ID: 1084738712

View in Genome Browser
Species Human (GRCh38)
Location 11:71123501-71123523
Sequence CATCATAAGGAGAGGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 397}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084738704_1084738712 -9 Left 1084738704 11:71123487-71123509 CCAGGTTGAGGGCCCATCATAAG 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1084738712 11:71123501-71123523 CATCATAAGGAGAGGGAGGGAGG 0: 1
1: 0
2: 1
3: 39
4: 397

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084738712 Original CRISPR CATCATAAGGAGAGGGAGGG AGG Intronic
900378929 1:2374067-2374089 CACCATGGGGAGAGGGAGGGTGG + Intronic
901650111 1:10738354-10738376 CACCAAAAGGAGGGGGTGGGTGG - Intronic
902380558 1:16050449-16050471 CATCCCAAGGAGAGGGAAGCAGG - Intronic
902567433 1:17321353-17321375 CTTCATAAAGAGAGTGAGGGTGG - Intronic
903517942 1:23925031-23925053 CATCAGAAGTAAGGGGAGGGGGG - Intergenic
904657965 1:32063409-32063431 CATCCCAAGGAGAGGGGGTGGGG - Intergenic
907332505 1:53680232-53680254 CTTCATAAGGAAAGGCAAGGAGG + Intronic
907575407 1:55521697-55521719 CATCAGAACTAGGGGGAGGGAGG - Intergenic
908121530 1:60990639-60990661 CACCCTAAAGTGAGGGAGGGAGG + Intronic
908975418 1:69891296-69891318 GATCCCAAGGAGAGGGAGAGAGG + Intronic
911040973 1:93590552-93590574 CATGATAAGGAGACGGACGGTGG + Intronic
911129357 1:94373425-94373447 CATCAGAAGGGGAAGGAGAGGGG - Intergenic
911635910 1:100236207-100236229 CTTCCTCAGGAGATGGAGGGAGG - Intronic
911845330 1:102745646-102745668 CATCAAAAGGAGAAGGAGAGGGG - Intergenic
912021719 1:105114405-105114427 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
912712650 1:111960851-111960873 CTTCATCAGGAGACCGAGGGAGG + Intronic
912991771 1:114494398-114494420 GAGGATAAGGAGTGGGAGGGAGG + Intronic
914232129 1:145772820-145772842 CATGGTAAGGAGAGGGAGAAAGG - Intronic
917632558 1:176904457-176904479 CAGCATGGGGAGAGGGAGTGCGG + Intronic
919602229 1:199636470-199636492 CCTCATAAAGAGAGTTAGGGAGG - Intergenic
921177699 1:212608473-212608495 CCTGATATGGAGAGAGAGGGCGG + Intronic
921827416 1:219688682-219688704 CATGGTGAGGAGAGGGAGGGTGG - Intronic
922191221 1:223320312-223320334 CATCATCAGGGGAGGGAAGGTGG + Intronic
922867873 1:228875940-228875962 AATAATAAGGAGGAGGAGGGAGG - Intergenic
922932584 1:229402061-229402083 CATCCTTATGAGAGGGAGGCAGG - Intergenic
923811777 1:237325978-237326000 CATAATAATGAGAAGGATGGTGG + Intronic
924359587 1:243223549-243223571 CACCATAAGCAGTTGGAGGGCGG - Intronic
1065120069 10:22520707-22520729 CATGAGAGAGAGAGGGAGGGAGG - Intergenic
1065607427 10:27432640-27432662 ACTCACATGGAGAGGGAGGGAGG - Intergenic
1068028406 10:51677839-51677861 CATCAGAAGGAGAGGGAATTGGG + Intronic
1068029389 10:51688357-51688379 CATCACAAGGAAGGGGAAGGAGG + Intronic
1069711956 10:70495336-70495358 CAAGAGAAGGAGAGGGAGGGAGG - Intronic
1069966936 10:72127069-72127091 CAACATAAGGGAATGGAGGGTGG + Intronic
1070357073 10:75650702-75650724 CTTTAAAAGGAAAGGGAGGGAGG + Intronic
1070723654 10:78773561-78773583 AATCAGGAGGAGAGTGAGGGAGG - Intergenic
1072801283 10:98393956-98393978 AAACATAAGATGAGGGAGGGAGG - Intronic
1072866707 10:99069900-99069922 CATAACAAGGAGAGGGAAAGTGG + Intronic
1074613224 10:115040645-115040667 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
1075835110 10:125446141-125446163 CGTCATAATGAGAGGCACGGGGG + Intergenic
1076059950 10:127406076-127406098 CATCTTTAGGAAAGGGAGGCAGG + Intronic
1077061843 11:620992-621014 CAGGATCAGGAGAGGAAGGGCGG - Intronic
1078966412 11:16349651-16349673 CAGAAGAAAGAGAGGGAGGGAGG + Intronic
1079104922 11:17564437-17564459 CTGGGTAAGGAGAGGGAGGGAGG + Intronic
1079290218 11:19181359-19181381 CATCCTAAAAAGAGGGATGGAGG + Intergenic
1079324120 11:19476940-19476962 CATGAAGAGGAGAGGGAGAGTGG - Intronic
1080550969 11:33374001-33374023 CATCTGAAGGAGAGGGAGAGGGG - Intergenic
1080688400 11:34534836-34534858 CATCATCAGATGAGGGAAGGAGG + Intergenic
