ID: 1084724539

View in Genome Browser
Species Human (GRCh38)
Location 11:70932624-70932646
Sequence CACTGACCAAAGCAAATGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 190}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084724538_1084724539 2 Left 1084724538 11:70932599-70932621 CCTCAAGCATTCAATCTTCTGCA 0: 1
1: 0
2: 0
3: 13
4: 205
Right 1084724539 11:70932624-70932646 CACTGACCAAAGCAAATGCCAGG 0: 1
1: 0
2: 3
3: 21
4: 190
1084724537_1084724539 3 Left 1084724537 11:70932598-70932620 CCCTCAAGCATTCAATCTTCTGC 0: 1
1: 0
2: 0
3: 16
4: 175
Right 1084724539 11:70932624-70932646 CACTGACCAAAGCAAATGCCAGG 0: 1
1: 0
2: 3
3: 21
4: 190
1084724536_1084724539 6 Left 1084724536 11:70932595-70932617 CCACCCTCAAGCATTCAATCTTC 0: 1
1: 0
2: 0
3: 15
4: 223
Right 1084724539 11:70932624-70932646 CACTGACCAAAGCAAATGCCAGG 0: 1
1: 0
2: 3
3: 21
4: 190
1084724533_1084724539 30 Left 1084724533 11:70932571-70932593 CCTTCCCATTGTGTGAGTAGAGA 0: 1
1: 0
2: 0
3: 13
4: 137
Right 1084724539 11:70932624-70932646 CACTGACCAAAGCAAATGCCAGG 0: 1
1: 0
2: 3
3: 21
4: 190
1084724534_1084724539 26 Left 1084724534 11:70932575-70932597 CCCATTGTGTGAGTAGAGATCCA 0: 1
1: 0
2: 0
3: 6
4: 168
Right 1084724539 11:70932624-70932646 CACTGACCAAAGCAAATGCCAGG 0: 1
1: 0
2: 3
3: 21
4: 190
1084724535_1084724539 25 Left 1084724535 11:70932576-70932598 CCATTGTGTGAGTAGAGATCCAC 0: 1
1: 0
2: 0
3: 6
4: 75
Right 1084724539 11:70932624-70932646 CACTGACCAAAGCAAATGCCAGG 0: 1
1: 0
2: 3
3: 21
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084724539 Original CRISPR CACTGACCAAAGCAAATGCC AGG Intronic
900798078 1:4721386-4721408 CACTGATCAAAGAAGATTCCTGG + Intronic
901738417 1:11326931-11326953 CCCTGGCCCAAGCAAAAGCCAGG - Intergenic
902528012 1:17071741-17071763 CACTGGCCAAAGCAAGAGCAAGG - Intronic
904598261 1:31660104-31660126 CACTGATCAAAGGCACTGCCTGG + Intronic
907488041 1:54790576-54790598 CACTTCCCAAAGCAAAAGGCAGG + Intronic
907698274 1:56756058-56756080 CACTGACCACAGAAAGTTCCAGG + Intronic
908145881 1:61242637-61242659 CACTGACTAAACTAACTGCCTGG - Intronic
908740494 1:67322545-67322567 AAGGGACAAAAGCAAATGCCAGG + Intronic
913448557 1:118975786-118975808 CACTGAGCAAAGACAATGCTTGG + Intronic
913502421 1:119483370-119483392 CACTTAACAAAGCAAACCCCAGG - Intergenic
914392477 1:147234919-147234941 CACTGTCCAAGGCAAATCACAGG + Intronic
917388511 1:174505153-174505175 CAGTGATCAAAGCAAAAGTCTGG + Intronic
919425613 1:197426638-197426660 CTCTGACCACAGGAAATGCAGGG + Intronic
921653457 1:217706277-217706299 CACTGCCCAAAGCAATTTACAGG - Intronic
922442147 1:225664719-225664741 CACTGTCCAAAGCAAGTCACAGG - Intergenic
1063273804 10:4541502-4541524 CTGTTGCCAAAGCAAATGCCAGG - Intergenic
1063328839 10:5134824-5134846 CACCTACAAAAGGAAATGCCAGG + Intronic
