ID: 1084731296

View in Genome Browser
Species Human (GRCh38)
Location 11:71075411-71075433
Sequence GCGCTTGCCCAGATGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084731296_1084731304 24 Left 1084731296 11:71075411-71075433 CCACCCACCATCTGGGCAAGCGC 0: 1
1: 0
2: 0
3: 12
4: 120
Right 1084731304 11:71075458-71075480 CAGACCCCTGGCTGTGGATCAGG 0: 1
1: 0
2: 1
3: 20
4: 219
1084731296_1084731305 25 Left 1084731296 11:71075411-71075433 CCACCCACCATCTGGGCAAGCGC 0: 1
1: 0
2: 0
3: 12
4: 120
Right 1084731305 11:71075459-71075481 AGACCCCTGGCTGTGGATCAGGG 0: 1
1: 0
2: 0
3: 17
4: 225
1084731296_1084731300 12 Left 1084731296 11:71075411-71075433 CCACCCACCATCTGGGCAAGCGC 0: 1
1: 0
2: 0
3: 12
4: 120
Right 1084731300 11:71075446-71075468 AGCATGCACCACCAGACCCCTGG 0: 1
1: 0
2: 3
3: 26
4: 270
1084731296_1084731301 18 Left 1084731296 11:71075411-71075433 CCACCCACCATCTGGGCAAGCGC 0: 1
1: 0
2: 0
3: 12
4: 120
Right 1084731301 11:71075452-71075474 CACCACCAGACCCCTGGCTGTGG 0: 1
1: 0
2: 2
3: 22
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084731296 Original CRISPR GCGCTTGCCCAGATGGTGGG TGG (reversed) Intronic
900796426 1:4711386-4711408 GCGCTTCCCCAGTGGGCGGGGGG + Intronic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
902367998 1:15989949-15989971 GCACTGGCCCAGATGCTGGCTGG + Intergenic
902448749 1:16483966-16483988 GCGCTTGGGCAGGTGGAGGGAGG - Intergenic
903833779 1:26189955-26189977 GCTCTTGGCCAGAGGGTGGGTGG + Intergenic
915219971 1:154366911-154366933 GCGGTTGCCCAGATCTGGGGTGG + Intergenic
915347851 1:155207210-155207232 GAGATAGCCCAGATGGTGGGAGG - Intronic
915601816 1:156927351-156927373 GCCCTTGCCGAGATGGTAGGGGG - Intronic
915936397 1:160092512-160092534 GTCCCTGCCCAGCTGGTGGGTGG - Exonic
920276965 1:204813685-204813707 ATCCTTGCCCAGATGCTGGGAGG + Intergenic
920659451 1:207902891-207902913 GCGCTCGGCCTGGTGGTGGGTGG - Intronic
922786073 1:228282917-228282939 GCTGTAGCCCAGATGGTGGCTGG + Intronic
1067101546 10:43338272-43338294 GCGCTAACCCTGGTGGTGGGTGG - Intergenic
1070668446 10:78361656-78361678 GCTCTTGCCCAGTTGCTGAGAGG + Intergenic
1071348395 10:84715314-84715336 GCGCTTCCCCAGCTGGTTAGTGG + Intergenic
1073512431 10:104051209-104051231 GTGCTTGCTCAGATGGAGGCAGG + Intronic
1082799869 11:57406578-57406600 GGGCTTGCCCAGCTGCTGAGGGG + Intronic
1083324147 11:61865069-61865091 GCCTCTGCCCAGGTGGTGGGAGG + Intronic
1084066784 11:66708860-66708882 GGGCCTGCCCTGAGGGTGGGTGG + Intronic
1084669261 11:70595686-70595708 GCCCTTCCCCAGCTGCTGGGAGG + Intronic
1084731296 11:71075411-71075433 GCGCTTGCCCAGATGGTGGGTGG - Intronic
