ID: 1084733154

View in Genome Browser
Species Human (GRCh38)
Location 11:71087408-71087430
Sequence CTGGCAAAAGGGCTGGCGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 223}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084733148_1084733154 2 Left 1084733148 11:71087383-71087405 CCAAAGTTGAGACACAGGGGCTA 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1084733154 11:71087408-71087430 CTGGCAAAAGGGCTGGCGGCTGG 0: 1
1: 0
2: 1
3: 23
4: 223
1084733146_1084733154 4 Left 1084733146 11:71087381-71087403 CCCCAAAGTTGAGACACAGGGGC 0: 1
1: 0
2: 1
3: 12
4: 161
Right 1084733154 11:71087408-71087430 CTGGCAAAAGGGCTGGCGGCTGG 0: 1
1: 0
2: 1
3: 23
4: 223
1084733142_1084733154 12 Left 1084733142 11:71087373-71087395 CCAGGAATCCCCAAAGTTGAGAC 0: 1
1: 1
2: 0
3: 5
4: 125
Right 1084733154 11:71087408-71087430 CTGGCAAAAGGGCTGGCGGCTGG 0: 1
1: 0
2: 1
3: 23
4: 223
1084733147_1084733154 3 Left 1084733147 11:71087382-71087404 CCCAAAGTTGAGACACAGGGGCT 0: 1
1: 0
2: 0
3: 7
4: 138
Right 1084733154 11:71087408-71087430 CTGGCAAAAGGGCTGGCGGCTGG 0: 1
1: 0
2: 1
3: 23
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084733154 Original CRISPR CTGGCAAAAGGGCTGGCGGC TGG Intronic
900931995 1:5743527-5743549 CTGACGAAGGGGCTGTCGGCTGG - Intergenic
901673792 1:10871107-10871129 CTGGGGAAATGGCTGGGGGCGGG + Intergenic
902142644 1:14369717-14369739 CTGGCACAAGGGCTGTGGTCAGG - Intergenic
902836929 1:19053530-19053552 CCGGCAGGAGGGCTGGGGGCTGG - Intergenic
903757017 1:25669439-25669461 CTGGCAAAAGGGCTGGTACATGG + Intronic
903850904 1:26305492-26305514 CTTGGAAAAGGGGTGGGGGCTGG - Intronic
905058704 1:35121176-35121198 CTAGCAGAAGAGGTGGCGGCAGG - Intergenic
906226773 1:44129213-44129235 CTGGGAAATGGTCTGGAGGCAGG + Intronic
907871376 1:58446521-58446543 CAGTCAAAAGGGCTGGGGGTGGG + Intronic
907945982 1:59137137-59137159 GTGGCTCAAGGGCTGGGGGCTGG + Intergenic
913466357 1:119147233-119147255 CTGGGGAAGGGGCTGGCGGAGGG - Intergenic
914871098 1:151474710-151474732 CTGGTAAAAGGGCTGCAGGAGGG - Intergenic
916625614 1:166552396-166552418 CTGGAAAAAGGGCTGAAGCCAGG - Intergenic
917779863 1:178382568-178382590 CTGGTAAAAAGGGTGGGGGCAGG - Intronic
920282415 1:204854089-204854111 CAGGCAAAAAGGCTGGTGGGTGG - Intronic
1069995150 10:72337262-72337284 CAGGGAAAAGGGCTGGCATCTGG + Intronic
1071580967 10:86769936-86769958 CTGGCAAGAAGGCTGGTGCCTGG - Intronic
1072417872 10:95263984-95264006 CTGGCAGTAGTGCTGGAGGCAGG + Exonic
1072430748 10:95368814-95368836 CAGCCAAAAGGGCTGGAGGATGG - Intronic
1073460306 10:103662009-103662031 CTGGAAGCAGGGCTGGGGGCAGG - Intronic
1073470386 10:103718473-103718495 CAGGGCAAAGGGCTGGGGGCTGG + Intronic
