ID: 1084732856

View in Genome Browser
Species Human (GRCh38)
Location 11:71084547-71084569
Sequence CTGTTCTAGCACCTGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 214}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084732856_1084732858 21 Left 1084732856 11:71084547-71084569 CCATTCTCCAGGTGCTAGAACAG 0: 1
1: 0
2: 1
3: 23
4: 214
Right 1084732858 11:71084591-71084613 AGCCCATCAGCCTGAGAGCTCGG 0: 1
1: 0
2: 1
3: 19
4: 245
1084732856_1084732861 24 Left 1084732856 11:71084547-71084569 CCATTCTCCAGGTGCTAGAACAG 0: 1
1: 0
2: 1
3: 23
4: 214
Right 1084732861 11:71084594-71084616 CCATCAGCCTGAGAGCTCGGAGG 0: 1
1: 1
2: 1
3: 15
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084732856 Original CRISPR CTGTTCTAGCACCTGGAGAA TGG (reversed) Intronic
901290214 1:8118213-8118235 CAGTTCTAGGACCTGGTGTAGGG + Intergenic
901343623 1:8518309-8518331 CTGTCCCAGCACCTTGGGAATGG - Intronic
901582745 1:10258966-10258988 CTGTTCTAAGTCCTGGAGATGGG + Intronic
902702930 1:18184932-18184954 CTGTTTTCTCACCTGGAAAATGG + Intronic
904891167 1:33780688-33780710 CTGTTCTAGCCCCTGGAGGCTGG - Intronic
905184518 1:36186973-36186995 CAGGACTACCACCTGGAGAAGGG + Intergenic
906713260 1:47948450-47948472 CTCTTCTTGCCCCTGGAGACAGG + Intronic
906798420 1:48715519-48715541 CTGCACTAGCACCAGGATAATGG - Intronic
908579794 1:65502551-65502573 ATGTTCTAGCGGATGGAGAAAGG + Intronic
909196617 1:72634721-72634743 CTGTTCAAGTTCCTGGAAAAGGG - Intergenic
909806965 1:79884079-79884101 CTGTTCTGGAATCTGGAGGATGG + Intergenic
910463357 1:87471162-87471184 CTGTGTTACCACTTGGAGAAGGG + Intergenic
911458848 1:98162892-98162914 CTGTTTTTGCACCTGTAAAATGG + Intergenic
913976853 1:143466153-143466175 CTCTTCTAGCATCTGGAGTTGGG - Intergenic
914071255 1:144291780-144291802 CTCTTCTAGCATCTGGAGTTGGG - Intergenic
914107900 1:144674575-144674597 CTCTTCTAGCATCTGGAGTTGGG + Intergenic
918197308 1:182234517-182234539 CTTTTCTAGCACCTGGAAAATGG - Intergenic
918370567 1:183857286-183857308 CTCTTCTAGAACCTCTAGAAAGG + Intronic
918800205 1:188961241-188961263 CTGTTCTGGGGCCTGGAGGATGG - Intergenic
920003547 1:202815818-202815840 CTCTTCTGGCAGGTGGAGAAGGG - Intergenic
922487634 1:225987944-225987966 CTGAGGTAGCACCTGAAGAAAGG - Exonic
923092787 1:230752643-230752665 CTGTGCTAGCTCCTGGGGCAGGG - Intronic
924638777 1:245813390-245813412 CTGTGCTTGCACCTGGGGGAAGG - Intronic
1062967574 10:1620579-1620601 CTGTTCTAGAAAATGCAGAAGGG + Intronic
1062972593 10:1660257-1660279 CTGTTAGTGCACCTGCAGAAGGG - Intronic
1063164293 10:3445854-3445876 CTACTCTAGCAGTTGGAGAAAGG + Intergenic
1063647499 10:7899521-7899543 ATGTTCTAGAAGATGGAGAAGGG - Intronic
1064156436 10:12906779-12906801 CTGATGTAGCACCTGGTGTAGGG + Intronic
1065231676 10:23604974-23604996 CAGTTATAGAACCTGCAGAAGGG - Intergenic
1065814090 10:29469382-29469404 CTGTTCCAGAACCCAGAGAATGG + Intronic
1067082852 10:43221427-43221449 CTGTTCCTTCATCTGGAGAAGGG - Intronic