1087938592 11:104064994-104065016 GTGCTTACCCAGATTGAGGGTGG - Intronic
1091597161 12:1885905-1885927 GCTCTTGTCTGGATGGTGGGCGG - Intronic
1095432060 12:42144797-42144819 GCGCTCGCCTAGGTGGTGGGCGG - Exonic
1099964441 12:89430606-89430628 TCGCCAGCCCAGAGGGTGGGTGG - Intronic
1100933475 12:99637528-99637550 GCGCCTGCCCAGATTAAGGGTGG - Intronic
1101337247 12:103807537-103807559 GGGGTTGCCCAGCTGGAGGGTGG - Intronic
1104136343 12:125942992-125943014 AGGGATGCCCAGATGGTGGGTGG + Intergenic
1106084417 13:26527361-26527383 GGGCTTGCCCAGATGAAGTGGGG - Intergenic
1107239334 13:38213093-38213115 GTGCCTGCCCAGATTGAGGGTGG - Intergenic
1112371914 13:98801838-98801860 GCTTTTGTCCAGATGTTGGGTGG - Intronic
1114323824 14:21569302-21569324 GCGCCTGCCCAGATTAAGGGTGG + Intergenic
1115994278 14:39179232-39179254 GAGCTTGCGCAGCTGGTGAGTGG + Exonic
1118457125 14:65954876-65954898 ACGCTTGGCCAGATGGGGGCAGG + Intergenic
1121274830 14:92660355-92660377 GGCCTTGCCCACATGCTGGGTGG + Intronic
1122155404 14:99747484-99747506 TCGGTTGCCCAGTTGGGGGGTGG + Intronic
1122206960 14:100152459-100152481 GTGCTGGCCCACATTGTGGGCGG - Intronic
1125584192 15:40808744-40808766 GCTCTTGCAGAGATGGAGGGAGG - Intronic
1126468629 15:48983602-48983624 ACGCCTGCCCACATGATGGGAGG + Intergenic
1128135436 15:65259858-65259880 GTGTCTGCCCAGATGGTGGCAGG + Intronic
1131344226 15:91631138-91631160 GGGCCAGCCCAGAGGGTGGGTGG + Intergenic
1143340577 17:6207819-6207841 GAGGTTGCCCAGCTGGTGAGTGG + Intergenic
1143783174 17:9240063-9240085 GGGCTTTCCCAGGTGGGGGGAGG + Exonic
1144731295 17:17527970-17527992 GCCCTGGGCCAGGTGGTGGGGGG - Intronic
1146971169 17:37073582-37073604 GTGCGCACCCAGATGGTGGGAGG + Intergenic
1147399490 17:40171599-40171621 GCCCTTGCCCAGAAGGTGACTGG - Exonic
1148237354 17:45977743-45977765 GCATTTGCCCAGAAGTTGGGAGG + Intronic
1152106051 17:78329712-78329734 GGGCTGCCCTAGATGGTGGGGGG + Intergenic
1152396392 17:80035970-80035992 GGGCTGGGCCAGAAGGTGGGCGG - Intergenic
1152584213 17:81181872-81181894 GCCCTTGCCTACAAGGTGGGGGG + Intergenic
1159599052 18:70411322-70411344 GAGCTTGCACAGAGGGAGGGTGG - Intergenic
1159704444 18:71668935-71668957 GTGCTCACCCAGATGGAGGGTGG + Intergenic
1160752376 19:740506-740528 GCTCTGGCCCAGGTGGAGGGAGG - Intronic
1161016414 19:1985849-1985871 GCCCTGGCCCAGGTGGTGAGCGG - Exonic
1161271614 19:3392750-3392772 GCCCTCGCCCAGCTGGAGGGAGG - Intronic
1163153284 19:15427287-15427309 GCCCTGGCCAAGATGATGGGCGG - Exonic
1164989781 19:32675362-32675384 GCGCGTGCCCAGAACGTGAGGGG + Intronic
1165900331 19:39166704-39166726 GGGCTTGCCCAGGTGCAGGGAGG - Intronic