1064049214 10:12045668-12045690 CACAGACGAAAGCAAAGGCCAGG + Intergenic
1064158239 10:12921493-12921515 CTCTGACCAGTGCAAAAGCCAGG + Intronic
1069449704 10:68506507-68506529 AAATGTCCAAAGCAAATGCCTGG + Intronic
1069889008 10:71641522-71641544 CACTGTCCTAAGCAAAGGCACGG - Intronic
1070489785 10:76965632-76965654 CTCAGACCACAGTAAATGCCTGG - Intronic
1071938967 10:90565954-90565976 CTCTGAACAAAGAAAATTCCAGG - Intergenic
1072201247 10:93160945-93160967 CACACACAAAAGCAAAGGCCAGG - Intergenic
1072811978 10:98468976-98468998 CACTGACCAGAGAAAATACCAGG + Intronic
1072926904 10:99623678-99623700 CACTGGCCAAAGCAAATCCCAGG - Intergenic
1075140831 10:119833665-119833687 CACTGACCAAATAAAATGTCTGG + Intronic
1075383444 10:122037598-122037620 GACTCAACAAAGCAAAAGCCAGG - Intronic
1075866613 10:125727502-125727524 CTCTGACTAAAGCAACTGCCTGG + Intronic
1077286959 11:1771416-1771438 CACTGACAACGCCAAATGCCGGG + Intergenic
1080982563 11:37425582-37425604 CACAGACAAAAGCAATTACCTGG + Intergenic
1081188854 11:40079153-40079175 CACTGGCCAAAGCAAACAACAGG + Intergenic
1083198399 11:61104668-61104690 CACTGAACAAAGGGAATGCTTGG - Intronic
1084323673 11:68387085-68387107 CACTGACCACAGTACAGGCCAGG + Intronic
1084724539 11:70932624-70932646 CACTGACCAAAGCAAATGCCAGG + Intronic
1084735105 11:71100104-71100126 CACTGACAACACCAAATGCTGGG + Intronic
1087692889 11:101342433-101342455 AACGTAGCAAAGCAAATGCCAGG + Intergenic
1087746396 11:101952534-101952556 CACTGACCAAATCTAATCTCTGG - Intronic
1089749474 11:120640177-120640199 CAGTAAACAAAGCAAATTCCTGG - Intronic
1090143051 11:124286215-124286237 CACTGACAACACCAAATGCTGGG - Intergenic
1090693717 11:129214881-129214903 CACAGACAATAGCAAATGCATGG + Intronic
1093148461 12:15594311-15594333 CATACACCAAAGCAAATTCCAGG - Intronic
1100645177 12:96521756-96521778 CACAGATTAAATCAAATGCCTGG + Intronic
1101599152 12:106193586-106193608 CACTGACGAAAGCAAGTCCATGG + Intergenic
1104659955 12:130604512-130604534 CACTCACCAGAGCAACTTCCGGG + Intronic
1105880499 13:24601674-24601696 TACTGCCCAAAGCAATTGACAGG - Intergenic
1106923683 13:34590666-34590688 GAGTGACCAATGCAAAGGCCTGG - Intergenic
1108228480 13:48315110-48315132 CACTGCCCAAAGCAATTTACAGG - Intronic
1110669437 13:78159139-78159161 AACTGACAATAGCAAATGCTGGG - Intergenic
1111365826 13:87243505-87243527 AACTGAGCAAAGAAAATGACTGG + Intergenic
1112417751 13:99217681-99217703 CAGAGACCAAAGGAAACGCCTGG - Intronic
1114439805 14:22737118-22737140 CACTGCCCAATGCTGATGCCAGG + Intergenic
1115334268 14:32229484-32229506 CACTGCCCAAATCAAAGACCTGG - Intergenic
1117698427 14:58390035-58390057 CACTGACGATACCAAATGCTGGG + Intergenic
1117714917 14:58570733-58570755 CAGTGACCAAACCAAAAGCTGGG - Intergenic
1118418061 14:65565662-65565684 AACTGACAATAGCAAATGCTGGG - Intronic