1074099672 10:110344807-110344829 TTGGCAGTAGGGCTGGTGGCAGG - Intergenic
1074374517 10:112928273-112928295 CTGACAAAGGAGCTGGAGGCGGG - Intergenic
1074881374 10:117662049-117662071 ATGGCAAAAGGGTGGGGGGCGGG - Intergenic
1075075857 10:119349697-119349719 CTGGGAAAAAAGCTGGCTGCAGG - Intronic
1075483286 10:122800136-122800158 TGGGCAAAAGGGCTGGGGGCAGG + Intergenic
1076167853 10:128296773-128296795 CTGCCAAAAGGGGTGGGGCCAGG + Intergenic
1076536151 10:131179022-131179044 CTGTCAGAGGGGCTGGAGGCTGG - Intronic
1077388992 11:2290621-2290643 CTGGCAGCAGGGCAGGCAGCTGG + Intergenic
1077552023 11:3204665-3204687 CTGGCAGAGGGGGTGGGGGCCGG - Intergenic
1079103154 11:17553775-17553797 CTGGCATAAGGTCTGGTGGCGGG + Intronic
1081851520 11:46278003-46278025 CTGGCAAACGGGCGGGGGGCAGG - Exonic
1081869128 11:46375383-46375405 ATGGCACCAGGGCTGGGGGCAGG - Intronic
1083203174 11:61132200-61132222 CTGGGAAAGGGGCCGGTGGCAGG + Exonic
1083249182 11:61454378-61454400 CTGTCCAAAGGGCTGGCTCCCGG - Intronic
1083307885 11:61770322-61770344 CTGGCAAGTGGGCTGGAGGTGGG - Exonic
1084349384 11:68584299-68584321 CTGGGAAAAGGGCTGCTTGCAGG - Intronic
1084733154 11:71087408-71087430 CTGGCAAAAGGGCTGGCGGCTGG + Intronic
1085641658 11:78196721-78196743 CTGGCAGAAGAGCAGGCGGTGGG - Exonic
1085791405 11:79500217-79500239 CTCCCAGAAGGGGTGGCGGCCGG - Intergenic
1085798358 11:79564458-79564480 ATGGCAGTAGGGCTGGCTGCAGG + Intergenic
1086555340 11:88103915-88103937 CTGGCAAGAAAGCTGGCTGCTGG - Intergenic
1089220999 11:116871570-116871592 GTGTGAAAAGGGCTGGTGGCAGG + Intronic
1089325998 11:117657464-117657486 CTGACAAAAGGACTTGTGGCAGG - Intronic
1092165235 12:6338300-6338322 CTGACACATGGGATGGCGGCAGG - Intronic
1092285196 12:7124609-7124631 CTGGTAAATGGGGTGGGGGCTGG - Exonic
1096075994 12:48805131-48805153 CTGGCAAACAGGCTGGGAGCTGG + Intergenic
1097992040 12:65845944-65845966 ATGGCCAAAGGGCAGGCAGCAGG - Intronic
1098485552 12:71017419-71017441 CTGGCCAAAGGGCTGGCCTTGGG + Intergenic
1100678937 12:96898003-96898025 GTGGCAAAGGGCCTGGGGGCGGG + Intergenic
1100860743 12:98803697-98803719 CTGGGAACAGGGCTGGGGGTGGG + Intronic
1101089194 12:101267272-101267294 CTGGCAGACTGGCTGGGGGCTGG - Intergenic
1102201007 12:111057634-111057656 CTGGCAGAAGGGGAGGCTGCTGG - Intronic
1103413062 12:120726150-120726172 CTGGGAACTGGGCTGGTGGCTGG - Intronic
1104990311 12:132620759-132620781 CTGGCCATGGGGCTGGCTGCTGG + Intronic
1105441201 13:20416421-20416443 CTGGCAGGAGGTCTGGAGGCAGG + Intronic
1106153548 13:27130138-27130160 CTAGTAACAGGGCTGGCAGCGGG + Intronic
1106168527 13:27270017-27270039 ATGGGAAAAGGGCGGGGGGCGGG - Intergenic
