ID: 1084740688

View in Genome Browser
Species Human (GRCh38)
Location 11:71137630-71137652
Sequence CCTTCCAGGGAGTGGGTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 604
Summary {0: 1, 1: 0, 2: 1, 3: 60, 4: 542}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084740688_1084740700 26 Left 1084740688 11:71137630-71137652 CCCGCCACCCACTCCCTGGAAGG 0: 1
1: 0
2: 1
3: 60
4: 542
Right 1084740700 11:71137679-71137701 AAGGCAAATCTGACCAGAACTGG 0: 1
1: 1
2: 1
3: 16
4: 155
1084740688_1084740699 7 Left 1084740688 11:71137630-71137652 CCCGCCACCCACTCCCTGGAAGG 0: 1
1: 0
2: 1
3: 60
4: 542
Right 1084740699 11:71137660-71137682 GTTGAACAGAATGCAGCAGAAGG 0: 1
1: 0
2: 4
3: 21
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084740688 Original CRISPR CCTTCCAGGGAGTGGGTGGC GGG (reversed) Intronic
900269696 1:1780817-1780839 CCTTCAAGGGATTGGGGGTCAGG + Intergenic
900746540 1:4364674-4364696 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
900864797 1:5260593-5260615 CCCTCCATGGAGTGTGTGGAAGG + Intergenic
900943192 1:5814402-5814424 CTTTGCAGGGGGCGGGTGGCAGG + Intergenic
902193490 1:14780464-14780486 CCATCCAGGCAGTGAGTGGGAGG - Intronic
902265194 1:15258242-15258264 GCTGCCAGGGACTGGGGGGCTGG - Intronic
902612089 1:17603306-17603328 CCTTGGAGGGGGTGGGGGGCGGG + Intronic
903030947 1:20464028-20464050 CTGTCCATGGAGTGGGTGGGTGG - Intergenic
903736222 1:25531346-25531368 CAGTCCAGGGAGTGGGTGCCAGG - Intergenic
903767982 1:25747026-25747048 CCTTGCAGGGAGGGGATGGATGG - Intronic
904317177 1:29673132-29673154 GCTCCCAGGTAGTGGGTGGCAGG - Intergenic
904363530 1:29994994-29995016 CCTGTCGGGGAGTGGGGGGCTGG - Intergenic
904434611 1:30486058-30486080 CCCTCCAGGGAGGGTGTGGGAGG + Intergenic
905238267 1:36565349-36565371 CCTTCCTGGGGGTGGCAGGCAGG + Intergenic
905627310 1:39497746-39497768 CCTGCCACGGGGTGGGGGGCAGG - Intronic
905709244 1:40086731-40086753 CCTTCCATCATGTGGGTGGCAGG + Intronic
907272583 1:53299521-53299543 CTCACCAGGGAGTGTGTGGCAGG + Intronic
907336387 1:53702470-53702492 GCCTCCTGGGAGAGGGTGGCAGG + Intronic
907424399 1:54370168-54370190 CCTTCCTGGAAGCTGGTGGCTGG + Intronic
908631680 1:66116427-66116449 CCTTCCAGGATGTGTGTGGTGGG - Intronic
908793121 1:67802780-67802802 CCAACCAGGGAGTGGTGGGCAGG - Intronic
908806452 1:67937672-67937694 AGTTCGAGGGAGTGGGTGGATGG + Intergenic
909129750 1:71719774-71719796 CCTGCCAGGGGGTGGGGGCCTGG - Intronic
909260735 1:73486442-73486464 CCTCTCAGGGGGTGGGGGGCTGG - Intergenic
910872894 1:91851208-91851230 CCTTCCAAGGAGTAGGCAGCAGG - Intronic
910934970 1:92480258-92480280 ACTTCCAGGCAGAGAGTGGCTGG + Intronic
911061414 1:93751270-93751292 CCTCCCATGCAGTGGGTGACAGG + Intronic
911991229 1:104699119-104699141 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
912306370 1:108571724-108571746 CCTCCTAGGAAGTGGGCGGCAGG - Intronic
912392968 1:109317567-109317589 CCTTCCTGGGGGTGGTTGGGCGG + Intronic
912615456 1:111095820-111095842 CCTTTCAGGGGCTGGGGGGCTGG + Intergenic
912632672 1:111259803-111259825 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
912668206 1:111602041-111602063 CTTTCCAGGGTGTGGGATGCAGG - Intronic
912776736 1:112510263-112510285 CCATCCAAGGAGTAGGGGGCAGG - Intronic
913205502 1:116534567-116534589 CCTTCAGGGCAGTGGGCGGCAGG + Intronic
914076756 1:144359980-144360002 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
914102422 1:144606517-144606539 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
914171203 1:145225556-145225578 CCTTTCAGGGGGTGGGGGGCTGG - Intergenic
914296474 1:146330681-146330703 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
914464627 1:147915596-147915618 CATTCCAGGGAGAGAGTGACTGG - Intergenic
914526312 1:148469529-148469551 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
914916227 1:151820892-151820914 CCTTCCAGGGAGTGGGGCTGGGG + Intronic
915369424 1:155335895-155335917 CATTGCAGGGAGTGGGTGGGAGG - Intronic
916473440 1:165145921-165145943 CATTCCAGTGATTGGGTGGTTGG + Intergenic
917263072 1:173190491-173190513 CCTGCCAGGGACTGGGCTGCAGG + Intronic