1081033616 11:38115075-38115097 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
1081635471 11:44718657-44718679 TAACAGAAGGAGAGGGAAGGAGG + Intergenic
1081706641 11:45185903-45185925 CATCTTAATAAGAGGGAGGTGGG + Intronic
1082151648 11:48747204-48747226 CATCATAAAAAGAGTTAGGGAGG + Intergenic
1082986561 11:59174384-59174406 CATCAGAAGGTGAGGGTGGAGGG + Intronic
1083324190 11:61865269-61865291 CATCATCAGGTGAGGGGTGGAGG + Exonic
1083792109 11:64992558-64992580 CCTTATAAGAAGAGGGAAGGAGG + Intronic
1084712725 11:70853900-70853922 CTTTATAAGAAGAAGGAGGGGGG - Intronic
1084738712 11:71123501-71123523 CATCATAAGGAGAGGGAGGGAGG + Intronic
1085059976 11:73436753-73436775 CATTTTGAGGAGAGGCAGGGAGG - Intronic
1085525075 11:77159405-77159427 CAGCATCAGGGGAGGGAGGGTGG - Intronic
1085711637 11:78834482-78834504 CATCGTAAGGTGATGGAGTGGGG + Intronic
1085793464 11:79516241-79516263 AATAATAAGGAAAGGGATGGAGG - Intergenic
1086399382 11:86448135-86448157 CATCATAGGTAGGAGGAGGGAGG - Exonic
1086571632 11:88291504-88291526 CAAGAAAAGAAGAGGGAGGGAGG + Intergenic
1087157790 11:94921848-94921870 CATTATAAGGAGAAGGCAGGAGG - Intergenic
1087280076 11:96200020-96200042 TGTGATAAGGAGGGGGAGGGTGG + Intronic
1088371143 11:109089811-109089833 CATCATAGGCAGCTGGAGGGAGG - Intergenic
1088747388 11:112815600-112815622 CCTCATAAGAAGAGGAAGAGAGG - Intergenic
1088828719 11:113517128-113517150 CAACAAGAAGAGAGGGAGGGAGG + Intergenic
1090078572 11:123595027-123595049 CACCCAAAGGGGAGGGAGGGAGG - Intronic
1090667662 11:128925486-128925508 CATGAAAGGGAGAGGGTGGGAGG - Intergenic
1091288233 11:134421073-134421095 CACCAGAGGGAGAGGCAGGGAGG - Intergenic
1092895677 12:13007978-13008000 CATCATAGGAGGAGAGAGGGAGG + Intergenic
1093917660 12:24823686-24823708 CAGGAGGAGGAGAGGGAGGGTGG - Intronic
1095797665 12:46237967-46237989 CATTATAACCAGAGGGAGGAGGG + Intronic
1096743709 12:53712375-53712397 CAGCAGACGGAGATGGAGGGAGG - Intronic
1096758015 12:53816262-53816284 CATGAAAAGGAGAGGGAGGTAGG - Intergenic
1096759832 12:53831950-53831972 GATCCTAAGCAAAGGGAGGGCGG + Intergenic
1097802584 12:63931020-63931042 AAACAAAAGGAGGGGGAGGGTGG - Intronic
1099595020 12:84650743-84650765 CAACATAAGCAGAGGGAGCAGGG - Intergenic
1100914364 12:99402224-99402246 CATCATTAGGAGAGTAAGAGAGG - Intronic
1101436674 12:104670143-104670165 CCTCACAGGGAGAGGGAGGAAGG + Intronic
1102026283 12:109715632-109715654 CCCCATAAGGTGGGGGAGGGAGG + Intronic
1103648919 12:122417892-122417914 CATCCTAGGGAGAAGGAAGGAGG - Intronic
1104803288 12:131569351-131569373 TGTCCTGAGGAGAGGGAGGGAGG - Intergenic
1105425445 13:20291024-20291046 CATAAAGAGGAGAGGCAGGGAGG - Intergenic
1106400450 13:29424829-29424851 CAGCAAAAGGAGAGGAGGGGTGG + Intronic
1110522696 13:76499298-76499320 TGTCCAAAGGAGAGGGAGGGAGG + Intergenic
1111104556 13:83628849-83628871 CAGGAGAAGGAGAGTGAGGGGGG - Intergenic
1111931416 13:94516718-94516740 CATCACATGGTGAGGGGGGGTGG - Intergenic
1112329344 13:98464981-98465003 AATCACAAGGGAAGGGAGGGAGG - Intronic
1113637399 13:111929180-111929202 CATCATCAGGGGAGGCAAGGAGG + Intergenic
1115544437 14:34453006-34453028 AATCATAAGGAGGAGGAGGAGGG - Intronic
1116654390 14:47632791-47632813 AATCAGAAGGAGAGAGAGGTTGG - Intronic
1117680296 14:58197025-58197047 CCTCAGAAGAAGAGGGAGGCCGG + Intronic
1117846863 14:59920480-59920502 CAAGAGAAGGAAAGGGAGGGTGG + Intronic
1118768174 14:68923935-68923957 CATAAAAAGGAAAGGGATGGCGG + Intronic
1119957055 14:78809710-78809732 CAACCTAAGGAGAGGGTGGAGGG + Intronic
1120583973 14:86287671-86287693 AGTCATTAGGAGAGGGAGGGTGG + Intergenic
1121066212 14:90968299-90968321 CACAATAGGAAGAGGGAGGGAGG - Intronic
1121782193 14:96629103-96629125 CATCCTAAGGAGAGTGTGAGGGG + Intergenic
1124050164 15:26189770-26189792 CATTAAAGGGATAGGGAGGGAGG + Intergenic
1125181392 15:36883909-36883931 CTGCAAAAGGAAAGGGAGGGGGG + Intergenic
1125691475 15:41599527-41599549 CAGCAGAAGGAGAGTGAGGGTGG + Intergenic
1125789306 15:42351287-42351309 TATTAAAAGGAGAGGGATGGGGG - Intronic