1067669012 10:48302928-48302950 CAGTTCTTGCAGCTGGAGGATGG + Intergenic
1070452652 10:76577634-76577656 GTGCTCTATCTCCTGGAGAAAGG - Intergenic
1071713523 10:88072966-88072988 CAGTTTTATCACCTGTAGAAGGG + Intergenic
1074821585 10:117183341-117183363 CTGTTCTAGCTCAAGGAAAAGGG + Intergenic
1075236732 10:120737268-120737290 CTGCTCTGGCACAGGGAGAATGG - Intergenic
1076186086 10:128450492-128450514 CAGCTTTAGCACCTGGAGCACGG + Intergenic
1076583513 10:131530598-131530620 CTGTTCTGTACCCTGGAGAAAGG - Intergenic
1078117324 11:8466651-8466673 CTATTCTAGGGTCTGGAGAATGG + Intronic
1078823747 11:14907048-14907070 TTGTTCTAGGCCCTGGGGAAGGG + Intronic
1080167074 11:29251560-29251582 CTGGGCTAGAACATGGAGAAAGG + Intergenic
1080596760 11:33780026-33780048 CAGTTCTAGCAGCTGGAGGGAGG - Intergenic
1081246311 11:40770985-40771007 CCGTTCTAGGATCTGGAGAATGG + Intronic
1083813840 11:65120795-65120817 CTGTTTGGCCACCTGGAGAAGGG + Exonic
1084102204 11:66957258-66957280 CTGTTTTCTCAGCTGGAGAACGG + Intronic
1084732856 11:71084547-71084569 CTGTTCTAGCACCTGGAGAATGG - Intronic
1090743471 11:129688031-129688053 CTGTTCCAGCACTGGGAGGAGGG - Intergenic
1090793092 11:130109273-130109295 CTGTTCTAGCTCCTGGGAAAAGG + Intronic
1091232683 11:133998889-133998911 ATGGTGTGGCACCTGGAGAAGGG + Intergenic
1091342515 11:134828232-134828254 CTGTTCTAGAACCTGCTCAAAGG + Intergenic
1095978733 12:47957982-47958004 CTATTCTAGGGTCTGGAGAATGG - Intergenic
1097169445 12:57104718-57104740 CTGTTCAAGAACCTGGTGAGGGG - Exonic
1097707224 12:62880800-62880822 CAGGGCGAGCACCTGGAGAAGGG - Intronic
1097762455 12:63483255-63483277 ATGTTACAGCACCAGGAGAAAGG - Intergenic
1097957817 12:65504593-65504615 CTGTCCAAGTACCTGGATAAAGG + Intergenic
1099576818 12:84392948-84392970 CTCCTATAGCAGCTGGAGAAAGG + Intergenic
1100418296 12:94402330-94402352 CTGTTTTACCACCTCTAGAATGG - Intronic
1101865450 12:108516572-108516594 CAGTTCCCTCACCTGGAGAAGGG + Intronic
1104095966 12:125558277-125558299 CTCTTCTCCCACCTAGAGAAGGG + Intronic
1105210117 13:18252648-18252670 CAGTTCCAACACCTGGAGCAGGG - Intergenic
1105222376 13:18343656-18343678 CTCTTCTAGCATCTGGAGTTGGG + Intergenic
1109189501 13:59307924-59307946 CTATTCTAGGGTCTGGAGAATGG + Intergenic
1109335943 13:60993779-60993801 ATGTGCTACCACATGGAGAAAGG - Intergenic
1109391846 13:61704490-61704512 CCATTCTAGCATCTGGAGGATGG - Intergenic
1109851470 13:68070803-68070825 CTGCTCTATCTCCTGGAAAAAGG - Intergenic
1111716615 13:91886929-91886951 CTGTTCTAGGGTCTGGAGGATGG + Intronic
1115939074 14:38589066-38589088 CTACCCTAGCACCTGGATAAGGG + Intergenic
1120528152 14:85601476-85601498 CTGTCCTAGCAGCTGGTGAATGG + Intronic
1120691057 14:87593484-87593506 CAGTTTTATCATCTGGAGAATGG + Intergenic
1122032230 14:98920714-98920736 CTGTTCTAGGCTCTGGAAAATGG + Intergenic
1123754419 15:23385832-23385854 CTGTTCTTGCATCTGTAAAATGG + Intergenic
1125282032 15:38052434-38052456 CTGTTCTAGGCCCTGGGGATGGG - Intergenic