1107836564 13:44416435-44416457 CTGGCAACATGGCAGGCGGCAGG - Intergenic
1110019934 13:70457468-70457490 CTGGAAAGGGGGCTGGAGGCAGG + Intergenic
1113967898 13:114164887-114164909 CTGGCAGCAGGGCAGGCGGCAGG - Intergenic
1114064297 14:19047796-19047818 CTGACAAAAGGGCTGACCCCTGG - Intergenic
1114097962 14:19352202-19352224 CTGACAAAAGGGCTGACCCCTGG + Intergenic
1114211850 14:20622708-20622730 CAGCCAAAGGGGCTGGCGACGGG + Intergenic
1117261009 14:54033409-54033431 GTGGCAGAAGGGCTGGGGGAGGG - Intergenic
1117920259 14:60721592-60721614 CAGGCAACTGGGCCGGCGGCGGG + Intronic
1120169482 14:81234486-81234508 CTTGCCAAAGGGCTGGGGGGTGG + Intergenic
1120953682 14:90063253-90063275 CTGGCTAATGGGATGGAGGCGGG + Intronic
1121277717 14:92679188-92679210 CTGACAAAAGGGCTGGATGCAGG - Intronic
1121315611 14:92959363-92959385 CTGACACAAGGGGTGGCAGCTGG - Intronic
1122130635 14:99603110-99603132 CTGGGAAAAGGGCTGCAGCCAGG + Intronic
1122814832 14:104307266-104307288 CTTGCCAGAGGGCTGGCGGTGGG + Intergenic
1126455577 15:48858316-48858338 CAGGGAAAAGGGGTGGCAGCGGG - Intronic
1128159675 15:65415369-65415391 CCGCCAGAGGGGCTGGCGGCTGG + Intronic
1128569845 15:68726180-68726202 CAGGGAAAGGGGCTGCCGGCAGG - Exonic
1128678809 15:69631398-69631420 CAGGCAAAAGGGCCAGAGGCAGG - Intergenic
1130411707 15:83653760-83653782 TTGGCACAACGCCTGGCGGCCGG + Intergenic
1130423187 15:83768880-83768902 AAGGCAGAAGGGCTGGCTGCTGG + Intronic
1130751210 15:86715043-86715065 CCAGCAAAAGTGCTGGGGGCAGG - Intronic
1130903256 15:88223038-88223060 CTGGCAGGAGGGTGGGCGGCAGG + Intronic
1132514307 16:359211-359233 CTGGCAACAGGGCGGGGGCCTGG + Intergenic
1132829277 16:1919513-1919535 CTGGCCACAGGGCTGGCGCCAGG + Intergenic
1136385953 16:29926106-29926128 CTGGCCCAAGGGCTGGGGGCCGG - Exonic
1136505569 16:30700738-30700760 CTGGCCGAGGGGCTGGCGTCCGG - Exonic
1137430774 16:48416703-48416725 CTCCCAAAAGGGGTGGCGGCCGG + Intronic
1138813893 16:60182392-60182414 CTAGCACAAGGGCTGGGGGTGGG - Intergenic
1139392262 16:66612443-66612465 CTGGCATCAGGGCAGGCCGCGGG - Intronic
1139513473 16:67440261-67440283 CAGGCACATGGGCTGCCGGCGGG + Intronic
1139632017 16:68236644-68236666 CTGGGAAAGGGGAGGGCGGCGGG + Intronic
1141418936 16:83899223-83899245 CTGGCGAGCGGGCAGGCGGCCGG + Exonic
1141464964 16:84199268-84199290 CTGGGAAAACGGCAGGCGGGAGG + Intergenic
1142136852 16:88455518-88455540 CTGGCAAGAGGGCGGGCGGGCGG - Intronic
1142240953 16:88944798-88944820 CTGGCCAAAGGGCAGGCGCTAGG + Intronic
1142674251 17:1503805-1503827 AGGGCAAAAGGGCTGAGGGCAGG - Intronic
1143551747 17:7634573-7634595 CTGGAAAAAGGGGTGGAGGCAGG + Intergenic
1143622560 17:8089058-8089080 CTAGGAAGAGGGCTGGAGGCAGG + Intergenic