1166099015 19:40560080-40560102 GCGCTGGAGCAGATGGTGGGAGG + Intronic
1168097669 19:54124730-54124752 CAGCTGGGCCAGATGGTGGGTGG - Intronic
1168382462 19:55935404-55935426 GAGGTCGCCCAGATGGTAGGAGG - Intergenic
925733603 2:6941784-6941806 GCTCTTGCCCAGATGCTAAGTGG - Intronic
925905058 2:8535252-8535274 GAGCTTACCCAGAGGGTGGCTGG - Intergenic
926079543 2:9973223-9973245 ACGCCTGCTCTGATGGTGGGAGG - Intronic
926302068 2:11611702-11611724 CCCCTCTCCCAGATGGTGGGGGG + Intronic
927215530 2:20666331-20666353 GCCCTCGCCCAGAAGGCGGGTGG + Intergenic
927717118 2:25360077-25360099 GCTCTTGCCCAGAGAGTGGCAGG + Intergenic
928201886 2:29252596-29252618 GCCCTGGCCCAGAGGCTGGGAGG + Intronic
928396710 2:30948302-30948324 GCCCTTGCCCAGCTCCTGGGAGG + Intronic
932867192 2:75356019-75356041 GTGCTTGCCCACATAGAGGGTGG + Intergenic
936538788 2:113333387-113333409 GCGCTTCCCCAGCTGTTGTGTGG + Intergenic
938697207 2:133845072-133845094 GCATTTGCCCAGAGGATGGGTGG + Intergenic
946328823 2:218998618-218998640 GCGCTCGCCTGGTTGGTGGGTGG + Intergenic
946690678 2:222306368-222306390 GCGCGTGCCCAAATAGTGAGTGG - Intergenic
948908793 2:240992754-240992776 GTGCTCTGCCAGATGGTGGGTGG + Intronic
1169774712 20:9240005-9240027 GTGCCTGCCCAGATTGAGGGTGG + Intronic
1171445031 20:25196744-25196766 GCTCTTGCACAGCGGGTGGGAGG - Intronic
1172126980 20:32630262-32630284 TGGCTTGCCCTGTTGGTGGGTGG - Intergenic
1180093411 21:45543553-45543575 GGGGTTGCCCTGCTGGTGGGCGG - Intronic
1180936051 22:19625940-19625962 GCCCTGGCCCAGGTGGCGGGAGG - Intergenic
1182367786 22:29790413-29790435 GGCCCTCCCCAGATGGTGGGAGG + Intronic
1182419951 22:30244116-30244138 GAGCTTGCCCAAAGGGTTGGCGG - Intronic
1182505715 22:30780904-30780926 GGGCTTTCCCAGGAGGTGGGAGG + Intronic
1183903165 22:41021531-41021553 GAGGTCGCACAGATGGTGGGTGG + Intergenic
1185376934 22:50487010-50487032 GCTCTTGCCCAGCTGGACGGAGG - Intronic
953755966 3:45646177-45646199 GCGGTTGCCCAGCTGGTGAGTGG + Intronic
953884349 3:46707042-46707064 GCTCTTGCTCAGATGGGGGGCGG - Intronic
953896214 3:46804837-46804859 GCTCTTGCTCAAATGGTGAGTGG - Intronic
960965157 3:123099572-123099594 GCGCTTGCTCAGGTGGAGTGAGG + Intronic
961572806 3:127812588-127812610 GCGCTTGCCATGAGGGTGGAGGG + Intronic
968771562 4:2510808-2510830 GCACTTGGCCAGAAGGTGGGAGG + Intronic
968881724 4:3303581-3303603 GAGCTTGCCCTGGTAGTGGGGGG + Intronic
975493371 4:75012493-75012515 GAGCTAGTCCAGATGGTGGTCGG - Exonic
977619441 4:99119956-99119978 GTGATTGCTCAGAGGGTGGGGGG + Intergenic
977920331 4:102636192-102636214 GTGCCTGCCCAGATGTTGTGAGG - Intronic
981457485 4:144970503-144970525 GTGTTTGCCTCGATGGTGGGTGG + Intronic