917289527 1:173457959-173457981 CCTGCCGGGGGGTGGGGGGCTGG + Intergenic
917933499 1:179840737-179840759 CCTGTCAGGGGGTGGGGGGCTGG + Exonic
918650301 1:186954432-186954454 CCTGTCAGGGTGTGGGGGGCTGG + Intronic
920185427 1:204156395-204156417 CCTTCCTGAGTGTGGGTGGGTGG + Intronic
920229284 1:204459937-204459959 CCTGCCTGGGAGTTGGGGGCAGG + Exonic
920865520 1:209748932-209748954 ATTTCCAGGAAGTGGGTGGGAGG - Intergenic
921830987 1:219727414-219727436 CCTGTCAGGGAGTGGGAGACTGG - Intronic
922824814 1:228510425-228510447 CCTTTCAGGGAGGAGGGGGCTGG + Intergenic
922976113 1:229784894-229784916 CCTTCCAGGGTCTGTGTGCCAGG + Intergenic
924160140 1:241222812-241222834 CCTGTCAGGGGGTGGGGGGCTGG - Intronic
924302621 1:242654774-242654796 CCTGTCAGGGGGTGGGGGGCGGG + Intergenic
1062934196 10:1374042-1374064 CATGCCAGGGCGTGGGTGGCCGG - Intronic
1063364328 10:5480662-5480684 CCCTCCAGGGAGGGGAAGGCAGG - Intergenic
1063512878 10:6663331-6663353 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1064951005 10:20850239-20850261 GATCCCAGGCAGTGGGTGGCTGG + Intronic
1066703867 10:38157030-38157052 CCTCCCAGGGAGTGGCGTGCAGG - Intergenic
1067013009 10:42732039-42732061 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1067069171 10:43119809-43119831 CAGGCCAGGGTGTGGGTGGCAGG - Intronic
1067080722 10:43210855-43210877 CCTTGCAGGGAGTGGGGGACAGG + Intronic
1067080738 10:43210919-43210941 CCTTGCAGGGAGTTGGGGACAGG + Intronic
1067080751 10:43210983-43211005 CCTTGCAGGGAGTGGGGGACAGG + Intronic
1067310831 10:45112077-45112099 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1067479154 10:46584231-46584253 CCTTCCTGGGGGTGGTGGGCTGG - Intronic
1067615585 10:47757570-47757592 CCTTCCTGGGGGTGGTGGGCTGG + Intergenic
1067898823 10:50216150-50216172 CCTGTCAGGGGGTGGGGGGCTGG + Intronic
1069573891 10:69511933-69511955 CCTTTCAGAGGGTGGGGGGCTGG + Intergenic
1069718638 10:70536356-70536378 CATTCCAGGGACTCTGTGGCAGG - Intronic
1069734013 10:70639628-70639650 CCTGCCAGGGGGTGAGGGGCTGG - Intergenic
1069808162 10:71138842-71138864 CCATGGAGGGACTGGGTGGCAGG - Intergenic
1069862470 10:71480218-71480240 ATTCTCAGGGAGTGGGTGGCCGG + Intronic
1070734106 10:78851827-78851849 ACATCCAGGGAGAGGGTGCCGGG + Intergenic
1072219506 10:93315765-93315787 CCTTGGAGGGGGTGGTTGGCGGG + Intronic
1073107549 10:101040967-101040989 TCTTCCAGGGGGTGGGAGGGTGG - Exonic
1073117042 10:101097154-101097176 ACTTCCAGGGCGGTGGTGGCAGG - Intronic
1073193524 10:101669369-101669391 CCTCCCAGGGAGTTTGTGTCAGG - Intronic
1073585836 10:104709095-104709117 GCTTCCAGGGAGTGTGAGGCTGG - Intronic
1073978746 10:109130124-109130146 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1074141624 10:110678604-110678626 TGATCAAGGGAGTGGGTGGCAGG - Intronic
1074289875 10:112130422-112130444 CTTGCAAGGGAGGGGGTGGCAGG + Intergenic
1074462186 10:113647885-113647907 CCTTTCTGGGAGTGGATGGATGG - Intronic
1075104155 10:119526680-119526702 GCTCCCAGGGAGGGAGTGGCAGG - Intronic
1075419180 10:122288237-122288259 CCTGCCACGGGGTGGATGGCAGG + Intronic
1076698310 10:132257536-132257558 GCTGCGAAGGAGTGGGTGGCAGG + Intronic
1076727890 10:132421829-132421851 CCTTCCTGGGTGTGGCTGGGGGG + Intergenic
1076806362 10:132861157-132861179 CCTGCCAGGGAGTGCGAGGGCGG - Intronic
1076898738 10:133326803-133326825 GCCTCCAGGCAGGGGGTGGCAGG - Intronic
1078084791 11:8227302-8227324 CCTTCCAGGGAGGGTGTGTAGGG + Intronic
1078263746 11:9737195-9737217 CCTTCCTGGGAGGGGCAGGCTGG - Intronic
1078722590 11:13898107-13898129 CCTTGCAGGGCCTGGCTGGCAGG + Intergenic
1079318495 11:19430287-19430309 TCTTCCATGGAGTATGTGGCAGG + Intronic
1079558402 11:21791016-21791038 CCTGCCAGGGGGTGGGGAGCTGG - Intergenic
1081323838 11:41721891-41721913 TCTGTCAGGGAGTGGGGGGCTGG - Intergenic
1081644212 11:44778497-44778519 CCTTCTAGTAGGTGGGTGGCTGG + Intronic
1081787573 11:45757981-45758003 CCTGTAAGTGAGTGGGTGGCAGG + Intergenic
1082723654 11:56709560-56709582 CCTGTCAGGGAGTGGTGGGCTGG - Intergenic
1082813627 11:57493981-57494003 CCTTCCTGAGAGTGAGTGTCTGG - Exonic
1082967655 11:58984103-58984125 CCTTTCAGGGGGTGGGTGACTGG - Intronic