1125931854 15:43605775-43605797 CTTCACAAGCAGAGGAAGGGTGG - Intronic
1125944953 15:43705253-43705275 CTTCACAAGCAGAGGAAGGGTGG - Intergenic
1126823885 15:52529941-52529963 CACCGTGAGGAGAGTGAGGGCGG - Intergenic
1128116556 15:65110942-65110964 CATCATGTGGAGAGGTAGGGTGG + Intronic
1128658955 15:69483888-69483910 AATCAAAAGCAGATGGAGGGCGG - Intergenic
1129209731 15:74060725-74060747 CAGCAGAGAGAGAGGGAGGGAGG + Intergenic
1129301825 15:74629897-74629919 CCGCATGAGGAGATGGAGGGCGG + Exonic
1129448331 15:75634454-75634476 CATAGAAAGGAGATGGAGGGAGG + Intergenic
1129882571 15:79016922-79016944 CAGCAGAAGGGGAGGGAGGTTGG - Intronic
1130397182 15:83512785-83512807 GCTGATAGGGAGAGGGAGGGAGG - Intronic
1131334459 15:91534407-91534429 CATAAAAAGGAGAGGGAGAATGG + Intergenic
1131703649 15:94969168-94969190 CAGGATAAGGAGAGGGAGCTGGG + Intergenic
1133485551 16:6215195-6215217 GAGGATAAGGAGAGGGAGAGGGG + Intronic
1133878761 16:9761113-9761135 AATCATAGGGAGACAGAGGGAGG - Exonic
1135339216 16:21632075-21632097 CATCAAAAGGGGAAGGAGAGGGG - Intronic
1136398442 16:30005309-30005331 CATCTTAGGGGGTGGGAGGGGGG - Exonic
1136927220 16:34385871-34385893 CATCATAAGATGAGGGATTGAGG - Intergenic
1136977354 16:35025936-35025958 CATCATAAGATGAGGGATTGAGG + Intergenic
1137083546 16:36095781-36095803 CAAAATAAAGAGATGGAGGGAGG - Intergenic
1137844580 16:51674641-51674663 AATCAGAAGGAGAGTGAGTGAGG + Intergenic
1138918535 16:61498247-61498269 ACTCATAAGAAAAGGGAGGGAGG + Intergenic
1140398966 16:74654498-74654520 AATCCCAAGGAGAGGGAGGGAGG - Intronic
1141809332 16:86364377-86364399 CATGATAAGGAGGGGCAGGGAGG + Intergenic
1141888953 16:86913684-86913706 CTTCATATGAAGAGGGAGGGTGG - Intergenic
1142024448 16:87804943-87804965 CAGCATGTGGAGAGAGAGGGCGG + Intergenic
1142496047 17:306856-306878 CATGAGAAGGAGAGGAAGAGAGG - Intronic
1142677260 17:1521460-1521482 CATCATTACTAGAGGGAAGGAGG + Intronic
1142942243 17:3390240-3390262 AATAAGAAAGAGAGGGAGGGAGG + Intergenic
1143377253 17:6474096-6474118 CAGGAGAAGGAGAGGGTGGGAGG + Intronic
1145284539 17:21495557-21495579 CATCCTAAGCAGAGGCAAGGAGG + Intergenic
1145975005 17:28978813-28978835 CATCATCAGGGGAGGGATGGTGG + Intronic
1146234957 17:31150620-31150642 CAAAATGAGGAGAGGGAGGGTGG - Intronic
1146578044 17:34012046-34012068 CAAAATAAGGGGAGGGAGGAAGG - Intronic
1147452708 17:40515837-40515859 CATCAGAGGGTGGGGGAGGGTGG - Intergenic
1147913373 17:43871383-43871405 GATGATAAGAGGAGGGAGGGAGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148690235 17:49522922-49522944 TATTATAGGGATAGGGAGGGAGG + Intergenic
1149287072 17:55176823-55176845 CATCTCAAGAAGAGGGAGAGAGG - Intergenic
1149495365 17:57114091-57114113 CATCAACAGAAGTGGGAGGGAGG + Intronic
1150365154 17:64576204-64576226 CAAAAAAAAGAGAGGGAGGGAGG + Intronic
1151084438 17:71364457-71364479 CACAGTAAGGAGAGGGAGGAGGG - Intergenic
1151522993 17:74644072-74644094 CACCATAAGAAGAGATAGGGAGG - Intergenic
1151678000 17:75609707-75609729 CATCAGGAAGGGAGGGAGGGAGG - Intergenic
1151885897 17:76923308-76923330 CATCATAAGCAGAGTCAGGCTGG - Intronic
1151933533 17:77247784-77247806 CCTCACATGGAGGGGGAGGGAGG - Intergenic
1152172813 17:78764716-78764738 TATCAAAAGCAGAGGGAGTGGGG + Intronic
1152507587 17:80760776-80760798 CATAGTAAAGGGAGGGAGGGAGG - Intronic
1153250747 18:3119159-3119181 CATCATAGGGAGTGGTTGGGTGG - Intronic
1153382003 18:4450813-4450835 AATCCTAGGGAGAGGGAGGAAGG + Intronic
1153424483 18:4946714-4946736 CAGCATATGGATAGGGATGGAGG + Intergenic
1153438237 18:5089036-5089058 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
1153780402 18:8490531-8490553 CATCACATGGTGAGAGAGGGAGG + Intergenic
1153815401 18:8786120-8786142 CAGAAAAAGGAGGGGGAGGGCGG - Intronic
1154494193 18:14944012-14944034 CAAGACAAGGAGAGGGAGGGAGG + Intergenic
1155715254 18:28934343-28934365 CAACAAAAGAAGAGGCAGGGGGG - Intergenic
1156269050 18:35514332-35514354 CATCAAAGGGAGATGGAGGATGG - Intergenic
