ID: 1084728083

View in Genome Browser
Species Human (GRCh38)
Location 11:70954929-70954951
Sequence TCCATGTGGTCCCACGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 102}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084728083_1084728088 -1 Left 1084728083 11:70954929-70954951 CCTGCTTCGTGGGACCACATGGA 0: 1
1: 0
2: 1
3: 5
4: 102
Right 1084728088 11:70954951-70954973 AAAGGGCTCAGCACAGGACTAGG 0: 1
1: 0
2: 12
3: 67
4: 542
1084728083_1084728087 -7 Left 1084728083 11:70954929-70954951 CCTGCTTCGTGGGACCACATGGA 0: 1
1: 0
2: 1
3: 5
4: 102
Right 1084728087 11:70954945-70954967 ACATGGAAAGGGCTCAGCACAGG 0: 1
1: 3
2: 3
3: 39
4: 312
1084728083_1084728091 24 Left 1084728083 11:70954929-70954951 CCTGCTTCGTGGGACCACATGGA 0: 1
1: 0
2: 1
3: 5
4: 102
Right 1084728091 11:70954976-70954998 GGGTGCCCCCATGCACTGAAAGG 0: 1
1: 0
2: 0
3: 9
4: 88
1084728083_1084728090 4 Left 1084728083 11:70954929-70954951 CCTGCTTCGTGGGACCACATGGA 0: 1
1: 0
2: 1
3: 5
4: 102
Right 1084728090 11:70954956-70954978 GCTCAGCACAGGACTAGGCAGGG 0: 1
1: 0
2: 3
3: 24
4: 245
1084728083_1084728089 3 Left 1084728083 11:70954929-70954951 CCTGCTTCGTGGGACCACATGGA 0: 1
1: 0
2: 1
3: 5
4: 102
Right 1084728089 11:70954955-70954977 GGCTCAGCACAGGACTAGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084728083 Original CRISPR TCCATGTGGTCCCACGAAGC AGG (reversed) Intronic
902862363 1:19255623-19255645 TCCATGTGTTTCCATGTAGCAGG + Intronic
907474238 1:54694984-54695006 TCCATCTGATCCTTCGAAGCAGG - Intronic
912801088 1:112720113-112720135 TCCATGTGAGTCCAGGAAGCAGG + Intergenic
916785294 1:168082717-168082739 TCCATGTGGTCCCATCAGGAAGG + Exonic
1063057080 10:2517374-2517396 TCCATGTTGTCCCACATGGCAGG + Intergenic
1066084849 10:31966147-31966169 TCCCTGTAGTCCCACGACTCAGG + Intergenic
1067702568 10:48584304-48584326 CCCATGTGGTCCCACTAGCCTGG + Intronic
1068965997 10:62912637-62912659 TCCATCTGGTCCGAGGCAGCTGG - Intronic
1069869822 10:71526331-71526353 TCCACGTGGGCCCAGGAGGCAGG + Intronic
1070581029 10:77719674-77719696 TCCATCTGGTGCCAGGGAGCAGG - Intergenic
1070987936 10:80704202-80704224 TCCATGTTGTCGCAAGCAGCAGG - Intergenic
1074749248 10:116568089-116568111 TCCATGTGAGCCCACCAAGAGGG - Intergenic
1076845618 10:133068183-133068205 TCCACTTGGCCCCACGACGCTGG + Intergenic
1077395950 11:2321331-2321353 TCTCTGGGGTCCAACGAAGCCGG - Intergenic
1078085590 11:8231498-8231520 TCCATGTGGACCCGTGAGGCTGG + Intronic
1081730216 11:45366629-45366651 TCCATGTGGTGCCAGGAAAGAGG - Intergenic
1082813749 11:57494748-57494770 GCCATGTGGTCCCAAAAAGAGGG - Intronic
1084728083 11:70954929-70954951 TCCATGTGGTCCCACGAAGCAGG - Intronic
1091450122 12:567311-567333 TCCATCTGTCCCCACGCAGCAGG - Intronic
1100204389 12:92332409-92332431 TTCTGGTGGTCCCATGAAGCAGG - Intergenic
1102885378 12:116517869-116517891 TCCCTGTGGTCCCAGGTGGCAGG + Intergenic
1104750148 12:131233164-131233186 TGCACGTGGGCCCACGAAGGGGG + Intergenic
1104782568 12:131431297-131431319 TGCACGTGGGCCCACGAAGGGGG - Intergenic
