronic
1080413442 11:32047886-32047908 TGCTGAATTATGAAATCTGGGGG + Intronic
1084723093 11:70921546-70921568 TGCCGAATTCTGAAATTGGGAGG + Intronic
1085331284 11:75653487-75653509 TGCCAAAGTCTGGATTTGGGTGG - Intronic
1085338511 11:75716070-75716092 TTCCGAGTTCTGAATTTTGGTGG - Intergenic
1087180789 11:95140474-95140496 TCCCGAATCCTGAAATGTGGAGG + Intergenic
1088457943 11:110052068-110052090 TGCCCATTTCTAAAATTGGTTGG - Intergenic
1089275470 11:117332736-117332758 TGCCTGATTCTGAGATTGGTAGG + Intronic
1093546664 12:20356738-20356760 TTTCAAATTCTGAACTTGGGTGG + Intergenic
1100409523 12:94301266-94301288 GGCAGAATTCTGCAGTTGGGTGG - Intronic
1100676929 12:96878440-96878462 TGCAGAATTCTGAAGGTGGAAGG - Intergenic
1102493249 12:113301859-113301881 TGCCTGACTCTGAACTTGGGAGG + Intronic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1107334580 13:39340675-39340697 TGCAGAATTCTTTACTTGGGAGG + Intergenic
1107780430 13:43896419-43896441 TGCAGAATTCTGAAAATGAAGGG - Intergenic
1113706060 13:112433696-112433718 TGGCAAAGTCTGAACTTGGGGGG - Intronic
1115376653 14:32683984-32684006 TGCCCAAGTCTGAAATACGGAGG - Intronic
1117952790 14:61099630-61099652 TGGGTAATTCTGAAAGTGGGTGG - Intergenic
1120941149 14:89951054-89951076 TGTAGCAATCTGAAATTGGGTGG - Intronic
1122782186 14:104148474-104148496 TTCAGATTCCTGAAATTGGGGGG + Intronic
1125123448 15:36192265-36192287 TGCTGAATTCTGAAATTTGGGGG - Intergenic
1144010028 17:11138645-11138667 TGCAGAATTCTGAATCTGGTAGG - Intergenic
1153444853 18:5159762-5159784 TGCCTAGTTCTTAAATTGAGTGG - Intronic
1153887285 18:9478147-9478169 TGACTAATGCAGAAATTGGGGGG + Intronic
1157020181 18:43772103-43772125 TGTCAAAATCTGAATTTGGGAGG - Intergenic
925350562 2:3198246-3198268 TGGCCACCTCTGAAATTGGGAGG - Intronic
925827981 2:7869137-7869159 TGCTGAGTTCAGAAATTGTGAGG - Intergenic
927751797 2:25676127-25676149 TGACCAATTCAGAAACTGGGGGG + Intergenic
928414679 2:31082353-31082375 TGCAGAATTCTGAGATGTGGAGG + Intronic
930375865 2:50566003-50566025 TGCTGTATTCAGAAATGGGGAGG + Intronic
930739588 2:54816910-54816932 TGCAGATTTCAGAACTTGGGGGG + Intronic
937813514 2:126224977-126224999 TGCCAAATTGTGAAATTGCAGGG - Intergenic
939877272 2:147592229-147592251 TGCCAGATTCAGAAATAGGGAGG - Intergenic
942030854 2:171957327-171957349 TGCTGAATTTTGAAATTGCTTGG + Intronic
944355475 2:198782668-198782690 GGCCTAATACTGAAATTTGGTGG + Intergenic
946077517 2:217086881-217086903 TGTCCAATTCTAAGATTGGGAGG - Intergenic
1169097457 20:2915436-2915458 TGCCTATTTTTTAAATTGGGGGG + Intronic
1170473598 20:16692130-16692152 TACTGTATTCTAAAATTGGGTGG + Intergenic
1171565916 20:26187270-26187292 TAGCGAATTGTGAAATTGTGAGG + Intergenic
1173857176 20:46257969-46257991 TGCCGAATGCTGCCATTGAGGGG + Intronic
1177890691 21:26800426-26800448 TGCGGAAGTCTCAAAGTGGGTGG + Intergenic
1182249340 22:28987549-28987571 TTCAGAATTCTGAGATTTGGGGG + Intronic
1183028731 22:35085945-35085967 GGCCGAGCTCTGAAATAGGGAGG + Exonic
949803176 3:7925648-7925670 TGCCATATTATGAAATTGGTAGG + Intergenic
952068392 3:29601345-29601367 TTCGAAATTATGAAATTGGGGGG + Intronic
