ID: 1084731035

View in Genome Browser
Species Human (GRCh38)
Location 11:71073808-71073830
Sequence TGGGGGTACCAGAACTATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 75}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084731027_1084731035 14 Left 1084731027 11:71073771-71073793 CCTGCTTTTTTCATGTGATGGTG 0: 1
1: 0
2: 1
3: 40
4: 523
Right 1084731035 11:71073808-71073830 TGGGGGTACCAGAACTATCCTGG 0: 1
1: 0
2: 0
3: 3
4: 75
1084731033_1084731035 -9 Left 1084731033 11:71073794-71073816 CCACGCATGCCTGGTGGGGGTAC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1084731035 11:71073808-71073830 TGGGGGTACCAGAACTATCCTGG 0: 1
1: 0
2: 0
3: 3
4: 75
1084731025_1084731035 27 Left 1084731025 11:71073758-71073780 CCTGGCTGGAAGGCCTGCTTTTT 0: 1
1: 1
2: 0
3: 23
4: 297
Right 1084731035 11:71073808-71073830 TGGGGGTACCAGAACTATCCTGG 0: 1
1: 0
2: 0
3: 3
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084731035 Original CRISPR TGGGGGTACCAGAACTATCC TGG Intronic
902331121 1:15731712-15731734 TGGGGCTCCCAGACCTCTCCTGG + Intronic
903569882 1:24296549-24296571 TGGATTTACCAGAAATATCCAGG - Intergenic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
916659506 1:166908665-166908687 TGAGGGTACCAGAAGAATCCAGG + Exonic
916851664 1:168710718-168710740 TTGGGGAAGCAGAAGTATCCTGG + Intronic
922222527 1:223619292-223619314 GGGGGCTGCCAGAACTACCCAGG - Exonic
1065821059 10:29525964-29525986 TGGGTGTACCAGCTTTATCCCGG + Intronic
1066688578 10:38004340-38004362 TGGAGGTACCAGCATGATCCTGG + Intergenic
1070934213 10:80280898-80280920 TGGGGGTTCCCTAACTAGCCAGG + Intronic
1072443568 10:95478681-95478703 TGGGGGTCCCAGAACTGTGTTGG - Intronic
1081286508 11:41276725-41276747 TGGGTGTACTTGAACAATCCAGG - Intronic
1082091860 11:48096854-48096876 AGGAGGTAGCAGAACCATCCAGG - Intronic
1084731035 11:71073808-71073830 TGGGGGTACCAGAACTATCCTGG + Intronic
1085048014 11:73364448-73364470 TGGGGGTCCCAGAAATGGCCTGG - Exonic
1085351062 11:75798101-75798123 TGGGTGTACCAGAATTACCTGGG - Intronic
1090495327 11:127206128-127206150 TGGGGTTACCAGATCTGTCTGGG - Intergenic
1096391750 12:51235045-51235067 GGGGGATTCCAGAAATATCCAGG - Intergenic
1096593598 12:52679431-52679453 TGGGGCTAACTGAACTTTCCAGG - Intronic
1099799488 12:87439909-87439931 TTGGGGTATCAGGACTTTCCTGG + Intergenic
1106021937 13:25924013-25924035 TGGGGAAACCAGTACTAGCCAGG + Intronic
1108448338 13:50532387-50532409 TGGGGGTGACAGAAATATTCTGG - Intronic
1118188297 14:63557538-63557560 TGAGGGTACCTGAGCTAACCTGG - Intergenic
1122878252 14:104678632-104678654 TGGGGGTGCCGGGACTCTCCTGG - Intergenic
1124822678 15:33063103-33063125 TGGTGGTACCATAACTGTGCAGG + Intronic
1128019981 15:64381644-64381666 GGGCGGTACCAGGACTCTCCAGG + Intronic
1128163346 15:65439363-65439385 TGTGGTTTCCAGAACCATCCTGG + Intergenic
1133684297 16:8151059-8151081 TGGGGGTACTGAAACTATTCTGG - Intergenic
1136504405 16:30693740-30693762 TGGGGGTTACAGAACCATCAAGG - Intergenic
1136784320 16:32925700-32925722 TGGGGGGATCAGAGCGATCCGGG + Intergenic
1142331468 16:89456830-89456852 CGGGGGGAACAGAAATATCCTGG + Intronic
1203086977 16_KI270728v1_random:1189706-1189728 TGGGGGGATCAGAGCGATCCGGG + Intergenic
1144600378 17:16607622-16607644 TGGGAGTCCCAGGACAATCCAGG - Intergenic