1118919090 14:70133552-70133574 CACGGACCACAGCAAATGTGAGG + Intronic
1120157138 14:81105996-81106018 CACTGACCAAAGGAATTCCATGG + Intronic
1121935972 14:98018955-98018977 AACTTAACAAAGCAAATCCCTGG + Intergenic
1122384209 14:101332991-101333013 CTCTAACCAAATCAAATCCCAGG + Intergenic
1124400921 15:29346472-29346494 CACTGACCACAGCCCCTGCCTGG - Intronic
1125805665 15:42491410-42491432 CACTGACTAAAGGAAATGGCGGG - Intronic
1127318549 15:57819683-57819705 CAATAACCCAAGCAAAGGCCAGG - Intergenic
1128546190 15:68569789-68569811 CACTGACAACACCAAATGCTGGG - Intergenic
1130292535 15:82616078-82616100 CATGGAGAAAAGCAAATGCCAGG + Intronic
1131449702 15:92529049-92529071 CACTGCCCAAAGCCAAAGCTAGG - Intergenic
1132586321 16:707075-707097 TACTGACCAAAGAAGGTGCCCGG + Intronic
1133288485 16:4702419-4702441 CAGTGGCCCAAGCAAGTGCCTGG + Intronic
1135146557 16:19967653-19967675 CACTGGCCAAAGCAAGTCACAGG - Intergenic
1135183440 16:20294481-20294503 CACTGACCTAAAGTAATGCCAGG - Intergenic
1135870705 16:26147321-26147343 CACTTACCAAAACAAAAGCAGGG - Intergenic
1137246905 16:46713007-46713029 TACTGAAAGAAGCAAATGCCTGG - Intronic
1137274903 16:46926994-46927016 CTCTGCCCAAAGCCACTGCCGGG - Exonic
1139253769 16:65521401-65521423 TACTGACCAAAGCAAGAGGCTGG + Intergenic
1143651184 17:8265095-8265117 CAGTGACCAGAGCAAACACCAGG - Exonic
1148143879 17:45347616-45347638 CACTGTTCAAAGCAAATTCCTGG - Intergenic
1151148478 17:72063701-72063723 CAGTGAAAAATGCAAATGCCAGG - Intergenic
1151322563 17:73360588-73360610 CCTTGACCATGGCAAATGCCTGG + Intronic
1153629034 18:7051763-7051785 CACTGACAACACCAAATGCTGGG + Intronic
1154071197 18:11152976-11152998 CACTGAAGGAAGAAAATGCCAGG - Intergenic
1155126104 18:22877318-22877340 CACCGACTAAATCAAAAGCCAGG + Intronic
1155854373 18:30814404-30814426 CTTTGACCAAAGCAAATGAAGGG - Intergenic
1156381174 18:36562816-36562838 CCCTGACCAACACCAATGCCAGG + Intronic
1156963047 18:43056255-43056277 CACTGACAAAAACAAAGTCCAGG + Intronic
1157434263 18:47655073-47655095 CACTAACCACAGCAAATCCAGGG - Intergenic
1158008093 18:52696260-52696282 ATCTGAACAAAGCAAGTGCCTGG + Intronic
1158095329 18:53763715-53763737 TACTCCCCAAAGCAAATGCATGG + Intergenic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
1159707493 18:71709616-71709638 TATTAACCAAAGCAAATCCCTGG - Intergenic
1160904384 19:1445597-1445619 CACTGAACAAAACAAAATCCAGG - Intergenic
1161195213 19:2982835-2982857 CTCTGTCCAAAGCAACTGACCGG - Intronic
1164696854 19:30251389-30251411 CTCTGACCAATGCAAAAGCCTGG - Intronic
925258580 2:2510460-2510482 CACTGGCTAAAGCAAAATCCAGG - Intergenic
925746861 2:7051024-7051046 CACAGACCAATGCAAATGCACGG + Intronic
927056164 2:19367377-19367399 CACTGAACAGAGCTAATGCCTGG - Intergenic
927435008 2:23059265-23059287 CGCTGACCAAAACACCTGCCAGG + Intergenic