981648661 4:147029682-147029704 GTGATTGCACAGATGGTGGGAGG - Intergenic
983228391 4:165106503-165106525 GTGCTTGCCCATATTGAGGGTGG - Intronic
985678951 5:1246119-1246141 GGGCTTGGCCTGATGGTGGGCGG + Exonic
986780557 5:11061544-11061566 TCCCTTGCCCAGATGGTGTAAGG + Intronic
1004838703 6:19558041-19558063 GCTATTTCCCAGAAGGTGGGAGG + Intergenic
1006093837 6:31643928-31643950 TCGTTGGCCCAGATGGTGAGCGG - Exonic
1007364730 6:41383432-41383454 GCGCCTCCCCACATGGTGGCTGG + Intergenic
1016992566 6:149940206-149940228 GCTCCTCCCCAGATGGTGTGGGG - Intergenic
1017053290 6:150414192-150414214 GTGCCTGCCCAGATTGAGGGTGG - Intergenic
1017395860 6:153999313-153999335 GTGCTTGCCCAGATTAAGGGTGG + Intergenic
1017744582 6:157435330-157435352 GTGCTTGCACACATGGAGGGAGG + Intronic
1019204108 6:170344630-170344652 GGACTTGCCCAGGTGGTGGCGGG - Intronic
1020427503 7:8085751-8085773 CCGCTAGCACAGATGGGGGGTGG - Intronic
1021623393 7:22569805-22569827 GGGCTTGACCAGAAGGTGAGGGG + Intronic
1032987657 7:137356659-137356681 GGGCCTGTCCAGGTGGTGGGAGG - Intergenic
1034429512 7:151034149-151034171 GCGCTTGTCCAGGTTGTGGCTGG - Intronic
1035263569 7:157676325-157676347 GGGCTGGGCCAGGTGGTGGGTGG - Intronic
1035551993 8:535690-535712 GCACTTGTCCATATGGTGGGAGG - Intronic
1038430173 8:27493686-27493708 GTGCCTGTCCAGCTGGTGGGAGG + Intronic
1039503040 8:38031648-38031670 GCGCTTGGCTAGGTGGCGGGCGG + Intronic
1045674207 8:104589485-104589507 GCTCTGGCCCAGCGGGTGGGGGG + Intergenic
1047995268 8:130329071-130329093 ACTCCTGACCAGATGGTGGGTGG + Intronic
1049340473 8:142109675-142109697 GCTCTTGGCCAGCTGGCGGGAGG - Intergenic
1049725429 8:144143470-144143492 GCGCTTGCCCTGCAGGTGGGAGG + Intergenic
1050742388 9:8836971-8836993 ACTCTTCCCCAAATGGTGGGGGG - Intronic
1058705290 9:107632900-107632922 GCGCAAGCCCATATGTTGGGTGG + Intergenic
1059251543 9:112891156-112891178 GCCCCTGCCCCGGTGGTGGGGGG - Intergenic
1059366023 9:113786930-113786952 GCACTTGCCCAGAGGGTGCTTGG + Intergenic
1059669529 9:116479181-116479203 GTGCTTGTCCAGATGATAGGAGG - Intronic
1060123743 9:121021657-121021679 TCGCTTGACCAGTTGGTAGGAGG - Exonic
1060210398 9:121706801-121706823 GTGCATGCCCAGGTGGTAGGTGG - Intronic
1061008669 9:127942705-127942727 TCCCTTGCCCTGGTGGTGGGGGG - Exonic
1061073379 9:128325802-128325824 GAGCTTGCCCAGGTCGAGGGTGG - Exonic
1185958505 X:4519301-4519323 GTGCCTACCCAGATTGTGGGCGG + Intergenic
1187811336 X:23180780-23180802 GGGCTTGCTCAAATGGTGGCTGG - Intergenic
1198783488 X:140261477-140261499 GTGCCTGCCCAGATTATGGGTGG + Intergenic
1200072443 X:153535879-153535901 GGGCTTGCCCAGGTGGGGGAGGG - Intronic