1157411059 18:47463948-47463970 CAGAATCAGGAGAGGGAGAGTGG - Intergenic
1157543162 18:48526747-48526769 CAGCAGAAGGAGAGGGAGAAGGG - Intergenic
1158322483 18:56278885-56278907 CATCTCCAGGAGAGGTAGGGAGG - Intergenic
1158727125 18:59983778-59983800 CAACACAGTGAGAGGGAGGGAGG - Intergenic
1159133043 18:64302958-64302980 CATCCTAAGAAGAAGGATGGGGG + Intergenic
1159495228 18:69194203-69194225 GATGGTAAGGAGAGGGAGTGGGG - Intergenic
1159954187 18:74507800-74507822 CCTGACAAGGAGAGGGAGGCCGG - Intronic
1160707706 19:537139-537161 CATCATCCGGTGAGGGCGGGCGG + Exonic
1161116406 19:2499302-2499324 CATCTGGAGCAGAGGGAGGGAGG - Intergenic
1161658258 19:5529454-5529476 CATCAGAAGGATGGGGTGGGAGG + Intergenic
1162182966 19:8883201-8883223 CACCTGAAGGAGAGGGAGGTAGG + Intronic
1162269656 19:9603859-9603881 AAAGAAAAGGAGAGGGAGGGAGG + Intergenic
1162786870 19:13040530-13040552 GCTCCTGAGGAGAGGGAGGGAGG - Intronic
1162923066 19:13914903-13914925 TATCACAAAGAGAGGGAGGGAGG - Intronic
1164540031 19:29115326-29115348 CTTCATAAGAGGAGGGAGTGGGG + Intergenic
1165717382 19:38055242-38055264 CATGAGAAGAAAAGGGAGGGAGG + Intronic
1166325870 19:42050866-42050888 CAAGCTCAGGAGAGGGAGGGAGG + Intronic
1166496227 19:43305103-43305125 CAACATAATGAAAGAGAGGGAGG - Intergenic
1166966024 19:46529649-46529671 AATAAGAAGGGGAGGGAGGGTGG + Intronic
1167782631 19:51609479-51609501 CATAAGAAGGTCAGGGAGGGTGG - Intergenic
925910106 2:8568237-8568259 CAGCAAAAAGGGAGGGAGGGAGG + Intergenic
925923181 2:8651722-8651744 CAAAAAGAGGAGAGGGAGGGAGG + Intergenic
926172934 2:10564635-10564657 GATCATAGGGAGAGGGCTGGCGG - Intergenic
926179403 2:10627731-10627753 CATCTTTTGGAGAGAGAGGGAGG + Intronic
926394965 2:12431450-12431472 CAGCATAATGAGAGAGATGGTGG + Intergenic
928542368 2:32295039-32295061 CATCAGAGGGAGAGGGGGAGGGG + Intronic
929103165 2:38337087-38337109 CAAGAAAAAGAGAGGGAGGGAGG + Intronic
929565059 2:42978860-42978882 CCTCAGAAGGACAGGGAGGAGGG + Intergenic
931654907 2:64502131-64502153 CCTAATAAGGAGTGGGATGGTGG + Intergenic
931774270 2:65526723-65526745 GATGATTGGGAGAGGGAGGGTGG + Intergenic
932312589 2:70755701-70755723 TTTTATGAGGAGAGGGAGGGAGG - Intronic
933740853 2:85532800-85532822 AAAGATAAAGAGAGGGAGGGAGG - Intergenic
934976428 2:98805975-98805997 CATTAAAAGGCGAGGGAGTGAGG + Intronic
935063267 2:99626468-99626490 GAAGAGAAGGAGAGGGAGGGAGG - Intronic
935965037 2:108464659-108464681 AAACATAAGGAAAGGGAAGGAGG - Intronic
936821011 2:116521046-116521068 CAGCAAAAGGAGATGGAGTGCGG - Intergenic
937973441 2:127566819-127566841 CATCATCAGGTGAGGCAGAGGGG + Exonic
938775425 2:134537443-134537465 CATGATGAGAAGAGGGAGAGAGG - Intronic
938805760 2:134806035-134806057 CATCAAAAGGGGAAGGAGAGGGG - Intergenic
939851132 2:147306289-147306311 CATCATGAGGAGGCAGAGGGAGG + Intergenic
940866308 2:158820813-158820835 CTTTATAAGGAGAAGAAGGGAGG + Intronic
941243701 2:163071193-163071215 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
942069198 2:172300112-172300134 GTTCAGATGGAGAGGGAGGGAGG + Intergenic
942074309 2:172342560-172342582 TATAAAAAGGAGGGGGAGGGAGG - Intergenic
942202805 2:173589126-173589148 CATGATGAGGACAGGCAGGGTGG - Intergenic
942398302 2:175575370-175575392 CTTCACATGGAGAGGGAGGGAGG - Intergenic
942490442 2:176484500-176484522 AAGCCTCAGGAGAGGGAGGGAGG - Intergenic
943902192 2:193454732-193454754 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
944187312 2:196963374-196963396 AATATTAAGGAGAGGGAGGTAGG + Intergenic
944496788 2:200315346-200315368 CATCATCAGAAGTGGGAGGCAGG + Intronic
946469903 2:219949335-219949357 CTTCCTTAGGAGAGAGAGGGGGG - Intergenic
946964944 2:225027608-225027630 CAGGAGAAGGAGAGAGAGGGAGG - Intronic
948335665 2:237205073-237205095 CACCAAAAGTGGAGGGAGGGAGG + Intergenic
948593285 2:239064491-239064513 CAACAGAAGGGGAGGGAGGAAGG + Intronic
948857651 2:240737540-240737562 AATAACAAGGAAAGGGAGGGAGG + Intronic
1168806012 20:672764-672786 GAAGATGAGGAGAGGGAGGGAGG - Intronic