1143751688 17:9032740-9032762 CTGGCCAAAGGGCTGAGGGTAGG - Intronic
1147326350 17:39671558-39671580 ATGGCAAAGGGGCTGGCAGCAGG + Exonic
1147341114 17:39753886-39753908 GTGGCGGAAGGGCGGGCGGCGGG - Intergenic
1147790949 17:43014053-43014075 ATGGGAGAAGGGCTGGGGGCTGG - Intronic
1148046640 17:44748868-44748890 GTGGCACAAGGGCTGGAGGGAGG - Intronic
1148334509 17:46832449-46832471 CTGGCAACAGGCCTGGCAGGAGG - Intronic
1152031785 17:77847360-77847382 CTGGGAGAAGGGCTCTCGGCCGG - Intergenic
1152100592 17:78299579-78299601 CTGGCAAAAGAGCAGGGGGTTGG - Intergenic
1152642509 17:81455056-81455078 CAGGCAGAGGGGCTGGCTGCAGG + Intronic
1153059400 18:980071-980093 CTGGAAAAAGGGCTGAAGCCAGG - Intergenic
1155344957 18:24848798-24848820 CTGGGAAGAGGGCTGGATGCTGG - Intergenic
1157569622 18:48703869-48703891 CTGCCAAAAGGGCTGTGGCCAGG + Intronic
1158308043 18:56128017-56128039 CTGACATAAGGGCTGGTGGGTGG - Intergenic
1160178294 18:76613439-76613461 CTGAGAAAAGGGATGGAGGCAGG + Intergenic
1160499548 18:79395396-79395418 CTGGAAAAGGGGCGGGGGGCGGG - Intergenic
1160796344 19:947462-947484 CTGTGAAACGGGCTGGCGGCCGG + Intronic
1160975870 19:1792124-1792146 CTGGGCAAAGGCCTGGGGGCCGG + Exonic
1161260837 19:3337009-3337031 CTGCCAACAGGGCTGGGGGTGGG + Intergenic
1162479780 19:10921513-10921535 CAGGCAAGAGGGCAGGCGGGCGG - Intronic
1162531118 19:11237005-11237027 CTGGGACCAGGGCTGGGGGCAGG - Intronic
1163448176 19:17359951-17359973 CAGGCCAAAGGCCTGGAGGCTGG - Intronic
1164671568 19:30074946-30074968 CTGGCTAATGGGCTGGGAGCAGG + Intergenic
1165427208 19:35752824-35752846 CTGGCAAAAGGTAAGGTGGCAGG + Exonic
1165485648 19:36093973-36093995 CAGGCAAATGGGCTGGTGGTGGG - Intronic
1165816845 19:38647798-38647820 CGGGCAATGGCGCTGGCGGCGGG + Exonic
1166315066 19:41985102-41985124 CTGGCATCAGGGCTGGAGGTGGG - Exonic
1166727404 19:45037415-45037437 CTGGCAGCAGGGCTGACGGCGGG - Exonic
1167096476 19:47377303-47377325 CTGGCACCTGGGCTGGCCGCAGG + Intronic
1167502693 19:49856677-49856699 CAGTCAGGAGGGCTGGCGGCAGG + Intronic
1168078257 19:53992035-53992057 CTGGAAAAGGGGCCGGTGGCCGG - Intergenic
1168722064 19:58559597-58559619 CTGGAAAAGGGGATGGAGGCGGG + Intergenic
926251381 2:11157083-11157105 CAGGCCTAGGGGCTGGCGGCAGG - Intronic
928009482 2:27594366-27594388 CTCCCAGAAGGGGTGGCGGCCGG + Intronic
932098038 2:68869421-68869443 CTGGCAGAGGTGCTGGCGGCTGG + Intronic
932410190 2:71542892-71542914 CTCGCAGATGGGGTGGCGGCCGG + Intronic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
934248279 2:90325023-90325045 CGGGCAAAAGCCATGGCGGCGGG + Intergenic
935567966 2:104629677-104629699 CTGGAAAAGGGGCTGAAGGCAGG - Intergenic
936019103 2:108981268-108981290 CTGGAAAGAATGCTGGCGGCAGG - Intronic