1083270782 11:61571540-61571562 CCTTCTAGTGCCTGGGTGGCTGG + Intronic
1083502831 11:63127126-63127148 CCTGTCAGGGAGTGGGGGGCTGG - Intronic
1083938937 11:65884836-65884858 CCTGCCAGGGATTGGCCGGCAGG - Intronic
1084266304 11:68007120-68007142 ACTGCCAGGGAGGGGGTGGGAGG + Intergenic
1084540376 11:69782607-69782629 CCATCCAGGGAGAGGGAGGGGGG - Intergenic
1084710441 11:70840693-70840715 TCTTCCAGGAAGTGGGAGCCTGG + Intronic
1084740688 11:71137630-71137652 CCTTCCAGGGAGTGGGTGGCGGG - Intronic
1085013477 11:73157501-73157523 CCTTGCAAGGATTGGGAGGCAGG + Intergenic
1085084330 11:73656649-73656671 CCTGGCATGGGGTGGGTGGCAGG + Intronic
1085336418 11:75700177-75700199 CCTTCCAGAAAGTAGATGGCTGG - Intergenic
1085418809 11:76337987-76338009 CCTTCCCTGGAGTGGGAGGAGGG - Intergenic
1085609310 11:77932951-77932973 CCTGTCAGGGGGTGGGGGGCTGG + Intronic
1086003795 11:82012044-82012066 CCTTCCTGGGAGTAGATAGCTGG + Intergenic
1086531032 11:87785231-87785253 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1086720380 11:90113999-90114021 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1086871673 11:92044897-92044919 CATGTCAGGGAGTGGGGGGCGGG + Intergenic
1087422627 11:97949559-97949581 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1087898824 11:103617303-103617325 CCTATCAGGGGGTGGGGGGCTGG + Intergenic
1088679284 11:112225714-112225736 CCTGTCAGGGAGTAGGGGGCTGG + Intergenic
1088720949 11:112591168-112591190 CCTTCAAAGGAATGGGAGGCAGG + Intergenic
1088745131 11:112798625-112798647 CCTTGCATGAAGTGGGGGGCAGG + Intergenic
1089292296 11:117444545-117444567 CCGTCCAGGGAGGAGGGGGCGGG + Intronic
1089689910 11:120180812-120180834 CTGTCCTGGGAGTGGGAGGCTGG + Intronic
1090828349 11:130403695-130403717 CTTTTCAGCGAGTGGGAGGCTGG - Intergenic
1091421872 12:348754-348776 CCTGTCAGGGGGTGGGGGGCTGG + Intronic
1091660653 12:2380820-2380842 CCTGCTTGGGAGTGGGTGGGGGG + Intronic
1092072281 12:5641217-5641239 CCTGTCAGGGGGTGGGGGGCAGG + Intronic
1092532341 12:9354956-9354978 CCTGTCAGGGAGTGGGGGGCTGG - Intergenic
1092984255 12:13830029-13830051 CCTTCCAGATAGTGGGTCTCAGG - Intronic
1093011883 12:14115741-14115763 CCTGTCAGGGGGTGGGTGCCTGG + Intergenic
1093329236 12:17814689-17814711 CCTGTCAGGGAGTGGAGGGCCGG - Intergenic
1093415587 12:18916835-18916857 GCTGCAAAGGAGTGGGTGGCTGG - Intergenic
1093899897 12:24619973-24619995 CCTGTCGGGGAGTGGGAGGCTGG - Intergenic
1093972425 12:25386932-25386954 CTCTCCAGGGAGCGGGTGGGTGG + Intergenic
1094181497 12:27596967-27596989 TCTTCCAGGGAGGAGGTGGGTGG - Intronic
1096413161 12:51391561-51391583 CCTCCCGGGGAGAGGGTCGCGGG + Intronic
1096735054 12:53646695-53646717 CCTGTCAGGGGGTGGGGGGCTGG + Intronic
1096761481 12:53845500-53845522 CATTCCAGGTAGTGGGTGTGGGG - Intergenic
1097089631 12:56494755-56494777 CCTCCCAGACAATGGGTGGCCGG + Intergenic
1098140367 12:67444617-67444639 CCTTCCAGGGAAAAGGTGCCAGG - Intergenic
1098291136 12:68957839-68957861 CCTGTCAGGGGGTGGGTGGCTGG - Intronic
1098450727 12:70615655-70615677 CCTTCCAAGGGTGGGGTGGCAGG - Intronic
1100073383 12:90749617-90749639 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1100399105 12:94212473-94212495 CCTGCCGGGGGGTGGGGGGCTGG - Intronic
1100797666 12:98199310-98199332 CCTGCCAGGGGCTGGGGGGCTGG - Intergenic
1101875046 12:108592127-108592149 CCATCCAGGAAGTTGGTGGGGGG + Exonic
1101878943 12:108613583-108613605 CCTCCCAGGGACTGAGTGACCGG - Intergenic
1101879218 12:108614978-108615000 CCTCCCAGGGACTGGGTGACGGG - Intergenic
1102031383 12:109741898-109741920 CCTGCCAGGCAGGGAGTGGCTGG - Intronic
1102657024 12:114490662-114490684 CCTTCTAGGGACTGGGGAGCGGG + Intergenic
1104196256 12:126541429-126541451 CCTGTCAGGGGGTGGGAGGCTGG + Intergenic
1104416380 12:128599376-128599398 CCTTCCAGGTACTGGGGGACAGG + Intronic
1104836970 12:131797865-131797887 CCCCCCAGGGTGTGGGTGCCTGG - Intronic
1104951282 12:132441641-132441663 CCTGCCAGCGAGTGGGTTGAGGG + Intergenic
1105349512 13:19602497-19602519 GCTGCCAGAGAGTGGGTGGCTGG + Intergenic
1105526511 13:21182838-21182860 CTTGCCAGCAAGTGGGTGGCAGG + Intergenic