1105425535 13:20291831-20291853 TCCATGTGGTACCACGTGACAGG + Intergenic
1106924196 13:34596095-34596117 TCCATGTTTACCCATGAAGCAGG - Intergenic
1111895976 13:94141951-94141973 TCCATGTGGTCACACCAACAAGG - Intronic
1112415436 13:99200423-99200445 TCCGGGCGGTCCCTCGAAGCTGG - Intergenic
1112870393 13:103963733-103963755 TACATGTGCTCCCACCTAGCTGG - Intergenic
1115658554 14:35467401-35467423 TATATGAGGTCCCACAAAGCTGG - Intergenic
1119522073 14:75294000-75294022 TCCCTGAGGTCCCTGGAAGCCGG - Intergenic
1121209881 14:92200198-92200220 TCCTTGTGGTCCCAAGACGATGG - Intergenic
1122873343 14:104651325-104651347 TCCATGAGGTGCCGCGAGGCTGG + Intergenic
1124887561 15:33701326-33701348 TCCATGTAGACCAACGAGGCTGG - Intronic
1128833717 15:70792433-70792455 GCCATCTGTTCCCAAGAAGCTGG + Intergenic
1129977138 15:79831792-79831814 TCCATGTGCTCACATGGAGCTGG - Intergenic
1132866917 16:2097608-2097630 TCCATGTGGTCACACCACCCGGG - Intronic
1134548049 16:15125430-15125452 TCCATGTGGTCACACCACGTGGG - Intronic
1134720303 16:16377294-16377316 TCCATGTGGTCACACCACGTGGG + Intergenic
1134947124 16:18334591-18334613 TCCATGTGGTCACACCACGTGGG - Intronic
1135586993 16:23679060-23679082 TCCTAGTGGACCCACGCAGCCGG + Exonic
1135590965 16:23705086-23705108 TCACTGTGGACCCAGGAAGCGGG - Exonic
1139653661 16:68374978-68375000 TCCAGGTGGCCCCAAGAATCTGG - Intronic
1141914730 16:87087510-87087532 TTTATGTGGCCCAACGAAGCAGG - Intronic
1143512760 17:7405270-7405292 GCCTTCTGGTCCCTCGAAGCCGG + Intronic
1147213222 17:38884282-38884304 CCCCTGTAGTCCCACCAAGCAGG + Intronic
1148780061 17:50116293-50116315 CCCATTAGGTCCCATGAAGCAGG - Intronic
1149516060 17:57281829-57281851 TCCAAGTTATCCCACGGAGCAGG - Intronic
1156577192 18:38330822-38330844 TTCATGTGGTCCCACCATGTGGG - Intergenic
1160932791 19:1578531-1578553 TCCATGTGTCCCCAGGAAGCAGG - Exonic
1164832566 19:31333727-31333749 TCCAGGTGGTCCCAGGATGATGG - Intronic
1166953701 19:46447810-46447832 GCCATTTCCTCCCACGAAGCAGG - Intergenic
1168712626 19:58510760-58510782 TCCATGTGATCCCAGCACGCAGG + Exonic
932420468 2:71598473-71598495 GCCATGTGGGGCCACAAAGCTGG - Intronic
932556643 2:72830342-72830364 TCCATGTGGCACCAGGAACCTGG - Intergenic
933247845 2:79995686-79995708 TCCCTGTGGTCCCAGGCAGTTGG + Intronic
936531207 2:113278131-113278153 TCCATGTGGTCCCTCGAAACCGG + Intronic
936815620 2:116456872-116456894 TCCTTGTCTTCCCACAAAGCCGG + Intergenic
938101182 2:128499209-128499231 TCTCTGTGCTCCCACGATGCAGG + Intergenic
1171157252 20:22887401-22887423 TCCTTCTAGACCCACGAAGCTGG - Intergenic
1174402350 20:50282834-50282856 TCCAGGTGGTCCCCCAAACCTGG + Intergenic
1179128118 21:38610717-38610739 CCCATGTGGTCACAGGAAGGAGG - Intronic
1180129387 21:45817323-45817345 GTCATGTGGTACCACGAGGCGGG - Intronic
1180698739 22:17770330-17770352 TGCATGTGATCCCACAAGGCAGG - Intronic
1183098447 22:35568668-35568690 TCCATGGGGTCTCACGACTCAGG - Intergenic
1185068802 22:48645125-48645147 TCCAGGTGGTTCCAGGGAGCAGG + Intronic
950557197 3:13702918-13702940 TCCATGTGCTCCCACTATGATGG - Intergenic
