ID: 1084737402

View in Genome Browser
Species Human (GRCh38)
Location 11:71114353-71114375
Sequence CTGGGTAAAATGATGGTGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 101}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084737394_1084737402 -7 Left 1084737394 11:71114337-71114359 CCAGCAAAAACCGCCCCTGGGTA 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1084737402 11:71114353-71114375 CTGGGTAAAATGATGGTGCGGGG 0: 1
1: 0
2: 0
3: 11
4: 101
1084737389_1084737402 27 Left 1084737389 11:71114303-71114325 CCGTCACCCTGCACGGTTACACA 0: 1
1: 0
2: 1
3: 11
4: 74
Right 1084737402 11:71114353-71114375 CTGGGTAAAATGATGGTGCGGGG 0: 1
1: 0
2: 0
3: 11
4: 101
1084737390_1084737402 21 Left 1084737390 11:71114309-71114331 CCCTGCACGGTTACACATGTGCT 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1084737402 11:71114353-71114375 CTGGGTAAAATGATGGTGCGGGG 0: 1
1: 0
2: 0
3: 11
4: 101
1084737391_1084737402 20 Left 1084737391 11:71114310-71114332 CCTGCACGGTTACACATGTGCTC 0: 1
1: 0
2: 0
3: 6
4: 48
Right 1084737402 11:71114353-71114375 CTGGGTAAAATGATGGTGCGGGG 0: 1
1: 0
2: 0
3: 11
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084737402 Original CRISPR CTGGGTAAAATGATGGTGCG GGG Intronic
901648313 1:10728334-10728356 GTCCATAAAATGATGGTGCGTGG - Intronic
911969616 1:104415281-104415303 TTGGGGCAAATGATGGTGGGTGG + Intergenic
916527960 1:165629805-165629827 CGGTGTAAAATGAGGGTGCAAGG + Intergenic
918038709 1:180899153-180899175 CTGGGTTAAATCAAGGTGTGTGG - Intergenic
920620383 1:207540604-207540626 CTGGGTTTAGTGATGGTGTGAGG + Intronic
920622165 1:207559161-207559183 CTGGGTTTAGTGATGGTGTGAGG + Intronic
920623775 1:207576212-207576234 CTGGGTTTAGTGATGGTGTGAGG + Intronic
920636412 1:207708794-207708816 CTGGGTTTAGTGATGGTGTGAGG + Intronic
1063746974 10:8895080-8895102 CTGGGGAAAATGGTGGGGCGTGG - Intergenic
1065204064 10:23341733-23341755 CTGGGTAGAAAGATGGTGCCTGG - Intronic
1065719413 10:28611648-28611670 CTGGGTAATATGGGGGTGGGGGG + Intronic
1068566756 10:58584364-58584386 TTGGGTGAAATGATGGTTGGTGG + Intronic
1075473764 10:122715406-122715428 AGGGGTAAGATGATGGTGCATGG - Intergenic
1077480965 11:2814395-2814417 CTGAATAAAAGGATGGTGGGTGG + Intronic
1081073969 11:38645692-38645714 TTGGGTAAAATGATGGTGTTAGG - Intergenic
1082179038 11:49096633-49096655 ATGGGTAAAATAATAGTGCTTGG - Intergenic
1082814717 11:57500341-57500363 CTGGGTAACATGATCTTGAGGGG - Intronic
1084737402 11:71114353-71114375 CTGGGTAAAATGATGGTGCGGGG + Intronic
1085704475 11:78774023-78774045 GTAAGTAAAATGATGGTGCTAGG - Intronic
1088574758 11:111259815-111259837 CTGGGTAATATGATGGGGACAGG - Intronic
1092786587 12:12032365-12032387 CAGAGTAAAATGCTGGTGGGAGG - Intergenic
1095755979 12:45767693-45767715 CTGGGGAGAACGATGGTGTGTGG + Intronic
1096427083 12:51513069-51513091 TTAGATAAAATGATGGTGGGTGG + Exonic
1096712083 12:53464989-53465011 CTGGGTGAAATGAGGTTGGGGGG - Intronic
1098597743 12:72294031-72294053 CTGGGGAATATGGTGGTGCTTGG + Intronic
1101225639 12:102685645-102685667 CTGGGTAAACTGATTGTTCATGG + Intergenic