1106665530 13:31847014-31847036 GCTGCCGGGGAGTGGGTGGGTGG + Intergenic
1107898580 13:44989775-44989797 CCGGCCAGGGAGTGGGTAGATGG - Intronic
1109510768 13:63369029-63369051 TGTTCTGGGGAGTGGGTGGCAGG + Intergenic
1109571211 13:64192707-64192729 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1111678581 13:91416606-91416628 CCTGTCAGGGGGTGGGAGGCTGG - Intronic
1112011512 13:95297568-95297590 CCATCCAGGAAGTGGCTGCCTGG - Intronic
1112042891 13:95565773-95565795 CCTGTCAGGGGGTGGGGGGCTGG - Intronic
1112271750 13:97976027-97976049 CCTTCCTGGGGGTGGGTGAAGGG + Intronic
1112365855 13:98754818-98754840 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1113478035 13:110599224-110599246 CATCCCAGGGAGAGGGTAGCTGG - Intergenic
1113521319 13:110943506-110943528 CCTTCCAGTAAGTCGGTAGCAGG - Intergenic
1113604163 13:111593494-111593516 CCTGTCATGGGGTGGGTGGCTGG - Intronic
1115525582 14:34277258-34277280 CTTTTTAGGGAGTGGGAGGCAGG - Intronic
1115936425 14:38558316-38558338 CCTGTCAGGGAGTGGGGGGCTGG + Intergenic
1116269324 14:42741422-42741444 CCTTGCAGGCAGGGGGTGGGGGG - Intergenic
1116861878 14:50001789-50001811 CCTTCCACGGAGAGGCTGCCGGG + Intronic
1117636197 14:57746076-57746098 CCTGTCATGGAGTGGGGGGCAGG + Intronic
1117720235 14:58622180-58622202 CCTCCCAGGGAATTGGTGCCAGG - Intergenic
1117893178 14:60449029-60449051 CCTGTCAGGGAGTAGGGGGCTGG + Intronic
1117952008 14:61092033-61092055 ACATCCAGGGAGTGGGTGCCAGG + Intergenic
1118287315 14:64487647-64487669 TCCTCCAGGGCCTGGGTGGCAGG + Exonic
1118600637 14:67469605-67469627 CCTTCCAGGAAGAGGATGGAGGG - Intronic
1118685399 14:68285668-68285690 TCTGCCAGGGAGTGGGCGGGAGG + Intronic
1119037034 14:71239166-71239188 GCTGCCAGGGACTGGGTGGGAGG + Intergenic
1119172693 14:72546911-72546933 CTTTCCTGAGAGTGGGTGGGAGG - Intronic
1119412024 14:74438421-74438443 CCTGGCAGGGAGTTGGCGGCAGG + Intergenic
1119806451 14:77485342-77485364 CCTATCAGGGAGTGGGCAGCAGG + Intronic
1120568286 14:86086234-86086256 CCTGTCAGGGAGTGGGGGGCTGG - Intergenic
1121010563 14:90517770-90517792 CCTTTGAGAGAGCGGGTGGCAGG - Intergenic
1121342650 14:93114871-93114893 CGTTCCAGGGAAGCGGTGGCCGG - Intronic
1121347897 14:93149665-93149687 CCTGCCGGGGTGAGGGTGGCGGG - Intergenic
1121563592 14:94892638-94892660 GCTCCCAGGGAGTAAGTGGCAGG - Intergenic
1121629731 14:95413496-95413518 CCTTGCAGGGGATGGGAGGCTGG - Intronic
1121696562 14:95917970-95917992 CCTGCCAGGGGCTGGGTGGAGGG - Intergenic
1122389470 14:101370399-101370421 CCTGCCAGGGACCGGGTTGCTGG - Intergenic
1122692358 14:103537437-103537459 CCTTCCAGGGCTTGGGCAGCTGG - Intergenic
1122718951 14:103711692-103711714 CCTTCCTGGGAGAGGCTGGGTGG - Exonic
1123162924 14:106297239-106297261 CCTGTCGGGGAGTGGGGGGCTGG - Intergenic
1124202027 15:27686867-27686889 TCTTCCAGGGAGAGCGGGGCTGG - Intergenic
1124512374 15:30338123-30338145 CCTTCCTGAGAGTGTGAGGCCGG - Intergenic
1124730540 15:32192628-32192650 CCTTCCTGAGAGTGTGAGGCCGG + Intergenic
1125301765 15:38262375-38262397 TCTACCTGGGAGTTGGTGGCAGG + Intronic
1126321549 15:47429606-47429628 CTTCCCAGGCAGTTGGTGGCTGG - Intronic
1126336432 15:47590373-47590395 CCTGTCAGGGGGTGGGGGGCTGG + Intronic
1128547865 15:68579605-68579627 CCCTCCAGGGAGTGCGCGGCGGG + Intronic
1128813811 15:70591012-70591034 CCTTTCAGAGAGTGGAGGGCGGG + Intergenic
1129554149 15:76487351-76487373 GCTTCCAGGGGTTGGGTGGGTGG + Intronic
1129742109 15:77994290-77994312 CCTTCCAAGGGGTGGGGAGCAGG + Intronic
1129761299 15:78130787-78130809 CCTTCCTGGGGCTGGGGGGCAGG + Intronic
1129843374 15:78757179-78757201 CCTTCCAAGGGGTGGGGAGCAGG - Intergenic
1131259761 15:90882257-90882279 CCATCCAGGCAGTCGGGGGCTGG + Exonic
1131832353 15:96361751-96361773 TCATCCCGGGAGTAGGTGGCTGG + Intergenic
1131917031 15:97278878-97278900 CCTATCAGGGGGTGGGGGGCGGG - Intergenic
1131933460 15:97473647-97473669 CCTTCCAGCCATTGAGTGGCAGG + Intergenic
1132374218 15:101318152-101318174 CCTACCAGGGACTGGGGGCCGGG - Intronic
1132481769 16:169863-169885 CCTGCCAGAGGGTAGGTGGCTGG + Intergenic
1132482637 16:174120-174142 CCTGCCAGAGGGTAGGTGGCTGG + Intergenic