927521885 2:23703946-23703968 CAGTGACCATAGCAATTCCCAGG + Intronic
927925286 2:27008610-27008632 TCCTGCCCTAAGCAAATGCCTGG + Intronic
928214531 2:29350348-29350370 CACTGGCCACAACAAATGTCTGG - Intronic
928750980 2:34470020-34470042 TACTGACCAAAAAAAATCCCAGG + Intergenic
930187440 2:48424481-48424503 ATCTGACCAAAGCAAGTCCCAGG - Intergenic
931706923 2:64954135-64954157 CATTGACCAAAGCAAGTACATGG + Intergenic
934920806 2:98343901-98343923 CATTGACAAAAGCAAATCCCAGG + Intronic
935161541 2:100533576-100533598 CACTGGCCAGAGCAAGTGACAGG - Intergenic
935387112 2:102511928-102511950 TATTATCCAAAGCAAATGCCAGG + Intronic
936175362 2:110214989-110215011 GACTGGCCACAGGAAATGCCAGG - Intergenic
936471027 2:112798665-112798687 CACTGAAAAAAGTAAATGCATGG + Intergenic
936661022 2:114543784-114543806 CAGTGATCAAAGCAGATGCTGGG - Intronic
940196992 2:151105715-151105737 TACTGACCAAAGCAAATCACAGG - Intergenic
941329836 2:164166358-164166380 CACTGTTCAAAGCAAAGGCTGGG - Intergenic
941454186 2:165695791-165695813 CACTGACTAAAGAAATGGCCAGG - Intergenic
943886650 2:193226386-193226408 CACAGAACATAGCAAATGTCAGG - Intergenic
944741307 2:202615414-202615436 CACTGTCCATAGTAAAGGCCTGG - Intergenic
946443242 2:219714797-219714819 CAATGACCAAAACAAAGGACAGG - Intergenic
946629929 2:221656066-221656088 AACTGAACAAAGCAAGTGCAGGG - Intergenic
948332635 2:237182286-237182308 CTCTGCCCACAGCAAATGCTAGG + Intergenic
948641241 2:239377264-239377286 CACTAACCGAAGCCACTGCCAGG + Intronic
1169443236 20:5650600-5650622 CACAGACCAACGTAAATGTCTGG - Intergenic
1169787491 20:9375820-9375842 CAATGAGCAAAGCAAAAACCTGG + Intronic
1170576490 20:17665862-17665884 CACATACCAAAGTAAATTCCTGG - Intronic
1170817421 20:19726107-19726129 CACTGAAAAAAGCAATTGCAGGG - Intergenic
1172173804 20:32960449-32960471 CACAGACCATAGGAAATGCTTGG - Intronic
1173176391 20:40767894-40767916 GACTGGCCAGAGCAAAGGCCTGG - Intergenic
1174515932 20:51092495-51092517 CACTGAACAAAGAAAAAGTCTGG - Intergenic
1177092672 21:16788827-16788849 CACTGACTAATGCATATGCTTGG + Intergenic
1177105168 21:16946141-16946163 CAAGGACCATAGCAAATACCTGG - Intergenic
1178860070 21:36281547-36281569 CACTGAAGACAGCAAAAGCCTGG - Exonic
1179523260 21:41959160-41959182 CACTGATCACGGCAAATGCTAGG - Intergenic
1179769913 21:43606741-43606763 CAGTGAACAAGGGAAATGCCTGG + Intronic
1180029850 21:45199566-45199588 CACTATCCAAAGCACATGCTAGG + Intronic
1181803015 22:25359446-25359468 CACTGACCACAGTACAGGCCAGG - Intronic
1182156357 22:28076794-28076816 CACTACCCAAAACAAAAGCCAGG + Intronic
1182481168 22:30609762-30609784 CCCAGACCAAAGCACATGGCTGG - Intronic
1184277442 22:43418146-43418168 CTCTGATCAAAGCCAGTGCCAGG - Intronic
1185149870 22:49158173-49158195 CAGGGGCCACAGCAAATGCCTGG + Intergenic
950355620 3:12406026-12406048 CGCTGACCAAAGCAAAGGCGAGG + Exonic