937362516 2:121238948-121238970 CTGGCAGCAGGGGTGGAGGCAGG - Intronic
937993625 2:127677583-127677605 CTGGAAAAAGGGGAGGTGGCAGG + Intronic
938316069 2:130328972-130328994 CTGAGAGAAGGGCTGGTGGCTGG - Intergenic
942487611 2:176455972-176455994 CTGGCAGGAGGGCTGACGTCAGG + Intergenic
943085021 2:183300780-183300802 CTGGAAAAAGGGCTGAAGCCAGG - Intergenic
943125797 2:183792437-183792459 CTCCCAAACGGGGTGGCGGCCGG + Intergenic
946083901 2:217151722-217151744 CTAGGCAAAAGGCTGGCGGCAGG + Intergenic
946171322 2:217897697-217897719 CTGGCACAGGGGCTGGTGGCAGG + Intronic
946194789 2:218026658-218026680 GTGGGAAAAGGGCTGGAGGGAGG - Intergenic
946196167 2:218034030-218034052 CTGTCGCAAGGGCTGGGGGCGGG - Intergenic
947717062 2:232346165-232346187 CTGGCAAAAGGTCTTGTTGCAGG - Intergenic
1171170935 20:23014950-23014972 CTGGCAAGAGAGCTGGAAGCTGG - Intergenic
1172595616 20:36149239-36149261 CTGGCAAAGGGGCTGGGGCAGGG - Intronic
1172707786 20:36895292-36895314 CTGGGTTAAGGGCTGGCAGCAGG - Intronic
1173640950 20:44601453-44601475 CTGGGAAAAGGGAGGGCTGCCGG - Intronic
1175267169 20:57709837-57709859 CCGGAAAATGGGCTGGCAGCGGG + Exonic
1176582934 21:8548905-8548927 TTGGCAAAAGCCGTGGCGGCGGG - Intergenic
1178715180 21:34957909-34957931 CGGGCAAAAGGGTTGGCTACTGG - Intronic
1179519264 21:41931737-41931759 CTGACAAAAGGGCTGTTGGGGGG + Intronic
1180093255 21:45543017-45543039 CAGGCAGGAGGGCGGGCGGCGGG - Intronic
1180482788 22:15770422-15770444 CTGACAAAAGGGCTGACCCCTGG - Intergenic
1180872006 22:19151470-19151492 CTTGCAGAGGGGCTGGCGGCGGG - Intergenic
1180995614 22:19963787-19963809 CTGGAAAAAGGGCCGGCTGTGGG + Intronic
1182419950 22:30244112-30244134 TTGCCCAAAGGGTTGGCGGCAGG - Intronic
1182422372 22:30254702-30254724 CTAGCCAGAGGGCTGGCAGCAGG + Intergenic
1183392355 22:37552663-37552685 CTGGGAAAAGGGCTGGCCTGTGG - Intergenic
1184145755 22:42609368-42609390 CTGGCAAGAGCGCTGCTGGCAGG + Intronic
1184430210 22:44438052-44438074 TTGGCACACGGGCAGGCGGCGGG + Intergenic
1184799615 22:46751693-46751715 CTGGCAACAGAGCTGGGGGAAGG + Intergenic
1184932803 22:47693637-47693659 CCCGCAAAGGGGCTGGGGGCTGG - Intergenic
949950576 3:9225628-9225650 CTAGCAGAAGGGCGGGCAGCTGG - Intronic
954217246 3:49131505-49131527 CTGGCATCTGGGCTGGGGGCTGG - Intronic
954615190 3:51965909-51965931 CTGGAAGAAGGGCTGGGGGGTGG + Intronic
957249648 3:77756908-77756930 CTGGAAAAAGGGCTGAAGCCAGG + Intergenic
961001184 3:123375112-123375134 CTTGAAAAAGGGCTGGGGGCAGG - Intronic
961795149 3:129403761-129403783 CTCTCGAAAGGGCTGGAGGCAGG + Intronic
964008439 3:151860055-151860077 CTGGAAAAAGGAATGGAGGCAGG + Intergenic
966907533 3:184538729-184538751 CTGGGATAAGGGTTGGCGTCTGG - Intronic