1132584329 16:699782-699804 CCTTCCAGTGAGGCTGTGGCAGG - Intronic
1132655023 16:1038208-1038230 CCTTCCAGGGAGCAGAGGGCTGG - Intergenic
1133103573 16:3493529-3493551 CCTCTCAGGGAGGCGGTGGCGGG + Exonic
1133475381 16:6116262-6116284 CCTGTCAGGGGGTGGGGGGCAGG + Intronic
1136087857 16:27898346-27898368 CCTCGCAGGGGGTGGGTGGGCGG - Intronic
1136545862 16:30954337-30954359 CCTCCCAGGTAGTGAGTAGCTGG + Exonic
1136559874 16:31033089-31033111 CTTTCGAGGCAGTGGGTGGTAGG - Intronic
1137350862 16:47712854-47712876 TGTCCCAGGGAGTGGGTGGCCGG - Intergenic
1138164689 16:54790102-54790124 CCTGTCAGGGAGTGGGGGGCTGG - Intergenic
1139182436 16:64764007-64764029 CCCTCCAGGGAGTGAGTTTCTGG + Intergenic
1139299297 16:65931396-65931418 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1139344066 16:66290658-66290680 CAGTGCAGGGAGTGGCTGGCTGG - Intergenic
1141673631 16:85506074-85506096 CCTCCCCGGGGGTGGGTGCCTGG - Intergenic
1141752059 16:85965092-85965114 CCTTCCAGTGAGTGGTAGGGTGG + Intergenic
1142101687 16:88275504-88275526 CCTTCCGGGGCGTTGATGGCGGG + Intergenic
1142137502 16:88458401-88458423 ACCTCCAGGGAGGGGCTGGCGGG - Intronic
1142202710 16:88768701-88768723 CCTTCCTGGCAGTGAGGGGCTGG + Intronic
1142373209 16:89694348-89694370 CCTCCCTGGGAGTGGGAGGCTGG - Intronic
1142698429 17:1645825-1645847 CCTGAGAGGGAGGGGGTGGCTGG + Intergenic
1142713073 17:1733788-1733810 CCATCTCGGGGGTGGGTGGCGGG + Exonic
1142874536 17:2843636-2843658 CCTGCAAGGTAGTGGGAGGCAGG - Intronic
1143190106 17:5034465-5034487 CCTTCCAGAGGGTGAGTGGGAGG - Exonic
1143300868 17:5909852-5909874 ACTTTCTGGGAGTGGCTGGCTGG - Intronic
1143423738 17:6816379-6816401 CCTGTCAGGGTGTGGGGGGCTGG - Intronic
1144092732 17:11872364-11872386 CATTGCAGGGGGTGGGGGGCGGG - Intronic
1144203054 17:12958620-12958642 CATACGAGGGAGTGGGTGTCTGG + Intronic
1144729597 17:17518837-17518859 GCTGCCAGGGACTGGGGGGCGGG + Intronic
1144844409 17:18208895-18208917 GCTTGCAGGGCGTGGATGGCAGG - Exonic
1144854714 17:18261425-18261447 CCTGCCAGAGTGTGGGTGCCAGG - Intronic
1144950660 17:18991908-18991930 CCTGCCAGGGTGTGGGAGGATGG + Intronic
1147372758 17:40004771-40004793 CCTTCCAGGAAGGGTGTGGTGGG + Intergenic
1147726955 17:42571837-42571859 ACTTCCATGGAGTGGGGGGAAGG - Exonic
1148115499 17:45172523-45172545 GCTGCCAGGGAGTGGGGGGAGGG + Intergenic
1148942736 17:51228891-51228913 CCTTCTCGGGGGTGGGTGGGTGG + Intronic
1149180469 17:53930815-53930837 CCTGTCAGGGTGTGGGGGGCTGG + Intergenic
1149505137 17:57188028-57188050 GTTTCCAGGGACTGGGAGGCTGG + Intergenic
1151539571 17:74758224-74758246 CAGTCCAGGGAGCGGATGGCGGG - Intronic
1152042504 17:77913645-77913667 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1152283530 17:79399223-79399245 ACTGCCACGGACTGGGTGGCTGG - Intronic
1152605655 17:81288362-81288384 CCTTCCAGCCAGTGTGCGGCTGG - Intronic
1152746141 17:82040207-82040229 CCCTCCAGGCAGTGGTTGGGAGG - Intergenic
1152750602 17:82060814-82060836 CCTTGCAGGGGGTGAGGGGCTGG - Intronic
1152923340 17:83076790-83076812 CCTTCCCACGAGTGGGTGGGTGG + Intergenic
1153265480 18:3264541-3264563 CTTTGCAAGGAGTGGGTGGCAGG - Intronic
1154484085 18:14859723-14859745 CCTCCCAGACAATGGGTGGCTGG + Intergenic
1155837444 18:30603809-30603831 CCTGTCAGGGAGTGGGGGACTGG - Intergenic
1156191469 18:34726090-34726112 CCTGTCGGGGAGTGGGGGGCTGG + Intronic
1156434201 18:37108926-37108948 CCTGTCAGGGGGTGGGGGGCTGG - Intronic
1156742573 18:40350133-40350155 CCTACCAGGGTGGTGGTGGCTGG - Intergenic
1157696259 18:49726115-49726137 GCTGCCAGGGAGTGGGGGTCGGG + Intergenic
1157804081 18:50645059-50645081 CAGGCCAGGGAGTGGGTGGCTGG + Intronic
1160911039 19:1473920-1473942 CCTCCCAGGCTGTGTGTGGCAGG + Exonic
1161200503 19:3012129-3012151 CCTCCCGGGTAGTGGGTAGCTGG - Intronic
1161313479 19:3607325-3607347 CCTTCCAGGGGTGGGGTGGGAGG + Intergenic
1161341527 19:3745787-3745809 CCTCCTGAGGAGTGGGTGGCTGG - Intronic
1161722148 19:5909036-5909058 CCCACCGGGGGGTGGGTGGCCGG - Exonic
1161751728 19:6102645-6102667 CCTTCCAGGAAGGGGGCAGCAGG - Intronic
1162128614 19:8512236-8512258 CCATCCAGGGAGTTGAGGGCGGG + Intronic