1126807000 15:52360973-52360995 CTTTTCCAGCAGCTGGGGAAAGG - Intronic
1127713392 15:61623991-61624013 CTCGTCCAGCACCTGAAGAATGG + Intergenic
1128721356 15:69952252-69952274 CTGTTCTAACCCCCGGGGAAAGG + Intergenic
1129429353 15:75487547-75487569 CTGTTCTAGGTACTGGAGACAGG + Intronic
1130228149 15:82075728-82075750 GTGTGCTGGCCCCTGGAGAAGGG + Intergenic
1132231620 15:100188722-100188744 CTCCTCTATCACCTGGAGACAGG - Intronic
1132554052 16:564937-564959 CTGCTCCAGCGCCTGGTGAATGG - Exonic
1134363360 16:13553442-13553464 CTGTTCTCCCACCTGTAAAATGG - Intergenic
1134461946 16:14437165-14437187 CTGTTCTTGCATCTGTAAAATGG - Intronic
1135918329 16:26625813-26625835 CAGTTTTCTCACCTGGAGAATGG - Intergenic
1136024062 16:27458738-27458760 CTGTTCTGGCAGCTGCAAAAGGG + Intergenic
1138315407 16:56065374-56065396 CTGTTTGTGCACCTGCAGAATGG - Intergenic
1140966758 16:79973886-79973908 CTTGTCTAGCACCTGGAGTCAGG - Intergenic
1141289338 16:82703362-82703384 TTGTTCTAGCTGCTGGAGCATGG + Intronic
1141423347 16:83931105-83931127 CGGTGATAGCACCTGGAAAAGGG - Intronic
1141744796 16:85918623-85918645 CTGTTCGGGCACCTGGAGCGCGG + Exonic
1141932538 16:87215748-87215770 CTCTCCTAACACCTGCAGAAAGG - Intronic
1142938219 17:3357044-3357066 CTGTTGTAGCAAGGGGAGAAGGG - Intergenic
1145776179 17:27530573-27530595 CTCTTCTAGCAAAGGGAGAAAGG - Intronic
1147949169 17:44097455-44097477 CTGCCCCAGCACCAGGAGAAAGG + Intronic
1148149462 17:45388094-45388116 CAGTTTTTTCACCTGGAGAATGG - Intergenic
1148852960 17:50563581-50563603 CTCCACTAGCACCTGGAGATAGG - Intronic
1149141444 17:53437170-53437192 CAGTTCTGGCACCTTGAGATTGG + Intergenic
1151658127 17:75505062-75505084 CTGTTCTAGCACCTGCGGCCAGG + Exonic
1153440875 18:5117770-5117792 CTGTTCTGGGATCTGGAGGATGG - Intergenic
1156054630 18:32985452-32985474 TTGTTCTAGCACTAGAAGAATGG + Intronic
1157724314 18:49952123-49952145 CTGTTCTATCACGTGGTGAGGGG - Intronic
1158626168 18:59073343-59073365 CTGTTCCAGCACCCAGAGCAGGG + Intergenic
1161786712 19:6331021-6331043 CTGTTTTATCACCTGGAAAATGG + Intronic
1162141200 19:8586459-8586481 CCGGGCCAGCACCTGGAGAAAGG + Exonic
1165124053 19:33581551-33581573 TTTTTCTAGCTCCTGGATAAGGG - Intergenic
1165929917 19:39350787-39350809 CTGCACTCCCACCTGGAGAAAGG - Intronic
1166916575 19:46199478-46199500 CTTTTTTGACACCTGGAGAAGGG + Intergenic
1168545764 19:57248628-57248650 CTGATCTACCACCTAGAGCATGG + Exonic
927060268 2:19412147-19412169 CTTTTCTATCTCCTTGAGAAGGG - Intergenic
927108146 2:19845103-19845125 ATGTTCTTGCCCCTGGAGACCGG + Intergenic
929038432 2:37719675-37719697 CTGTTCCACCACTTGGGGAAAGG + Intronic
929650529 2:43676319-43676341 CTGTCCTAACGCCTGGAAAATGG - Intronic
931071217 2:58652437-58652459 CTCTTCTAGCAGCTGGGGGATGG + Intergenic
931991874 2:67798475-67798497 CTGTTCTAGAACCTGAAGCTGGG + Intergenic
933284439 2:80369875-80369897 CTCTTCTAGCACCTCCAGAAAGG + Intronic
933980462 2:87545183-87545205 CTGTTCTAGTACATGGGAAACGG + Intergenic