953129388 3:40123869-40123891 TGTGGCATTCTGAAATAGGGAGG - Intronic
956821155 3:72955429-72955451 TGCTGATTTTGGAAATTGGGTGG + Intronic
957769103 3:84665310-84665332 TGCTGAGTTTTGAACTTGGGAGG - Intergenic
959354589 3:105309752-105309774 TAACAAGTTCTGAAATTGGGGGG + Intergenic
960072117 3:113442191-113442213 TGCCCATTTAAGAAATTGGGTGG - Intergenic
960362356 3:116728918-116728940 TACCGAATTCTGATCTTTGGAGG + Intronic
963418812 3:145032954-145032976 TTCCTCATTCTGAAAATGGGAGG + Intergenic
964200389 3:154112299-154112321 TGCCCAGTTTTGAAATTGGTGGG - Intergenic
972029393 4:34434239-34434261 TAGCGAATTGTGAAATTGTGAGG + Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
974741296 4:66011764-66011786 TGTCTAATACTGACATTGGGTGG + Intergenic
979650828 4:123129097-123129119 TGATGAATTCTGAAATATGGAGG + Intronic
987899807 5:23997234-23997256 TACCTAATTCTGAACCTGGGAGG + Intronic
988147194 5:27325568-27325590 TGCCAAGTTTTGTAATTGGGTGG - Intergenic
990614908 5:57497745-57497767 TACAATATTCTGAAATTGGGTGG + Intergenic
990906914 5:60813599-60813621 TGATGACTTCTGAGATTGGGAGG - Intronic
991987969 5:72309022-72309044 TGCTGAAGTCTGCACTTGGGAGG - Intronic
992826893 5:80558858-80558880 TGCCGTCTTCTGAAGTTGGAGGG + Exonic
995364585 5:111343678-111343700 TCTGGGATTCTGAAATTGGGTGG + Intronic
998707367 5:144778562-144778584 TGCCTAATTTTGAGATTTGGAGG + Intergenic
998737968 5:145164670-145164692 TGTCTAATGCTGAAAGTGGGAGG + Intergenic
1000614979 5:163416517-163416539 TGCCATATTCTTAAATTGGCGGG + Intergenic
1007617424 6:43188509-43188531 TGGCCATTTCTGAAATTGGTGGG - Exonic
1015149782 6:130024033-130024055 TGCCTAATTGTGAAAATGGTAGG + Intronic
1022096091 7:27142567-27142589 TGCAGGATTCTGAATTTTGGGGG - Intronic
1022853266 7:34288718-34288740 TGCCCATTTTTTAAATTGGGTGG - Intergenic
1025271556 7:57524638-57524660 TGGCGAATTGTGAAATTGTGAGG - Intergenic
1031297942 7:120027682-120027704 TGCAGAATATTGAAATTGGCTGG - Intergenic
1032180561 7:129673329-129673351 TTCAGAATTCTGAAATGTGGTGG - Intronic
1032400879 7:131623462-131623484 AGCCCAACTCTGAAGTTGGGTGG - Intergenic
1040301302 8:46189373-46189395 TGGGGGCTTCTGAAATTGGGGGG - Intergenic
1042888260 8:73576592-73576614 TGTCTAGTTCTTAAATTGGGCGG + Intronic
1046761470 8:118025866-118025888 ACCCGAATCCTGAAATTGGATGG + Intronic
1047605089 8:126466699-126466721 TGGCCAATTATGAATTTGGGGGG - Intergenic
1052014167 9:23445675-23445697 TGGCGAATTCTGGAAGTGAGAGG - Intergenic
1053335157 9:37262181-37262203 TGCCGAATTTTGAACTTGGTTGG + Intronic
1058417953 9:104807457-104807479 TGTGGAATTCTGAAACTGGAAGG - Intronic
1059674845 9:116528320-116528342 TGTGGAACTCTGAAATTGAGAGG + Intronic
1186088070 X:6012988-6013010 TGCTGAATTTTGCAATTGGCTGG - Intronic
1186778053 X:12885180-12885202 TGCCAAAGTCTGAAATTTGGAGG - Intronic
1189373104 X:40445531-40445553 GGCCTAATACTGAATTTGGGGGG - Intergenic
1189675810 X:43459428-43459450 AGGCGAATTCATAAATTGGGTGG - Intergenic
1189689947 X:43605726-43605748 AGCCTAATTCTGAAACTGGAGGG - Intergenic
1190057988 X:47193185-47193207 TGCATAATTCATAAATTGGGTGG + Intronic
1198454506 X:136802875-136802897 TGCCCAAATGTGAAATTGGTAGG + Intergenic