967164950 3:186772471-186772493 CTGCCAGCTGGGCTGGCGGCGGG + Intergenic
968089774 3:195892792-195892814 CAGGCAAGAGGGAGGGCGGCCGG - Intronic
968762639 4:2450559-2450581 TTGGCAAAGCAGCTGGCGGCTGG + Intronic
969561596 4:7951539-7951561 CTGGGAGAGGGGCTGGCTGCGGG + Intergenic
970534370 4:17014272-17014294 CTGGCAGAAGGGCTGGAAGCAGG - Intergenic
975212993 4:71722664-71722686 CTGGAAAAAGGGCTGAAGCCAGG - Intergenic
976438272 4:85043809-85043831 CTGGAAAAGGGGCTGGAGCCAGG + Intergenic
979273776 4:118792366-118792388 CTCCCAGAAGGGGTGGCGGCCGG - Intronic
980308625 4:131099246-131099268 CTGGCACAAGGGCTGACACCTGG - Intergenic
981036081 4:140169999-140170021 CTGGTGTAAGGGCTGGGGGCTGG + Intergenic
981994852 4:150963984-150964006 CTCCCAGAAGGGGTGGCGGCAGG - Intronic
989958859 5:50387199-50387221 CTGGCAAGAGGGCTGAAGCCAGG + Intergenic
992287330 5:75248671-75248693 CTGGAAAAAGGGGTGGCTGTAGG + Intergenic
993686319 5:90942623-90942645 CTGGCAAAAGGGGTGGTAACAGG + Intronic
994438090 5:99763772-99763794 CTGGAAAAAGGGCTGAAGTCAGG - Intergenic
994991333 5:107000234-107000256 CTGGAAAAAGGGCTGAAGCCAGG - Intergenic
995239640 5:109871357-109871379 ATGGCAAAATGGCTGCCAGCAGG + Intergenic
995813738 5:116141689-116141711 CTGGGAAGAGGGGTGGTGGCTGG + Intronic
996426639 5:123320304-123320326 CTGGAAAAAGGGCTGAAGCCAGG - Intergenic
997565928 5:134886413-134886435 CTGGCACAAAGTCTGGCAGCTGG + Intronic
999246193 5:150155945-150155967 CTGGGAGAAGGGGGGGCGGCGGG + Intergenic
999488731 5:152026983-152027005 CTGAAAAAAGGGCTGACGCCAGG - Intergenic
999693534 5:154168809-154168831 CTGGCACCAGGCCTGGCAGCGGG + Intronic
999928521 5:156405790-156405812 CTGGCTATAGGCCTGGGGGCAGG + Intronic
1002347377 5:178557456-178557478 CTGGCAGGAGGACTGGCGGGGGG - Intronic
1002541201 5:179907636-179907658 CTGGCGGCGGGGCTGGCGGCGGG - Intronic
1003276862 6:4660923-4660945 CAGCCAAGAGGGCTGGCAGCTGG - Intergenic
1006425630 6:33961207-33961229 CTTCTAAAAGGGCTGGCAGCTGG + Intergenic
1006826927 6:36941948-36941970 CTCCCAGAAGGGGTGGCGGCGGG - Intergenic
1009794155 6:68445075-68445097 CTGGCAAAAGGACTGCCGAAAGG - Intergenic
1010040960 6:71383404-71383426 CTGCCAAAAAGGCTGGGGACCGG - Intergenic
1010214329 6:73388528-73388550 CTTGAAAAAGGGATGGCAGCTGG + Intronic
1011099892 6:83709047-83709069 CTGGCAGAAGAGGCGGCGGCGGG - Intronic
1011474122 6:87735859-87735881 CTCCCAGAAGGGGTGGCGGCCGG + Intergenic
1013189144 6:107787094-107787116 CTGGCAACAGAGCTGGCTGGGGG + Intronic
1013288467 6:108699838-108699860 CTGGCAGGAGGGCTGGGGCCTGG + Intergenic
1018918374 6:168152773-168152795 CTGGCAGAAGCGCCAGCGGCAGG + Intergenic