1162128702 19:8512603-8512625 CCTTCCAGGGACTGTGTGGGCGG + Exonic
1162940259 19:14005349-14005371 CCTCCCAGAGAGAAGGTGGCAGG + Intronic
1164085057 19:21893836-21893858 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1165837659 19:38769711-38769733 CCTGCCCTGGAGTGGGTGGGCGG - Intronic
1165993093 19:39826987-39827009 CCTGGCAGGGAGGGGGTGGGAGG + Exonic
1166251784 19:41576350-41576372 ACTCCCTGGGAGTGGGTGGGAGG + Intronic
1166266531 19:41688068-41688090 ACTTCCTGGGAGTGGGTGGGAGG - Intronic
1166268613 19:41700272-41700294 CCCTCCAGGGAGGGGGCTGCAGG + Intronic
1166268626 19:41700308-41700330 CCCTCCAGGGAGGGGGCTGCAGG + Intronic
1166268639 19:41700344-41700366 CCCTCCAGGGAGGGGGCTGCAGG + Intronic
1166268652 19:41700380-41700402 CCCTCCAGGGAGGGGGCTGCAGG + Intronic
924982062 2:232590-232612 CCTTTCAGGGGGTTGGGGGCTGG - Intronic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925438644 2:3864992-3865014 TCTCCAAGGGAGTGTGTGGCAGG + Intergenic
925959637 2:9003399-9003421 CCTTCCAGGGAGCGGCGGGTAGG + Intronic
926028127 2:9562423-9562445 GCTTCCAGGGACTGGGAGGAGGG - Intergenic
926197268 2:10771600-10771622 CCCTCCAGGGACAGGGAGGCTGG - Intronic
926527441 2:13998757-13998779 CCTGTCGGGGAGTGGGGGGCTGG + Intergenic
926649138 2:15322231-15322253 CCTGTCAGGGGGTGGGGGGCTGG + Intronic
928095305 2:28401081-28401103 GCTTCCCAGGAGTGGGTAGCTGG + Intronic
928201320 2:29249426-29249448 GCTTCCAGGAGGTGGGTGGTGGG + Intronic
928272001 2:29864914-29864936 CCTTCAGGGGAGAGGGTGGGAGG - Intronic
928426093 2:31179219-31179241 CCTGTCAGGGGGTGGGGGGCAGG - Intronic
928493484 2:31807491-31807513 CCTGCCAGGGGGTGGGTGGAGGG + Intergenic
928736783 2:34300582-34300604 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
929460942 2:42101642-42101664 CGTTCCGGGGAGGGGGTGCCTGG - Intergenic
930710324 2:54544924-54544946 CCTACTGGGGAGTGGGGGGCTGG - Intronic
930734134 2:54757802-54757824 CCTACCAGGGCGAGGGTGGGAGG - Intronic
932324472 2:70848155-70848177 CCTCTCAGGGAGTGGGGAGCTGG + Intergenic
932594553 2:73086065-73086087 CCTTGCAGGGAGGGGAAGGCTGG - Intronic
932756268 2:74412150-74412172 AGTTTCGGGGAGTGGGTGGCAGG - Intergenic
935656095 2:105424864-105424886 CCTGTCAGGGAGTGGGGGCCTGG + Intronic
936903914 2:117514810-117514832 CATCCCAGGCAGTGGGTGGTTGG + Intergenic
936911725 2:117600742-117600764 CCTGCCAGTGGGTGGGGGGCTGG + Intergenic
937044366 2:118843418-118843440 CGATCCAGGGATTGGCTGGCGGG - Intronic
937072163 2:119072787-119072809 CATGCCAGGGAGTGGGCAGCAGG - Intergenic
937101502 2:119274380-119274402 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
937157919 2:119734317-119734339 CATTCCAGGGCCTGGGTGGAGGG - Intergenic
938734623 2:134175075-134175097 CCTACCAGGGAGTATGTGTCCGG + Intronic
938867932 2:135443376-135443398 CCTGTCAGGGGGTGGGGGGCTGG + Intronic
939710928 2:145519283-145519305 CCTGTCTGGGAGTGGGAGGCTGG - Intergenic
939851278 2:147308891-147308913 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
940703325 2:157073595-157073617 CCTGTCAGGGAGTGGGGGGCTGG + Intergenic
940720209 2:157273972-157273994 CCTTTTAGGGGGTGGGGGGCTGG - Intronic
942349492 2:175038080-175038102 CCTTCCCGGGGGTGGGCGGGGGG + Intergenic
942368221 2:175252523-175252545 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
942466949 2:176218300-176218322 CCTGTCAGGGCGTGGGGGGCTGG - Intergenic
942630516 2:177946480-177946502 CCTTCCCGGGACGGGGCGGCTGG - Intronic
943945225 2:194052306-194052328 CCTGTCATGGAGTGGGGGGCAGG + Intergenic
944033329 2:195263950-195263972 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
944195422 2:197048337-197048359 CCTGTCAGGGAGTGGGGGGCAGG - Intronic
944334055 2:198508633-198508655 CCTGTCAGGGGGTGGGGGGCTGG - Intronic
944375292 2:199034429-199034451 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
945749415 2:213762189-213762211 GCTTCCAGGGACTGGGAGGAAGG + Intronic
945895949 2:215481830-215481852 CCTTGTAGGGAGTGAGGGGCAGG + Intergenic
945976258 2:216273562-216273584 CCTGGCAGAGAGTGGGTGGAAGG - Intronic
946924613 2:224614705-224614727 ATTTCCAGGGAGCGGGAGGCTGG + Intergenic