1168943921 20:1735883-1735905 CCGCAGCAGGAGAGGGAGGGAGG - Intergenic
1170662727 20:18358691-18358713 CATCCCAAGGAGAGGAAGGAGGG - Intergenic
1171261785 20:23740342-23740364 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
1171270923 20:23816217-23816239 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
1171404847 20:24904090-24904112 CATCATAAAAAGAGTTAGGGAGG - Intergenic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1172051794 20:32123152-32123174 GACCATGAGGAGAGGGAGAGGGG + Intronic
1172123086 20:32609860-32609882 CCTCAGATGGAGAGTGAGGGGGG - Intergenic
1172598339 20:36166058-36166080 AATCATCAGGAGAGGCAGGCTGG + Intronic
1172598741 20:36168891-36168913 CACCATCCTGAGAGGGAGGGAGG + Intronic
1173404339 20:42752037-42752059 GAGTATAAGAAGAGGGAGGGAGG - Intronic
1173614660 20:44394899-44394921 CAGGCTAAGGACAGGGAGGGAGG + Intronic
1175056275 20:56201496-56201518 CATCATGGGGAGAGGGAGGAAGG + Intergenic
1175065435 20:56282425-56282447 CCCCAGAAGGAGAGGGAGGCTGG - Intergenic
1176289869 21:5038099-5038121 CAGCATGGGGAGTGGGAGGGGGG - Intronic
1177108707 21:16996167-16996189 CATAATAAGGAGAGACATGGGGG + Intergenic
1177774754 21:25555532-25555554 CATTATAAAGATAGGGAGAGAGG + Intergenic
1178109575 21:29356943-29356965 CATCAAAAGGGGAAGGAGAGGGG - Intronic
1178490854 21:33050611-33050633 CTCCATAAGGAGAAGGAAGGAGG - Intergenic
1179001441 21:37463555-37463577 AATCATTGAGAGAGGGAGGGAGG - Intronic
1179650955 21:42808341-42808363 CCTCATACGGAGACAGAGGGAGG - Intergenic
1179802146 21:43816186-43816208 CCTCAGCAGGAGAGGGAGGCAGG - Intergenic
1179867382 21:44225540-44225562 CAGCATGGGGAGTGGGAGGGGGG + Intronic
1180649651 22:17368168-17368190 CATAATAAAGTGAGGGAGAGTGG + Intronic
1182736529 22:32535186-32535208 CTTCAGAATGAGAGGAAGGGTGG - Intronic
1183173429 22:36204585-36204607 GAGAATAAGGAGATGGAGGGAGG + Intronic
1183288356 22:36982137-36982159 CCTCATGAGGAGATGCAGGGAGG - Intergenic
1183319098 22:37154261-37154283 CCTCAGATGGAGAGGCAGGGAGG + Intronic
1185264525 22:49893400-49893422 AACCTTAAGCAGAGGGAGGGAGG + Intergenic
949150943 3:766261-766283 CACCAGAAGGAGAGGCAGCGTGG + Intergenic
949838756 3:8297637-8297659 CATGGCAAAGAGAGGGAGGGGGG + Intergenic
949928851 3:9062357-9062379 CAACATAGGGAGAAGGAGAGAGG - Intronic
951239766 3:20274111-20274133 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
951679936 3:25284060-25284082 CAGCAAAATGAGAAGGAGGGAGG - Intronic
952484217 3:33793278-33793300 CAGAATAAGGAGAGGGTGGAGGG - Intergenic
953042423 3:39267191-39267213 CATGAGCAGGAGGGGGAGGGGGG + Intronic
953850169 3:46459924-46459946 CATGAAATGGAGAGGGAAGGAGG - Intronic
953939743 3:47082839-47082861 CATCATAATTAGGGGCAGGGAGG + Intronic
954485838 3:50850698-50850720 CATCCTGAGGAGAAGGAGAGAGG - Intronic
954599221 3:51854603-51854625 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
958414302 3:93855561-93855583 CTTTATAAGGAGAGGAAGAGAGG - Intergenic
959327640 3:104957142-104957164 CATCACATGTGGAGGGAGGGAGG + Intergenic
960673814 3:120176111-120176133 CATCATGACCAGAGGCAGGGAGG - Intronic
960709613 3:120514579-120514601 AAGAAGAAGGAGAGGGAGGGGGG - Intergenic
961971656 3:130974642-130974664 TATCATAAAGATGGGGAGGGGGG + Intronic
962235019 3:133700217-133700239 CATCCTAAGGAGGTGGGGGGTGG + Intergenic
962256414 3:133872918-133872940 CAAAAGAAGGTGAGGGAGGGAGG + Intronic
963021550 3:140876787-140876809 CATCAAAAGGAGAAGGAGAGGGG + Intergenic
963737362 3:149035155-149035177 CATCATAGTGATTGGGAGGGTGG - Intronic
964839744 3:160980769-160980791 AAAGAAAAGGAGAGGGAGGGAGG + Intronic
964972412 3:162578093-162578115 CATCAAAAGGGGAGGGAGAGGGG + Intergenic
965139625 3:164816866-164816888 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
965857747 3:173109215-173109237 AATCAAAAGGACAGGAAGGGTGG - Intronic
966268775 3:178080184-178080206 CATGAAAAGGAGAAGGTGGGAGG - Intergenic