1019070388 6:169340641-169340663 CTGGCACAGGGGCTGGCCCCGGG + Intergenic
1019128311 6:169856543-169856565 CTCCCAAACGGGGTGGCGGCCGG + Intergenic
1019170902 6:170132645-170132667 TAGGCAACAGGGCTGGCTGCAGG + Intergenic
1020339002 7:7089250-7089272 CTGGAAAAAGGGCTGAAGCCAGG - Intergenic
1021777968 7:24072469-24072491 CTGGCAGATGGGCTGGGGGAAGG + Intergenic
1023411315 7:39891669-39891691 CTTCCAAAAGGGCTGATGGCAGG + Intergenic
1025200260 7:56957363-56957385 CTGTCAAAAGGGCTGGGTGAAGG + Intergenic
1025671685 7:63619569-63619591 CTGTCAAAAGGGCTGGGTGAAGG - Intergenic
1027187680 7:75981670-75981692 CTGGAACAAGGGCTGGCAGTGGG + Intronic
1028952991 7:96657798-96657820 CTGGGCAAAGGGCTGGCCACTGG - Intronic
1031717311 7:125125194-125125216 CTGGAAAAAGGGCTGAAGCCAGG - Intergenic
1033494095 7:141876713-141876735 CTGGCAAAAGGGCAGGGTGCTGG + Intergenic
1036210171 8:6834943-6834965 CTCGCAGAAGGGGTGGCGGGGGG - Intronic
1037617047 8:20528955-20528977 TTTGCAAAAGTGCTGGCTGCTGG + Intergenic
1037677797 8:21066861-21066883 CTGGCTAAGGGCCTGGGGGCAGG - Intergenic
1048335604 8:133499874-133499896 CTCGCAACAGGGCTGGGGGCAGG + Intronic
1048603579 8:135944764-135944786 CTGGCAAGAGGGCTGTCATCAGG + Intergenic
1049433679 8:142576647-142576669 CTGGCAGGAGGGCTGGGGGCAGG - Intergenic
1049752091 8:144289758-144289780 CTAGAAAAGGGGCTGGGGGCTGG + Intronic
1052343431 9:27384906-27384928 CTGGCAGAGGGACTGGAGGCTGG - Intronic
1056094901 9:83242944-83242966 CTGGGAACTGGGGTGGCGGCAGG - Intergenic
1056413481 9:86354581-86354603 CTGGCAAAGGCGCGGGAGGCGGG - Intergenic
1056634526 9:88320599-88320621 TTGGCAGATGGGCTGGGGGCGGG - Intergenic
1060048024 9:120356172-120356194 CTGGCAGGTGGGCTGGGGGCTGG - Intergenic
1061188612 9:129069377-129069399 GTGGCCACAGGGCTGGCAGCTGG + Intronic
1061371013 9:130197604-130197626 CTGGCGGGAGGGCTGGGGGCAGG + Intronic
1062114929 9:134803250-134803272 CTGGGAGCAGGGCTGGCAGCTGG - Intronic
1062262697 9:135670830-135670852 CAGGCGAGAGGGCTGGAGGCGGG - Intergenic
1187310363 X:18135721-18135743 GTGGCAAAAGTGCTGGCAGGTGG - Intergenic
1189469740 X:41304415-41304437 GTGGTCAAAGGGCTGGCGGTGGG + Intergenic
1191168552 X:57418205-57418227 CTGGAAAAAGGGCTGAAGCCAGG - Intronic
1191258053 X:58288366-58288388 CTGGCACAGGGGCTGCCGGCAGG - Intergenic
1193068573 X:77282992-77283014 CTGGAAAAAGGGCTGAAGCCAGG + Intergenic
1193936341 X:87626814-87626836 CTGGCAAAAGGTCTGGCTGCTGG + Intronic
1196003312 X:110809196-110809218 CTGGGAAAAGTTCTGGAGGCAGG - Intergenic
1196476465 X:116092167-116092189 CTGGAAAAAGGGCTGAAGCCAGG - Intergenic
1199664042 X:150082611-150082633 CTGGCAGAAGGACTTGCAGCAGG - Intergenic
1200150355 X:153948324-153948346 CAGGCAAAAGGGCAGAGGGCAGG + Exonic