947765787 2:232636300-232636322 CCTTCCAGGGAGCAAGTGGTGGG - Intronic
947807196 2:232976998-232977020 CCTTCCCGGGAGTGCCTGGGAGG + Intronic
948374376 2:237511854-237511876 CTTTTCAGGGAGAGGGTGGGAGG + Intronic
948644750 2:239397503-239397525 CCTTCCAGGAAGTGAGTAGGAGG + Intronic
948856857 2:240734272-240734294 CCTTGCAGGGAGAGGGGAGCGGG + Intronic
1168844868 20:937417-937439 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1170481289 20:16767609-16767631 CTTTCCATGTGGTGGGTGGCAGG - Intronic
1171049506 20:21842213-21842235 ACTTCCAGGTATGGGGTGGCTGG + Intergenic
1171174373 20:23040432-23040454 CTTTTCAGGGAGGGGTTGGCAGG + Intergenic
1172915538 20:38440703-38440725 TCTTCCAAGGAGTTGGTGCCCGG + Intergenic
1173253242 20:41375515-41375537 CCCACCATGGAGTGGGTGGTTGG + Intergenic
1173626341 20:44475852-44475874 CGATCCAGGGCGTGGGAGGCGGG - Intergenic
1173855561 20:46248289-46248311 CTTTTCAGGATGTGGGTGGCTGG + Intronic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1175268480 20:57717089-57717111 CCATGCATGGGGTGGGTGGCGGG - Intergenic
1175348829 20:58303053-58303075 CCTGCCAGGCTGTGGGTGTCAGG + Intergenic
1175408253 20:58749251-58749273 CCTCAAAGGGTGTGGGTGGCTGG + Intergenic
1175639145 20:60612486-60612508 CTTTCTAGGGATTGGATGGCTGG - Intergenic
1175800064 20:61796470-61796492 CTTTCCAGGAAATGGGAGGCAGG - Intronic
1176141854 20:63548376-63548398 CTGTCCAGGGAGAGGGTGGGAGG - Intronic
1176546968 21:8206336-8206358 CCTTCCCCGGAGTGGGGGGTTGG + Intergenic
1176554873 21:8250545-8250567 CCTTCCCCGGAGTGGGGGGTTGG + Intergenic
1176565919 21:8389383-8389405 CCTTCCCCGGAGTGGGGGGTTGG + Intergenic
1176573794 21:8433570-8433592 CCTTCCCCGGAGTGGGGGGTTGG + Intergenic
1176797069 21:13379021-13379043 CCTCCCAGACATTGGGTGGCCGG - Intergenic
1177088967 21:16742256-16742278 CCTTCCAGGGAGTTCCTGGCTGG - Intergenic
1178037824 21:28604255-28604277 CCTCTCAGGGAGTGAGGGGCTGG + Intergenic
1178232688 21:30804851-30804873 CCTGTCAGGGAGTGGGGGGCAGG + Intergenic
1178602031 21:34002833-34002855 CCTTCCAGGCAGTGGCTTTCAGG - Intergenic
1178765121 21:35443257-35443279 GATTCCAGGGAGTGGGCAGCAGG + Intronic
1179521716 21:41949981-41950003 CCTGTCAGGGACTGGGCGGCTGG + Intronic
1180158587 21:45989334-45989356 CCTGCCAGGGAGGGGCTGGGTGG + Intronic
1180158998 21:45990665-45990687 CTTTCCAGGGAGGGTGTGGAGGG + Intronic
1180244899 21:46540384-46540406 CCTCCCGGGAGGTGGGTGGCCGG - Intronic
1180736664 22:18022758-18022780 CCTTGTAGTGAGTGGGTGGTGGG + Intronic
1181667409 22:24407651-24407673 CCTTGCAGGGAGAGGGGGCCAGG - Intronic
1181961471 22:26625008-26625030 CCTGCCAGGGTGTGGGAGACGGG - Intronic
1182447604 22:30398504-30398526 CCTACCAGGGAGTGAGAGGTTGG + Intronic
1182619291 22:31609985-31610007 CCTTAGAGGGAGGCGGTGGCAGG + Intronic
1183186063 22:36292315-36292337 CCTTCCACGGTGTGGCAGGCAGG - Intronic
1183355076 22:37354219-37354241 CCCTCGAGGGAGAGGCTGGCAGG + Intergenic
1184270079 22:43375467-43375489 CCTGCCAGGGAGTGGTTGAGAGG + Intergenic
1184372557 22:44091878-44091900 CCTTCGGGGGAGTGGGTAACTGG + Intronic
1184387706 22:44185824-44185846 CCTTCCGGGAAGTGGGTGGCAGG - Exonic
1184572481 22:45334845-45334867 TCTTCCAGGGAGTGTGGGGGTGG - Intronic
1184613729 22:45623454-45623476 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1203251843 22_KI270733v1_random:122621-122643 CCTTCCCCGGAGTGGGGGGTTGG + Intergenic
1203259894 22_KI270733v1_random:167704-167726 CCTTCCCCGGAGTGGGGGGTTGG + Intergenic
949701212 3:6761403-6761425 CCTGTCAGGGCGTGGGTGTCAGG - Intergenic
950014832 3:9748161-9748183 CCATGCATGGAGTGAGTGGCAGG + Intergenic
950152123 3:10695997-10696019 CCTTACTCAGAGTGGGTGGCTGG - Intronic
950563329 3:13748790-13748812 CTTTCCTGGGGGTGGCTGGCAGG + Intergenic
950670797 3:14524307-14524329 CCCACCAGGGCCTGGGTGGCAGG - Intronic
950710950 3:14812289-14812311 CTTTCCAAGCAGTGGCTGGCTGG - Intergenic
951204184 3:19909031-19909053 CCTTGTAGGGGGTGGGGGGCGGG - Intronic
951806526 3:26650346-26650368 ACTTCCAGGATGTGGGTTGCTGG + Intronic
952457118 3:33483805-33483827 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