951270811 3:20621182-20621204 CACTGTCCAAAACAAAAGCCTGG - Intergenic
956736902 3:72245180-72245202 AAATGATCACAGCAAATGCCTGG + Intergenic
959553338 3:107688872-107688894 CAGTCATCAAAGCAAATGGCTGG + Intronic
959892688 3:111574142-111574164 CACTGACCACAGCACATGGCAGG - Intronic
959940546 3:112076608-112076630 CAGTGTCCTAAGCAAATGCCTGG - Intronic
960954602 3:123023173-123023195 AAGAGGCCAAAGCAAATGCCTGG - Intronic
964829653 3:160869881-160869903 CAATGCCTGAAGCAAATGCCAGG - Intronic
966916968 3:184590237-184590259 CCAGGACCAAAGCAGATGCCAGG + Intronic
966946452 3:184780229-184780251 CACTGACAGAAGCGAATGCATGG - Intergenic
967211628 3:187175261-187175283 CACTGAACAAAGCAGTTGTCTGG + Intronic
969398175 4:6936779-6936801 CACTGACAACAGCAAACGCTGGG - Intronic
971083942 4:23248270-23248292 GACTGACCAAATCAAATACCAGG - Intergenic
971221196 4:24707692-24707714 CACTGACAATACCAAATGCAGGG - Intergenic
976070949 4:81239098-81239120 CATTGATCAAAGCAAGTCCCAGG - Intergenic
977146399 4:93446303-93446325 CATTGATCAAAGCAAGTTCCTGG + Intronic
979009206 4:115345403-115345425 CACTGAGCAAAGCCACGGCCAGG - Intergenic
979768548 4:124492940-124492962 CACTGAGCTAATCCAATGCCAGG - Intergenic
980038231 4:127909335-127909357 CACTGGAGAAAGAAAATGCCAGG + Intergenic
982443042 4:155458967-155458989 CACTGTCCATAGTAAAGGCCTGG + Intergenic
983429412 4:167629488-167629510 GACTGACATGAGCAAATGCCAGG + Intergenic
984364092 4:178775695-178775717 AATTGACTAAAGCAAATGACTGG + Intergenic
985425267 4:189823938-189823960 CACTGACTAAAGCAAATCAAGGG + Intergenic
986088422 5:4477349-4477371 GACTTACCAAAGCCAATGCCAGG - Intergenic
986399872 5:7370355-7370377 TACTGCACAAAGCAAATGCAAGG - Intergenic
987120738 5:14764244-14764266 TACTGACCAAAACAAATCACTGG - Intronic
988616785 5:32782440-32782462 CGATGAACAAAGCAAAAGCCGGG + Intronic
995075443 5:107978087-107978109 CACTGAGAAATGCAAATTCCTGG - Intronic
996731345 5:126720563-126720585 CCCTGAGCAAAGCAAAAGCCAGG + Intergenic
997351211 5:133232783-133232805 GACTGACCAAGGCAAGTGCTGGG + Intronic
998056082 5:139078663-139078685 CACTGCACACATCAAATGCCAGG + Intronic
1000464402 5:161557913-161557935 CACTGATCAGAGCAAATGATTGG - Intronic
1007267700 6:40609781-40609803 CACTGACCAGCTCAGATGCCAGG - Intergenic
1009658934 6:66584535-66584557 CACTTACTAAAGCAAATGCCAGG + Intergenic
1010081711 6:71871366-71871388 GACTGACCAAAGCAAAAGGCTGG + Intergenic
1012658251 6:101853425-101853447 CACTGACAACACCAAATGCTAGG + Intronic
1014692205 6:124575652-124575674 CACTGGCCTAAGCAATTCCCCGG - Intronic
1015617868 6:135097675-135097697 CACTGAGAAAAGCATAAGCCTGG + Intronic
1015934779 6:138397734-138397756 CATTGACCAAAGCAAGTCACCGG - Intergenic
1016073949 6:139774318-139774340 CACAGACCAAGGCAATTGACTGG - Intergenic