950789495 3:15461268-15461290 ACCATCTGGTCCCACAGAGCTGG + Intronic
952803437 3:37320486-37320508 TCCATGTGCCCCCACAGAGCTGG - Intronic
955326161 3:58010399-58010421 GCCATCTGGGCCCAGGAAGCAGG - Intronic
958884970 3:99715546-99715568 TCCATGTTGTCCTGAGAAGCAGG + Intronic
962217510 3:133535411-133535433 TCCATCTGGTCCCTGGAAGTAGG + Intergenic
968074634 3:195809717-195809739 TCCATGTGGAGCCAGGAAGTGGG - Intronic
970143181 4:13005142-13005164 TAGATGTGGTCCCAGGAAACAGG + Intergenic
970714700 4:18907936-18907958 GCCATGTGGTCCCACTCAGCAGG + Intergenic
979216309 4:118168808-118168830 TCCATGTTGTCACACATAGCAGG - Intronic
980940017 4:139264981-139265003 TGCATGTGATCCTACGAAGCAGG - Intergenic
982032134 4:151311419-151311441 TCCATGTGGTCGCAAGTGGCAGG - Intronic
982425633 4:155255708-155255730 TCCATGTGGTCACATAGAGCAGG - Intergenic
982938729 4:161520845-161520867 TCCTGGTGGTCCCAAGAAGATGG + Intronic
985716696 5:1467038-1467060 TCCATGTGGAGCCATGCAGCAGG + Intronic
990991446 5:61688318-61688340 TGAATGTGCTCCCACGATGCTGG - Intronic
995611308 5:113913263-113913285 TCTATGTAGTCCCTGGAAGCAGG + Intergenic
996125627 5:119722564-119722586 TCCATGTGGTCCAGGGAAGATGG - Intergenic
1002423524 5:179162864-179162886 TCCCTGTGGTCCCCCAAAGGAGG - Intronic
1002554942 5:180029652-180029674 GCCATGTAGTCCAACGTAGCTGG + Intronic
1004193673 6:13486417-13486439 TCCAAGTGGTGCCAGGAGGCAGG + Intronic
1012230074 6:96750778-96750800 TCCATTTGGTCCCTAGAATCTGG + Intergenic
1013605586 6:111744578-111744600 TCCATGTGTTCCCACCAGACTGG - Intronic
1017796284 6:157847658-157847680 TCCACGTGGGCCCAGGAAGGAGG + Intronic
1021769330 7:23983158-23983180 TCCATGAGGTCCCGTGAGGCAGG - Intergenic
1024625597 7:51206710-51206732 TCCATGTTGTCACACGTGGCAGG - Intronic
1024787903 7:52929530-52929552 TCAATGTGGTCCCCCCAAGTGGG - Intergenic
1027351821 7:77319719-77319741 TCCATGTTGTCACATGGAGCAGG - Intronic
1036716315 8:11127533-11127555 TATATGTGGTCCCTAGAAGCTGG - Intronic
1036773818 8:11596500-11596522 TCAATGCGGTCCCACCAAGCAGG + Intergenic
1038256001 8:25951731-25951753 TCCATATGTTCCCAGGAAGAAGG + Intronic
1041241377 8:55851802-55851824 TCCCTGTGGTTCCAGGAAGTAGG - Intergenic
1046440035 8:114243676-114243698 TCCATGGGGTCCCACACAGATGG - Intergenic
1048839668 8:138553876-138553898 TCCATGTGGTGCCTTGAAGGAGG + Intergenic
1049578932 8:143402107-143402129 TCCGTGTGGTGCCACGACGGTGG - Intergenic
1049679412 8:143910996-143911018 ACCATGGGGGCCCATGAAGCTGG + Intergenic
1056223099 9:84469096-84469118 TCCATGTGGTCTCTCCAAGTGGG - Intergenic
1061972564 9:134052913-134052935 TCCAAGTGGGCTCACCAAGCTGG + Intronic
1186206388 X:7204987-7205009 GCCATGTGGGGCCACAAAGCAGG - Intergenic
1195046593 X:101060048-101060070 TGCATGTGGTCCCAGCTAGCAGG + Intergenic
1198699967 X:139385938-139385960 TCCAAGTGGTCTCAAGAAGCAGG - Intergenic
1199328365 X:146528828-146528850 TCCATGTTGTCGCAAGTAGCAGG + Intergenic
1201782415 Y:17738206-17738228 GCCAAGTGGTCCCACTGAGCAGG - Intergenic
1201819138 Y:18167782-18167804 GCCAAGTGGTCCCACTGAGCAGG + Intergenic