1103360973 12:120353371-120353393 CTGGGTAACCTGATGGGGCAAGG + Exonic
1104559008 12:129826795-129826817 CTGGGTGAAATGCAGGTGTGGGG + Intronic
1108577445 13:51802490-51802512 TTGGGTAAATTGAGGGTGTGGGG - Intronic
1111984126 13:95048591-95048613 CTGGGAAAAATGGAGGTGCAAGG + Intronic
1113469330 13:110533377-110533399 CTTGGTTAAATAATGGTGCGTGG + Intronic
1114785106 14:25587614-25587636 CTGGATATAGTGATGGTGAGTGG + Intergenic
1118098489 14:62567478-62567500 CTATGTGAAATGATGGTGCTGGG + Intergenic
1118515246 14:66521235-66521257 CTGGGTTAAATGGTGGTCAGAGG + Intronic
1119517151 14:75257331-75257353 CTGGGTAAAATCCTGGGGAGTGG + Intronic
1121832237 14:97062513-97062535 TTGGGTAAAAGCATGGTGTGGGG + Intergenic
1124128874 15:26967677-26967699 CTGGGTTACATGATGTTTCGTGG - Intergenic
1128675989 15:69608852-69608874 CTGGGTAAAATCATCGTCCATGG - Intergenic
1140020957 16:71238132-71238154 CAAGGTACAATGCTGGTGCGAGG - Intergenic
1141174323 16:81709341-81709363 CTGGCTCAAAGGATGGTGCTAGG - Intronic
1141248042 16:82329182-82329204 GTTGGGAAAATGATGGTGGGAGG - Intergenic
1141581557 16:85003027-85003049 CTGGGTAAGTTTATGGTGCTGGG - Intronic
1142285774 16:89170997-89171019 CTGGGCAAAATGAGGTCGCGAGG + Intergenic
1144160298 17:12551396-12551418 CTGGGTATAATGATGCTGAGTGG + Intergenic
1153558694 18:6347139-6347161 GAGGGTGAAATGATGGTGCCGGG + Intronic
1161283966 19:3459444-3459466 CTGGGTAAACCGAGGGTGGGGGG + Intronic
1164441476 19:28283340-28283362 GTGGGAAAGATGATGGTGGGGGG - Intergenic
1167835425 19:52064558-52064580 AAGGTTAAAATGATGGTGGGAGG + Exonic
925984103 2:9201283-9201305 CTGGGTCAAAATATGGTGTGGGG + Intergenic
928663095 2:33523533-33523555 CTTGGTAAAATGCTGGTTCCTGG - Intronic
930946550 2:57083663-57083685 CTGGGGAACATGATGGTACCTGG + Intergenic
932010751 2:67975227-67975249 CTAGGTAAAATGAAAGTGGGAGG - Intergenic
932252885 2:70259470-70259492 CTGGCTACCATGATGGTGCAGGG + Exonic
935101730 2:100002103-100002125 CTGGGAGAAATGAGGGTGTGTGG - Intronic
935140916 2:100352118-100352140 CTGGATAAAATTCTGGTGCATGG + Intergenic
938785282 2:134623071-134623093 CTTAGGAAAATGATGGTGCTTGG - Intronic
940248567 2:151647521-151647543 TTGGTTAAAGTGATGGTGCCAGG - Intronic
944640772 2:201723322-201723344 CTTAATAAAATGATGGTGAGTGG - Exonic
944881403 2:204016711-204016733 CTGGGTAAAATGATGGCCATGGG - Intergenic
1172130738 20:32653073-32653095 CTGGGCCAAATGATGGTCTGGGG + Intergenic
1174087468 20:48019351-48019373 GTGGGTAAAATGGTGATGTGTGG + Intergenic
1174314872 20:49691167-49691189 CTGATTAAAATGACGGTGCGGGG + Intronic
1175138652 20:56843425-56843447 CTGGGAAACATGGTGGTGCCTGG - Intergenic
1175470576 20:59224143-59224165 CTTGGAAATGTGATGGTGCGTGG + Intronic
1180745933 22:18088994-18089016 CTGGGTAAAGTGATCTTGCCTGG + Exonic
1182662257 22:31933389-31933411 CTGGGCAGAGTGATGGTGGGAGG - Intergenic
1184865731 22:47200988-47201010 CTGGGGAACATGGTGGTGCCTGG + Intergenic
949492262 3:4600620-4600642 CTACGTAAAATGATAGTCCGTGG + Intronic
951050132 3:18084753-18084775 CAGGGTAAAATGTTGGAGGGAGG + Intronic