1019382846 7:734700-734722 CACTGAGCAAAGAAAAGCCCGGG - Intronic
1020025069 7:4894129-4894151 CTCTGACCAAAGAATATGGCAGG + Intergenic
1021534541 7:21688555-21688577 GACTGACCTAAACAACTGCCTGG + Intronic
1022269828 7:28795519-28795541 CAATGACCAAAGTCAATGCCAGG - Intronic
1024814563 7:53253996-53254018 CACTGACCCAAGGAACTGCAAGG - Intergenic
1026461977 7:70622352-70622374 CACTGACCAAAACAGATGCCAGG - Intronic
1033863256 7:145656139-145656161 CATTGATCAAAGCAAATCACAGG - Intergenic
1034013028 7:147550694-147550716 CACTGAGGAAAGACAATGCCAGG + Intronic
1036369191 8:8148101-8148123 CACTGACCAAAGCAAGTCATAGG + Intergenic
1036881699 8:12517541-12517563 CACTGACCAAAGCAAGTCATAGG - Intergenic
1037604448 8:20425622-20425644 CCCTGACCAAAGCAATGGTCTGG - Intergenic
1037724983 8:21475664-21475686 CACTGACAACACCAAATGCTGGG + Intergenic
1040934462 8:52768094-52768116 CACTGTCCCAAGAAAATGGCAGG - Intergenic
1041277905 8:56182135-56182157 CACTGAGAACAGCAAATGCTTGG + Intronic
1042373654 8:68022125-68022147 CACTTACCAAAAGAAATGTCCGG - Exonic
1043139425 8:76570089-76570111 CACTGGCCAAAGAAAATCACAGG - Intergenic
1045110021 8:98931529-98931551 CACTGACCACAGCAGAGGCTTGG - Intronic
1045264590 8:100608617-100608639 CACTTTCCAAAGCACTTGCCAGG - Intronic
1045512871 8:102827268-102827290 CAGTAAACAAAGCAAATTCCTGG + Exonic
1046899263 8:119506306-119506328 CCCTGAGAAAAACAAATGCCAGG - Intergenic
1047271996 8:123369612-123369634 CCTTGACCAAAGCAAATAACTGG - Intronic
1047433570 8:124815316-124815338 CAATGACCAATTTAAATGCCAGG + Intergenic
1047822141 8:128532646-128532668 CACAGACTAAATCAAATGCTGGG - Intergenic
1048321960 8:133406957-133406979 CACTAACTAAAGCAAATGTTAGG - Intergenic
1048850667 8:138642390-138642412 CTCTGCCCAACGCAACTGCCTGG + Intronic
1049681846 8:143922446-143922468 CACCCACCAAAGCAGATCCCCGG + Intronic
1050698886 9:8314221-8314243 CATGGACAAAAGCAAAGGCCAGG + Intergenic
1057920956 9:99096524-99096546 GACTGACCAAGGGAAAAGCCAGG + Intergenic
1059557168 9:115293014-115293036 CTCTGGCCAAACCAAATCCCAGG + Intronic
1061007568 9:127936843-127936865 CAGGCACCAAAGCAAGTGCCCGG - Intronic
1186431770 X:9511127-9511149 CACTTACCAAATCCAATGCTTGG - Intronic
1187185647 X:16982671-16982693 CACTAGCCAAAGCAAATCCGTGG - Intronic
1187268116 X:17755865-17755887 GAAAGACCAAAGCAAATGCTAGG - Intergenic
1187321121 X:18238418-18238440 GAAAGACCAAAGCAAATGCTAGG + Intergenic
1187397877 X:18933943-18933965 TACTGACTATAGTAAATGCCAGG - Intronic
1190029429 X:46957489-46957511 CAATGACCAAAGCAAGTCACAGG - Intronic
1192169069 X:68843291-68843313 CATTAACCAAAGGAAGTGCCTGG + Intergenic
1192375944 X:70562146-70562168 CACTTCCATAAGCAAATGCCAGG + Intronic
1195960556 X:110382123-110382145 TTCTGACCAAAGCATAGGCCTGG - Intronic
1198789338 X:140326593-140326615 CACTGAACAAAACAAAGCCCCGG + Intergenic