967853688 3:194100757-194100779 AATAAAAAGGAGAGAGAGGGAGG + Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968082329 3:195855095-195855117 TATCAGAAAGATAGGGAGGGAGG + Intergenic
968586041 4:1416495-1416517 CAGGAAAAGGAGAGGAAGGGTGG - Intergenic
968657071 4:1783324-1783346 CATCCTTAGGAGAGGGTGTGTGG + Intergenic
970237885 4:13976907-13976929 CAAGATATGGGGAGGGAGGGAGG - Intergenic
970634309 4:17990493-17990515 AATCATGAGGTGAGGGAGTGGGG + Intronic
970906880 4:21226224-21226246 CAGCATAGGGGGAGGGAGGGGGG + Intronic
972436359 4:39039292-39039314 CTTCATATGCAGGGGGAGGGTGG + Intergenic
973824480 4:54691548-54691570 CAGCCTAAGGAGAGGCAGGTTGG + Intronic
973847911 4:54932032-54932054 CATCAGGAGGAGAGGGAGGAGGG - Intergenic
974356514 4:60819982-60820004 CGTCATCAGGAGAGGGAGAGTGG - Intergenic
976174138 4:82335451-82335473 CATCAAAAGGGGAAGGAGAGGGG - Intergenic
977477377 4:97529491-97529513 CATCATAAAGTGAGTTAGGGAGG + Intronic
978697552 4:111600457-111600479 CATCCCAAAGAAAGGGAGGGAGG - Intergenic
979089400 4:116462191-116462213 CATTATGAGAAGAGGAAGGGAGG - Intergenic
979263196 4:118671712-118671734 CATCACAGTGAGATGGAGGGAGG + Intergenic
979927701 4:126588255-126588277 GAACATATGGACAGGGAGGGGGG + Intergenic
980176867 4:129356460-129356482 CATCAGAAGGAGAAAGAGGAGGG - Intergenic
984822837 4:183898160-183898182 CTGGAGAAGGAGAGGGAGGGCGG - Intronic
985511582 5:316960-316982 CATCAGAAGTCAAGGGAGGGAGG + Intronic
986396455 5:7335588-7335610 CTTTATAAGGAGAGGAAGAGAGG - Intergenic
986630375 5:9766809-9766831 AAGCATACAGAGAGGGAGGGAGG + Intergenic
986671771 5:10148897-10148919 CATCAGGAGGAAAGGGGGGGAGG + Intergenic
986915109 5:12610156-12610178 CCTCATAAGGAGAGTTAGGGAGG + Intergenic
987353025 5:17038072-17038094 CATCCTAAGAAGAGGGAAGTTGG + Intergenic
987370713 5:17190262-17190284 TATCATCAGGAGTGGTAGGGTGG + Intronic
987930996 5:24398960-24398982 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
987945665 5:24605345-24605367 AATCAGCAGTAGAGGGAGGGGGG + Intronic
989496598 5:42116245-42116267 CATCAAAAGGAGAGCGAGAGGGG + Intergenic
989680569 5:44023697-44023719 CATCATATGGGGAGAGAGTGAGG - Intergenic
991297855 5:65100829-65100851 CTTCAAAAGGAGATGGAGGTGGG - Intergenic
991321522 5:65378568-65378590 CATCATAAGACAAGGCAGGGGGG - Intronic
992002849 5:72452245-72452267 CCTCAAAGGGAGAGAGAGGGAGG + Intronic
992402009 5:76420133-76420155 CATCACCAGTAGTGGGAGGGTGG - Intronic
992977839 5:82138876-82138898 CATGAGAGGGAGAGGGAGAGGGG - Intronic
993481167 5:88426154-88426176 TATCATAAGGAAAGTGAGGCTGG - Intergenic
994673043 5:102785252-102785274 CTTAATAAGAAAAGGGAGGGGGG + Intronic
994988607 5:106969472-106969494 AATCCCAGGGAGAGGGAGGGAGG + Intergenic
995583004 5:113620427-113620449 CATCAAAAGGGGAAGGAGAGGGG - Intergenic
996995171 5:129686956-129686978 CATCAGCAGGAGAGGATGGGAGG - Intronic
997042512 5:130275048-130275070 GAACAGAAGGAGGGGGAGGGGGG - Intergenic
997473215 5:134128282-134128304 CTTCATGAGGCGAGTGAGGGAGG - Intronic
998651769 5:144128564-144128586 CATCACTAGGAGAAGGAGTGAGG + Intergenic
998915350 5:147005585-147005607 CATCAAAAGGGGAAGGAGAGGGG + Intronic
999381265 5:151123194-151123216 TGTCAAAAGGAAAGGGAGGGAGG - Intronic
999973871 5:156891752-156891774 CATCATAGGGAGAATGAGGCTGG - Intergenic
1001694913 5:173662919-173662941 GATCCTAGGGCGAGGGAGGGTGG - Intergenic
1002390823 5:178910388-178910410 CATCCTCAGGAGATGGTGGGAGG - Intronic
1002699031 5:181109678-181109700 CATCTTCAAGGGAGGGAGGGAGG + Intergenic
1003529741 6:6927839-6927861 CACCACAAAGGGAGGGAGGGAGG + Intergenic
1005969539 6:30750461-30750483 CCTGATATGGAGAGGGAGGGAGG - Intergenic
1006088727 6:31615465-31615487 CAGGGTAAGGAGAGGAAGGGAGG + Intronic
1006184908 6:32176030-32176052 CAGCAGAAAGGGAGGGAGGGAGG - Intronic
1006309455 6:33247738-33247760 CATCTTAAGTGGAGGGTGGGTGG + Intergenic
1007521959 6:42456914-42456936 CATCAGAAGGAGTGGCATGGAGG + Intergenic
1007803612 6:44419773-44419795 CATCTTAAAGAAAGGGGGGGAGG - Intronic
1008379788 6:50827992-50828014 CATCAGCAGGACTGGGAGGGAGG + Intronic