1154409612 18:14130905-14130927 TGGGGGTGAGAGAAATATCCAGG - Intronic
1155243997 18:23890018-23890040 TGGGGATTCCCGAAATATCCCGG - Exonic
925960433 2:9009448-9009470 TGGGGTTACCACATCTAACCTGG + Intergenic
926332963 2:11840255-11840277 TGGGGGTGCCAGGACCACCCGGG + Intergenic
929114718 2:38434477-38434499 TGGGGATGCCACAACTACCCTGG - Intergenic
929947774 2:46383286-46383308 TGGGCCTACCAGAGCTTTCCAGG - Intronic
936063658 2:109314199-109314221 TGGGGGCACCAGAACCATGTGGG + Intronic
941881483 2:170484915-170484937 TGGAGGTAGCAGAACTATTTTGG - Intronic
942617038 2:177802683-177802705 TGGGGGTAGCAGTGATATCCTGG + Intronic
945562293 2:211353928-211353950 TGAGGATACCAGAACCCTCCTGG + Intergenic
1168813684 20:722452-722474 TGGGTGTACCTGAACTTTTCTGG - Intergenic
1176863615 21:14028947-14028969 TGGGGGTGAGAGAAATATCCAGG + Intergenic
1177819557 21:26016491-26016513 TGAGTGTAGCAGAAATATCCTGG + Intronic
1178897538 21:36571777-36571799 TACCGGTACCAGCACTATCCTGG - Intronic
1183151064 22:36037701-36037723 TGGGGCTGCCAAACCTATCCTGG + Intergenic
1183442147 22:37829355-37829377 TGGGGTTACAGGAAATATCCTGG + Intergenic
950743918 3:15072026-15072048 TGGTGCTACCAGCACGATCCTGG + Exonic
966943512 3:184761609-184761631 GGGGTGTGCCAGAACTCTCCTGG + Intergenic
967762385 3:193240886-193240908 TGGGTGTACCCGAACATTCCTGG + Intergenic
969130525 4:4987777-4987799 TGGGGGAAGCAGAAGCATCCAGG + Intergenic
969177465 4:5409657-5409679 TGGGGGCACCAGAATTAGCTGGG + Intronic
969336893 4:6516271-6516293 TGGGGGCTCCAGGACCATCCTGG + Intronic
975220859 4:71810994-71811016 TGTGTGTACCACAACTTTCCTGG + Intergenic
982101830 4:151975715-151975737 TGGGGGTACCATCACTTCCCAGG + Intergenic
990400944 5:55436830-55436852 TTGGGGTAACACAAATATCCAGG - Intronic
994332465 5:98523261-98523283 TGGGGATGCCAGAACCTTCCTGG + Intergenic
995813857 5:116144056-116144078 TGGAGGTACCTGAGATATCCAGG + Intronic
998324148 5:141264073-141264095 TGGAGTTACCAGAACTACCTTGG - Intergenic
1002682873 5:180981859-180981881 TCCGGGTACCAGAGCTGTCCCGG - Intergenic
1004122661 6:12839581-12839603 TAGGGGTACCAGGATTATCTTGG + Intronic
1008001442 6:46364702-46364724 CTGGGGTACCAGAACTTTCAGGG - Intronic
1013162694 6:107561031-107561053 TGGGGGTACCTGACCCATCAGGG + Intronic
1022608014 7:31835379-31835401 GGGGGGAACTAGAACTATACAGG - Intronic
1029155501 7:98514593-98514615 TGGGTGTCCCAGAAATATCCTGG + Intergenic
1032162589 7:129522206-129522228 TTGGTGTACCAGCACTGTCCAGG + Intergenic
1036638058 8:10564964-10564986 TGGGGGTTCCTGATCTATCAGGG + Intergenic
1038342404 8:26697547-26697569 TTGGGATTCCAGAACTTTCCTGG - Intergenic
1050204317 9:3181332-3181354 CTGGGGCACCAGAACTGTCCAGG + Intergenic
1057696338 9:97325335-97325357 TGGGAGTAGCAGAAATCTCCTGG + Intronic
1061070832 9:128309596-128309618 TGGGAGTCCCAGGACCATCCCGG + Exonic
1061163472 9:128909446-128909468 TGGGGTTTACAGAACCATCCAGG + Intronic
1061283295 9:129609479-129609501 TGGGGGGAGCAGAGCTTTCCTGG + Intronic
1061318797 9:129814897-129814919 TGTGGGCACCAAAACTAGCCTGG + Intronic
1196349889 X:114716129-114716151 AGGTGGTAGCAGAACTATCTGGG - Intronic
1196696821 X:118622016-118622038 AGTGGGTACAAGAACTATACAGG - Intronic
1197570264 X:128141891-128141913 TGGGGGTACCAGAGATTACCTGG - Intergenic
1199357070 X:146875035-146875057 TGGGGGGATCAGAACAATACAGG + Intergenic