934181554 2:89627137-89627159 CTCTTCTAGCATCTGGAGTTGGG - Intergenic
934291857 2:91701357-91701379 CTCTTCTAGCATCTGGAGTTGGG - Intergenic
935239776 2:101168424-101168446 CCATTCTGGCACCTGGAGGATGG - Intronic
936313364 2:111405608-111405630 CTGTTCTAGTACATGGGAAACGG - Intergenic
937079692 2:119131874-119131896 CTGCTGAGGCACCTGGAGAAGGG + Intergenic
937751076 2:125476842-125476864 CTGTTCTAGGGTCTGGAGGATGG - Intergenic
939201238 2:139037743-139037765 CTGCTGTAGCACATGTAGAAAGG + Intergenic
941149364 2:161894758-161894780 CTGTTCTCCCTCCTGGAGAATGG + Exonic
944663379 2:201939553-201939575 CTTTTCAAGGCCCTGGAGAAAGG + Intergenic
946615045 2:221500163-221500185 CTGTTTCCTCACCTGGAGAATGG - Intronic
1170674961 20:18470531-18470553 CTGTTCTAGCCCAAGGACAAAGG + Intronic
1171328626 20:24318120-24318142 GTGTTCTAGAACCTGGGGAAGGG - Intergenic
1172147279 20:32765337-32765359 CAGTTCTATCACCTGTAAAAGGG - Intronic
1173919416 20:46732695-46732717 CTGTTCTAGGCCCTGGAAACAGG - Intronic
1173993015 20:47317445-47317467 ATTTCCTAGCCCCTGGAGAACGG - Intronic
1175027259 20:55915352-55915374 CTGTTCTAGCCCCTGATGGAAGG - Intergenic
1176730924 21:10496080-10496102 CTCTTCTAGCATCTGGAGTTGGG + Intergenic
1177121720 21:17145401-17145423 TTATTCCAGCACCTGGACAACGG + Intergenic
1178913249 21:36693170-36693192 CGGCTCGCGCACCTGGAGAAGGG - Intergenic
1180766140 22:18346756-18346778 CAGTTCCAACACCTGGAGCAGGG + Intergenic
1180780173 22:18515622-18515644 CAGTTCCAACACCTGGAGCAGGG - Intergenic
1180812889 22:18772943-18772965 CAGTTCCAACACCTGGAGCAGGG - Intergenic
1181199067 22:21207259-21207281 CAGTTCCAACACCTGGAGCAGGG - Intergenic
1185181842 22:49368232-49368254 CTGTTTGGGCACCTGGAGGATGG - Intergenic
1203227758 22_KI270731v1_random:87647-87669 CAGTTCCAACACCTGGAGCAGGG + Intergenic
949730129 3:7100990-7101012 ATGTTCCATCAACTGGAGAATGG - Intronic
950182909 3:10927629-10927651 CTTCCCTAGGACCTGGAGAAAGG + Intronic
950667865 3:14508169-14508191 CAGTTTTCCCACCTGGAGAATGG + Intronic
950686259 3:14620648-14620670 GTGTCCTAGCAACTGGAAAAGGG - Intergenic
950712996 3:14827108-14827130 CTGTTTTCTCACCTGGAAAATGG - Intronic
951156866 3:19365640-19365662 CTGTTCTAGATGCTGGAGATAGG + Intronic
953173715 3:40530235-40530257 CTGATCTCCCACCTGGAGAGAGG + Exonic
953336447 3:42098360-42098382 CTTTTCCAGCACATGGAGGAAGG + Intronic
954660155 3:52222732-52222754 CAGGTCTAGCACCTGCAGACCGG + Exonic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
955126876 3:56121116-56121138 CTGTTTTCTCACCTGTAGAATGG + Intronic
956464878 3:69509466-69509488 CACTTCCAGCACCTTGAGAAAGG - Intronic
960392136 3:117090463-117090485 TGGTTCTAGAATCTGGAGAATGG + Intronic
962611561 3:137081507-137081529 CTGTTATAGCAGCTAGAAAATGG + Intergenic
963785978 3:149534829-149534851 CTTTCCTAGCAGCTGGAGGACGG + Intronic
963886048 3:150583871-150583893 ATCTTCCAGCTCCTGGAGAAGGG - Exonic
965259245 3:166459108-166459130 CTGTAATAGCACCTGGTTAAAGG + Intergenic