1008811088 6:55500120-55500142 CATAAAAGGGAGAGGGATGGTGG + Intronic
1009043585 6:58211440-58211462 CCTCATAAAATGAGGGAGGGAGG - Intergenic
1009047610 6:58248847-58248869 CATAATATGCAGAGGGAGAGAGG + Intergenic
1009267876 6:61579034-61579056 CAGCAGAAAGAGAGGGAGGTGGG + Intergenic
1009906541 6:69875921-69875943 CATTATAAAGAGAGGAAAGGAGG + Intronic
1010773561 6:79860098-79860120 GAACACAAGGAGTGGGAGGGAGG - Intergenic
1011222108 6:85065554-85065576 AATCTGAAGGAAAGGGAGGGTGG + Intergenic
1012747566 6:103113509-103113531 CATCAAGAGTAGAGGGAGAGGGG - Intergenic
1012808903 6:103932616-103932638 TGTCATAAGGAATGGGAGGGAGG + Intergenic
1013041718 6:106440789-106440811 CATCAGAAAGAGATGGTGGGTGG - Intergenic
1014160020 6:118157223-118157245 CCTCACAAGGAGTGGCAGGGTGG - Intronic
1016305293 6:142677823-142677845 CATAAAAAGGAGAGGCAGGCAGG - Intergenic
1016772141 6:147863443-147863465 CATCATAATGAGAGGCAGGAAGG - Intergenic
1018483420 6:164214880-164214902 CATCATAAGTTTAGGCAGGGAGG - Intergenic
1019168369 6:170114623-170114645 CATCGCAAGAAGAGGGAGGAAGG - Intergenic
1019686824 7:2386583-2386605 CATCAGGAAGGGAGGGAGGGAGG + Intergenic
1019720377 7:2566921-2566943 CATCAGAAGGAATGGGTGGGTGG - Intronic
1019943980 7:4312209-4312231 GAGCAGAAGCAGAGGGAGGGAGG - Intergenic
1020222972 7:6255607-6255629 CCTCATCAAGATAGGGAGGGAGG + Intronic
1020224538 7:6269752-6269774 CAAGATAAGGAGAGAGAGGATGG - Intronic
1021064249 7:16154123-16154145 CATTACAAGGAGTGGGAGGCAGG - Intronic
1021472771 7:21024551-21024573 CATCAAAGGGAGAGGCAGTGTGG + Intergenic
1021903602 7:25311854-25311876 CCTCATATGTGGAGGGAGGGAGG + Intergenic
1022518749 7:30992334-30992356 GACCATAAGGAGAGGGAGAATGG - Intronic
1022831853 7:34075645-34075667 CGTGATAGGCAGAGGGAGGGAGG - Intronic
1023348212 7:39293209-39293231 CATGCCAAGGAGAGGGAGGGTGG - Intronic
1023386848 7:39667041-39667063 CATCAAAAAGAGTGGGAGTGAGG - Intronic
1023648904 7:42348159-42348181 CATCAGAAAGAGAGGGAGACAGG + Intergenic
1023784279 7:43690928-43690950 CATCATCAGGCCAGGGATGGTGG + Intronic
1024494682 7:50031552-50031574 CATCATAAAGAAATTGAGGGCGG + Intronic
1024602938 7:51001113-51001135 CATCCAAAGGAGAGGGAGCTGGG - Intergenic
1024969302 7:55054004-55054026 TATTCTACGGAGAGGGAGGGAGG - Intronic
1025798307 7:64760416-64760438 CATCAAAAGGGGAAGGAGAGGGG - Intergenic
1026865539 7:73821913-73821935 AAGCATAAAGGGAGGGAGGGAGG + Intronic
1027844943 7:83361063-83361085 CTTTATAAGAAGAGGAAGGGAGG - Intergenic
1028837794 7:95394268-95394290 GACAATAAGGAAAGGGAGGGAGG + Intronic
1029335007 7:99891510-99891532 CAACATAGGCAGAGTGAGGGGGG + Exonic
1030842885 7:114377967-114377989 CTACTTAAGGAGAGGGAGAGAGG - Intronic
1031297701 7:120024323-120024345 CCTCATAAGAAGAGGAAGAGAGG - Intergenic
1032865182 7:135917698-135917720 CATCCTCAGGAGAGGGAAGCAGG + Intergenic
1033282724 7:140017415-140017437 ATTCCTAAGGAGAGGCAGGGAGG + Intronic
1033350825 7:140560449-140560471 TATCATAAAGAGAGAGAGAGAGG - Intronic
1033535471 7:142308246-142308268 CCTGAAAAGGAGAGGAAGGGAGG + Intergenic
1034629074 7:152516526-152516548 CCTCATGAGGAGAGTGTGGGTGG - Intergenic
1037289467 8:17335931-17335953 AATAAAGAGGAGAGGGAGGGTGG - Intronic
1037654750 8:20873289-20873311 CATGCTAAGGAGAGAGAGGCTGG - Intergenic
1037687959 8:21159533-21159555 CAGAATAAAGAGAGGGAGCGGGG + Intergenic
1038281341 8:26168045-26168067 CCTCAGAAGGAGAAGGAGGTGGG - Intergenic
1038358207 8:26849886-26849908 CACCATATGGAGTGGGATGGAGG + Intronic
1038586607 8:28795339-28795361 CCTCATAAGAAGAGGAAGAGAGG + Intronic
1038639202 8:29310356-29310378 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
1038721335 8:30038583-30038605 GAACAGAGGGAGAGGGAGGGAGG + Intergenic
1039795067 8:40905923-40905945 CATCATAAAAAGGGGGAGGAGGG + Intergenic
1040999709 8:53438625-53438647 CATCAAAAGGGGAAGGAGAGGGG - Intergenic
1042269475 8:66940953-66940975 AATCAAAAGGACATGGAGGGAGG + Intergenic
1042297082 8:67232182-67232204 CATCACAAGTAGGGGGTGGGAGG + Intronic