953788606 3:45929521-45929543 CTGGGGAACGTGATGGTGAGTGG + Intronic
958089602 3:88859201-88859223 ATGTGAAAAATGATGGTGGGTGG - Intergenic
960449318 3:117786997-117787019 ATGGGTAAAGTGATGTTGCATGG - Intergenic
962374034 3:134845753-134845775 GTGGGTAAAATGATAGTGGCAGG - Intronic
970324434 4:14908757-14908779 CTGGGTAAAATGATGCAACCAGG - Intergenic
978109209 4:104942483-104942505 CTGGGTTAAATGGTGGTGGTGGG - Intergenic
978885133 4:113760368-113760390 CTAGGAAGAATGATGGTGAGCGG + Intronic
986901730 5:12443166-12443188 CTGGCTCACATGATTGTGCGAGG + Intergenic
988843092 5:35102359-35102381 ATGGGCAAAAGGATGGAGCGAGG - Intronic
989031758 5:37126578-37126600 CTGGGGAAAATGCTTGTGAGAGG - Intronic
989564784 5:42891412-42891434 CTGGGTCAAATGCTGCTGAGAGG + Intergenic
990432171 5:55746771-55746793 AGGGGAAAAATGATGGTGGGAGG - Intronic
990859307 5:60308870-60308892 CTGGGGGAAATGGTGGTGGGCGG - Intronic
994753129 5:103763695-103763717 CTGGGAAACATGCTGGTGCCAGG + Intergenic
996720924 5:126629457-126629479 CTGGGTAAAATGACTGGGTGTGG - Intergenic
1003286893 6:4742258-4742280 CTTGGGAAACTGATGGTGGGAGG + Intronic
1004735510 6:18402263-18402285 CTGTGTAAAATGAAGGTGCTAGG + Intronic
1007843921 6:44738634-44738656 CAGGGTAAAAAGATGGGGCCTGG + Intergenic
1008742636 6:54627968-54627990 GTGGGAAAAATGATGGTGGGTGG + Intergenic
1015117769 6:129668335-129668357 TTGGGTAAATTGATGGTTTGGGG - Intronic
1015268482 6:131314231-131314253 CTGGGTCAAATGATAGTTCTAGG + Intergenic
1018199417 6:161381332-161381354 CTGGGTAAAATAATGGTCTGGGG + Intronic
1019710278 7:2515291-2515313 CTGGTTGAACTGATGGTGGGGGG - Intronic
1022205384 7:28158726-28158748 TTGGGTAAACTGATGGTGAGAGG - Intronic
1022274223 7:28839711-28839733 CTGGGTAAAAAGAAGGTCTGAGG - Intergenic
1022779098 7:33560029-33560051 CTGGGTAAACTGATAGAGAGGGG - Intronic
1023753328 7:43392547-43392569 TTGGGTAAAATGATGTTCCCAGG + Intronic
1028114152 7:86978649-86978671 GTTGGAAAAATGATGGTGCTGGG - Intronic
1029669212 7:102017384-102017406 CTGGGCCAAAGGATGGTGCTAGG - Intronic
1037321303 8:17645930-17645952 CTGGGTGAAATGCTGGGGCTAGG + Exonic
1038533692 8:28338822-28338844 CTTTGTAAAATGATGGAGCTGGG + Intronic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1045405846 8:101866177-101866199 CTGTGTCAAATGATGCTGGGAGG - Intronic
1053004879 9:34597831-34597853 CTGGGCATTATGATGGTGCTAGG + Intergenic
1053445142 9:38146904-38146926 CTGGGGAACATGGTGGTGCCTGG - Intergenic
1054904680 9:70404249-70404271 CTGTGTAAAATGCTGGTACCAGG - Intronic
1057181996 9:93035350-93035372 CTGGGGAGAGGGATGGTGCGGGG - Exonic
1058717620 9:107737041-107737063 CTGGCTGACATGGTGGTGCGTGG + Intergenic
1059556403 9:115284996-115285018 CTGTCTAAAATGATGCTGAGTGG + Intronic
1060163456 9:121388322-121388344 CTGGGTAAAATAAGGCTGAGAGG - Intergenic
1061415633 9:130445495-130445517 CAGGGTAAACTGAGGCTGCGGGG - Intronic
1062302352 9:135881947-135881969 CTTGGAACAGTGATGGTGCGGGG - Intronic
1185883816 X:3764101-3764123 AGGGGTAAATTGATGGTGGGTGG - Intergenic
1196716105 X:118812441-118812463 CATGGTAAAATCATGGTGCTGGG - Intergenic