969427876 4:7136429-7136451 CTGGTCTCTCACCTGGAGAGGGG + Intergenic
969505210 4:7582387-7582409 ATGTTCAACTACCTGGAGAAGGG - Intronic
974573744 4:63689310-63689332 CCGTTCTGGGATCTGGAGAATGG - Intergenic
976789495 4:88861862-88861884 CTGTTCTACCACCTTTAAAATGG - Intronic
977163091 4:93660983-93661005 CTGACCTCGCACCTGAAGAAAGG + Intronic
977454070 4:97235518-97235540 CTGTTCCAACACATGCAGAAAGG + Intronic
980105920 4:128588285-128588307 CTTCTCTAGCACATGGAGAGAGG + Intergenic
981235512 4:142410695-142410717 CTATTCTAGCATCTGCAAAATGG + Intronic
985016653 4:185643206-185643228 CTGTGCTGGGACCTGGAGGATGG + Intronic
985440604 4:189980683-189980705 CTGTTCTAGGAGCAGGAAAAGGG - Intergenic
986257752 5:6114759-6114781 CTGTACCAGCACCTGCAGGATGG + Intergenic
986398987 5:7361119-7361141 CTGTTCCAGAAGCTGGAAAAGGG + Intergenic
991510147 5:67367074-67367096 CTCTCATAGCACCTGGAGAAAGG - Intergenic
993737834 5:91498857-91498879 CTGCTCTAGGAACTGGAGAAAGG + Intergenic
995243448 5:109911329-109911351 CTGTGCTAGCTACTGGAGATAGG + Intergenic
996796868 5:127357116-127357138 CTGTTCTAACAACTCAAGAAAGG + Intronic
996881960 5:128308571-128308593 CTCTTTTATGACCTGGAGAATGG - Intronic
996904174 5:128578522-128578544 CTGTTCCACCTCCTGGAGATAGG + Intronic
998386032 5:141757673-141757695 CTTTTCTAGGAGCTGGAGCAGGG + Intergenic
999108044 5:149091213-149091235 CTATTCTAGGATCTGGAGGATGG - Intergenic
1000268453 5:159659989-159660011 GTGTTCAAGGACCTGGAGGAAGG + Intergenic
1000550888 5:162662757-162662779 CTGTTTTAGCAGGTGTAGAATGG + Intergenic
1000676941 5:164132685-164132707 CTATTCTAGGATCTGGAGGATGG - Intergenic
1001764442 5:174234335-174234357 CTCTTCTCTCACCTGTAGAATGG - Intronic
1001765803 5:174246011-174246033 GTGTACTAGCACCTGCAGATTGG + Intergenic
1002840532 6:901459-901481 GTGTGCTAGGAGCTGGAGAAAGG - Intergenic
1004470193 6:15922137-15922159 CTGTTCTGGCACCTTCAGAGGGG + Intergenic
1005812841 6:29529850-29529872 CTGTTCTACCTCTTGGGGAAGGG + Intergenic
1009780269 6:68260304-68260326 CCATTCTAGGATCTGGAGAATGG + Intergenic
1011385761 6:86796303-86796325 CCATTCTAGGGCCTGGAGAATGG + Intergenic
1012064851 6:94537354-94537376 CTATTCTGGGGCCTGGAGAATGG + Intergenic
1013601768 6:111711860-111711882 CTTTTCTATAACCTTGAGAAAGG + Intronic
1014143578 6:117971431-117971453 CAGTTCTGGCATCTGGAGGATGG + Intronic
1015177563 6:130327327-130327349 CAGTTCTAGAATCTGGAGAATGG - Intronic
1015938485 6:138425719-138425741 TTGTTCTAGGACCTGGAGTGGGG - Intronic
1018201195 6:161397188-161397210 ATGTTCTAGCACCTGGATCTTGG - Intronic
1021068381 7:16205650-16205672 CAGTTCTAGCCCATGGAGAAAGG - Intronic
1022614610 7:31916521-31916543 CTGTTCTCACACCAGGAAAATGG - Intronic
1023372687 7:39528074-39528096 CTGTTCTTGCATCTGGTGCAAGG - Intergenic
1024063038 7:45713223-45713245 CTGTTCTAGCATCTGGAGCTGGG + Intronic
1026499815 7:70934931-70934953 CTGTTCTGAGACCTGGAGAAAGG + Intergenic
1030503610 7:110390837-110390859 TTGTACTAGTACTTGGAGAATGG + Intergenic