1043262885 8:78223868-78223890 CATCATATGGCAAGAGAGGGAGG - Intergenic
1044473263 8:92597155-92597177 CACTGGAAGGAGAGGGAGGGAGG + Intergenic
1046682126 8:117182157-117182179 CATGAGAAGGAGAGTGAGGTGGG + Intergenic
1046958170 8:120083032-120083054 CATCCTTAGGAAAGGGAGGGAGG + Intronic
1047896495 8:129372097-129372119 CATCACAAGGAAAGGGAAAGAGG + Intergenic
1048550904 8:135432917-135432939 CAGCCTTGGGAGAGGGAGGGAGG + Intergenic
1048795056 8:138141949-138141971 CATCATGAGTAGAGGTGGGGAGG - Intronic
1049276458 8:141722492-141722514 TTTAATAAGGAGAGGGATGGGGG + Intergenic
1049365902 8:142236745-142236767 CAACATGAGGAGAGGGACTGGGG - Intronic
1049552810 8:143268184-143268206 CATCATTAGGGGATGGAGGCTGG + Intronic
1049846252 8:144803258-144803280 CAGCATCAGGAGAGGGAGGATGG - Intronic
1050042055 9:1506363-1506385 TTTTAAAAGGAGAGGGAGGGAGG - Intergenic
1050857033 9:10372209-10372231 AATCTAAAGGAGAGGAAGGGAGG - Intronic
1051707465 9:19895761-19895783 CCGCATGAGGAGATGGAGGGTGG - Intergenic
1055881224 9:81006289-81006311 CATTATAAGGGTAGGGAGGGAGG + Intergenic
1056254411 9:84783932-84783954 CAGCATGAGGAGATGGAGGTTGG + Intronic
1056869491 9:90264215-90264237 CAAAATGAGGAGAGGTAGGGTGG - Intergenic
1056926035 9:90835186-90835208 CATCATAAGGAGGGGGAACAGGG + Intronic
1058540114 9:106002982-106003004 CATCTGAAGGAGAGGGATGAAGG + Intergenic
1060949929 9:127594979-127595001 AGACAAAAGGAGAGGGAGGGAGG + Intergenic
1061048559 9:128180707-128180729 CACCAGAAGGTGAGGGAGGGAGG - Exonic
1185957695 X:4510005-4510027 TATTAGAGGGAGAGGGAGGGGGG - Intergenic
1186069960 X:5808802-5808824 AAGCAGCAGGAGAGGGAGGGAGG - Intergenic
1186497419 X:10022707-10022729 CATCCTTACTAGAGGGAGGGAGG + Intronic
1187124146 X:16437720-16437742 CAGCATATGGATAGGGAGGTGGG + Intergenic
1187248892 X:17579474-17579496 GATAAAAAGGAGAGGGAGAGGGG - Intronic
1188385471 X:29552159-29552181 CTTCATAAGGGGAGGGGAGGTGG - Intronic
1189398797 X:40646698-40646720 CATCATGAGCACAGGCAGGGAGG - Intronic
1190503560 X:51102862-51102884 CTTCATAATGAGAGGGAGAATGG + Intergenic
1190636307 X:52437423-52437445 AATCATAAACAGAGGGAGGCTGG + Intergenic
1190888697 X:54551124-54551146 CATGATAAGGAAAGGGACAGGGG - Intronic
1192432830 X:71124307-71124329 CATCAAAGGGAGAGGGAGGCCGG - Exonic
1194200473 X:90948776-90948798 CAGGAGAAAGAGAGGGAGGGAGG - Intergenic
1195086496 X:101418512-101418534 CATTAGGAGGAGGGGGAGGGCGG + Intronic
1195449133 X:104990380-104990402 CATCCCAAGGGGAGAGAGGGTGG - Intronic
1195490497 X:105463263-105463285 AATAATAAGGAGTGGGAGAGTGG + Intronic
1196126967 X:112111412-112111434 CATCAAAAGGGGAAGGAGAGAGG - Intergenic
1196194470 X:112825225-112825247 AATGTTCAGGAGAGGGAGGGAGG + Intronic
1196222402 X:113126593-113126615 CTTCATAAGGAAAGGGAGATTGG + Intergenic
1197333436 X:125181700-125181722 CCACAGAAGGAGAGGGAAGGAGG + Intergenic
1197460780 X:126737937-126737959 CAGCTCCAGGAGAGGGAGGGAGG - Intergenic
1198062264 X:133058622-133058644 CTTCATAAGGAAAGAGATGGAGG - Intronic
1198095918 X:133379676-133379698 CATTATATGGAAAGTGAGGGAGG + Intronic
1198479360 X:137026968-137026990 CAGCAGAGGGAGAGGGAGTGAGG + Intergenic
1200694726 Y:6348983-6349005 CATCATAAGGGGAAGGAGAGGGG - Intergenic
1200711514 Y:6488745-6488767 CATCATAAGTGGAAGGAGAGGGG + Intergenic
1201040551 Y:9825727-9825749 CATCATAAGGGGAAGGAGAGGGG + Intergenic
1201143446 Y:11047410-11047432 GAGCATAAGGAGAGGGAGGGAGG + Intergenic
1201271802 Y:12263118-12263140 CATCAAAAGGGGAAGGAGTGGGG - Intergenic
1202089732 Y:21177432-21177454 CATCAAAAGGGGAAGGAGAGGGG - Intergenic
1202126828 Y:21575731-21575753 CAACAAAATGTGAGGGAGGGTGG + Intergenic
1202192247 Y:22257539-22257561 CATCAAAAGGGGAAGGAGAGGGG - Intergenic
1202258273 Y:22942697-22942719 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
1202411263 Y:24576455-24576477 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
1202459518 Y:25093617-25093639 CATCAAAAGGGGAAGGAGAGGGG - Intergenic