1030805908 7:113918807-113918829 CTCTTCTAGTACCTGAAGATGGG + Exonic
1032319133 7:130868737-130868759 CTGTTTTAACAGCTGTAGAATGG + Intergenic
1033027565 7:137790759-137790781 CTGTATTATCACCTGGAAAATGG + Intronic
1034359747 7:150484074-150484096 ATCTTCTAGCTCCTGGAGAAGGG + Intergenic
1034371686 7:150603576-150603598 ATCTTCTAGCTCCTGGAGAAGGG + Intergenic
1034379358 7:150676848-150676870 ATCTTCTAGCTCCTGGAGAAGGG + Intergenic
1034598659 7:152225429-152225451 CTCTTCTAGCATCTGGAGTTGGG - Intronic
1035022285 7:155806798-155806820 CTGTTTCAGGACCTGGAGAAAGG - Intronic
1035396069 7:158535532-158535554 CTGTTAGAGCACCTGGGGAGCGG + Intronic
1036782418 8:11658783-11658805 CTGTTTTCTCATCTGGAGAATGG - Intergenic
1038622061 8:29153756-29153778 CAGTCCTACAACCTGGAGAAAGG + Intronic
1039119043 8:34125365-34125387 CTGGCCAAACACCTGGAGAAAGG - Intergenic
1039417794 8:37410346-37410368 CTCTTCAAGCTGCTGGAGAATGG - Intergenic
1039461030 8:37744478-37744500 CTGTTGTAGCACCTTGGAAAAGG + Intronic
1040777927 8:51070119-51070141 CTGTTCTATTACTTGGAGCAGGG + Intergenic
1041538550 8:58956249-58956271 TTATTCTAGGAGCTGGAGAAGGG + Intronic
1041589040 8:59555316-59555338 CTGTTCTAGCATGTGAAGAAAGG - Intergenic
1041644068 8:60233618-60233640 CTGTTGTTGCAGCTGGAGAAGGG - Intronic
1042509059 8:69592226-69592248 GTGTCCTAGAAACTGGAGAATGG + Intronic
1042663747 8:71183533-71183555 CTTTTCTAAAACCTGGAGAAGGG - Intergenic
1044174065 8:89094788-89094810 ATGTTCTAGAACCTAGATAAAGG + Intergenic
1044283775 8:90387053-90387075 CAATTCTAGCATCTGGTGAATGG + Intergenic
1044522082 8:93210458-93210480 CTGTGTTAGAACCTGGAGATAGG + Intergenic
1046354268 8:113059290-113059312 CTAATCTAGCACCTGGAAAATGG + Intronic
1046932491 8:119855620-119855642 CTGTGCCAGCAGCTGGAGGATGG - Exonic
1046981026 8:120336557-120336579 ATGTTCTGGCAGCTGGGGAATGG - Intronic
1047118274 8:121870004-121870026 CTGATCCAGCACCTCGAAAAAGG - Intergenic
1049681475 8:143920453-143920475 CTGTTCCAGGCCCTGAAGAAGGG - Exonic
1050402492 9:5271035-5271057 CCATTCTGGCATCTGGAGAAAGG - Intergenic
1051984226 9:23063506-23063528 CTATTCTGGGATCTGGAGAATGG + Intergenic
1051995435 9:23210261-23210283 CTCTTCTAGCAGATAGAGAAGGG - Intergenic
1052016260 9:23471803-23471825 CTTTTCCAGCATCTGGAGACGGG + Intergenic
1057078257 9:92152356-92152378 CTGTTCTAACAACTGAAAAACGG + Intergenic
1058105840 9:100970923-100970945 CTGTTCTTGCTCATGGAAAAAGG + Intergenic
1062741720 9:138178951-138178973 CTGTTCTAGGAGCAGGAAAAGGG + Intergenic
1186428978 X:9488351-9488373 CTTTTCCAGCTCCTGGAGACTGG + Intronic
1187137408 X:16561388-16561410 CTCTTGAAGCACCTCGAGAAAGG + Intergenic
1195458210 X:105093454-105093476 GTGTGCTAGAAGCTGGAGAAGGG + Intronic
1198228076 X:134664779-134664801 CTGCTCTGGCTCATGGAGAAAGG - Intronic
1198963874 X:142207833-142207855 CTGCTGTAACACCTGGAGAAAGG - Intergenic
1199420801 X:147642412-147642434 ATGTTCTAAAACCTTGAGAATGG - Intergenic