952899176 3:38098255-38098277 CCTTCCAGAGAGTGGGGAGGAGG - Intronic
952959320 3:38579741-38579763 CCTTCCAGGGAGTCTGGGGAGGG - Intronic
954894372 3:53963450-53963472 CCTTCAAGGGGGCGGGTGTCAGG + Intergenic
955101137 3:55851193-55851215 CCATGCTGGGAGTTGGTGGCAGG + Intronic
956707440 3:72011509-72011531 CCACCCAGGGAGTCTGTGGCTGG - Intergenic
956920566 3:73924269-73924291 CATTCCAGGGAGTGGAAGTCAGG + Intergenic
960140895 3:114151026-114151048 CCTCCCAAGAAGTGGGTAGCAGG - Intronic
961363633 3:126384896-126384918 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
963878786 3:150504555-150504577 CATTCCAGGGAAATGGTGGCTGG + Intergenic
964264697 3:154880979-154881001 CCTGTCAGGGAGTGGGGGGCTGG + Intergenic
965256968 3:166425689-166425711 GCTGCCAGGGAATGGGAGGCGGG - Intergenic
965739526 3:171859143-171859165 CCTTTCAGTGGGTGGGAGGCTGG + Exonic
966215639 3:177499416-177499438 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
966382328 3:179356240-179356262 CCTTCCTGGAAATGGGTGGGTGG - Intronic
967857804 3:194131441-194131463 CCTTCCGGGGCGGGGGTGGGGGG + Intergenic
968468286 4:764193-764215 CCATGCAGGGTGTTGGTGGCAGG + Intronic
968810554 4:2797821-2797843 CCTGCCCAGGAGTGGGAGGCTGG - Intronic
969153352 4:5188856-5188878 CCTGTCAGGGGGTGGGGGGCTGG + Intronic
969690344 4:8700828-8700850 CCCACCAGGGAGGGGGTGGCTGG - Intergenic
969882723 4:10188530-10188552 CCTCCCAGGGTCTGGCTGGCTGG + Intergenic
972178243 4:36434237-36434259 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
972397951 4:38673264-38673286 CCCTGCAGGGAGTGGGAGGTTGG - Intronic
972405127 4:38738268-38738290 CCTTCCAGGGGGTGGGGCGAGGG + Intergenic
972868176 4:43260364-43260386 CCTTTCAGGGAGTTGGGGGAAGG - Intergenic
973097576 4:46222361-46222383 CCTGTCAGGGAGTGGGGGGTTGG - Intergenic
973678750 4:53293878-53293900 CCTGTCAGGGGGTGGGAGGCTGG - Intronic
973700102 4:53528771-53528793 CCTTCCAGGGAGATGGTGCCAGG - Intronic
973782561 4:54301932-54301954 CCTGTCAGGGGGTGGGGGGCCGG + Intergenic
974806875 4:66891957-66891979 CCTTTCAGAGGGTGGGAGGCGGG + Intergenic
975087172 4:70355908-70355930 CCTGTCAGGGGGTGGGTGGCTGG + Intergenic
975641630 4:76506221-76506243 CCTGTCAGGTAGTGGGGGGCTGG + Intronic
976938345 4:90667490-90667512 CCTGTCAGGGAGTGGGGGGCTGG - Intronic
977961742 4:103093169-103093191 CCTGCCAGAGACTGGGTTGCTGG + Intronic
978007193 4:103631170-103631192 CCTGTCGGGGTGTGGGTGGCTGG + Intronic
978329504 4:107597387-107597409 CCTGTCAGGGGGTGGGGGGCTGG + Intronic
978912835 4:114084700-114084722 CCTTTCAGGGTGTGGGCAGCTGG + Intergenic
979311103 4:119203976-119203998 CCTGTCAGGGGGTGGGGGGCTGG + Intronic
980335953 4:131473703-131473725 CCTATCAGGGAGTTGGGGGCAGG - Intergenic
981748021 4:148069381-148069403 CCTTCCAGGGAGGGGAGGGCTGG + Intronic
981781036 4:148429097-148429119 TCTTGCAGGGAGTGGGTAGTGGG - Intronic
981906399 4:149925988-149926010 CCTTTCAGAGAGTGGGGGGAAGG - Intergenic
983135416 4:164073489-164073511 CCTGTCAGGGAGTGGGGGGCAGG + Intronic
983753895 4:171310135-171310157 CCTGTCAGGGGGTGGGTGGCTGG - Intergenic
985044231 4:185924245-185924267 ACTGCCAGGGAGTGAGTGGGTGG + Intronic
985065690 4:186118820-186118842 CCTCCCAGGCAGTGGGTGCTTGG - Intronic
985233441 4:187846847-187846869 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
985240847 4:187929612-187929634 GTTTCCAGGCAGTGGGTGACAGG + Intergenic
985776541 5:1847173-1847195 CCTCACAGGGAGTGCGGGGCAGG - Intergenic
985782547 5:1878678-1878700 CCGTCCAGGGAGTGGAAGGGCGG + Exonic
987853124 5:23382646-23382668 CCTTTCAGGGGGTGGGGGTCTGG + Intergenic
988612284 5:32738285-32738307 CCTATCAGGGGGTGGGGGGCAGG - Intronic
992346976 5:75889248-75889270 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
992570460 5:78050109-78050131 CCTTCCAGGTAGAGGGTCCCAGG - Intronic
992776475 5:80093515-80093537 ACTTCCAGGGAGCAGGGGGCAGG + Intergenic
993163514 5:84319994-84320016 CCTGTCAGGGGGTGGGTGCCTGG + Intronic
994353373 5:98770302-98770324 CCTTCTTGGGAGCGAGTGGCTGG + Intronic
994712472 5:103282456-103282478 ACTTCTAGGGAGTGGGGGGAAGG - Intergenic
995745039 5:115394088-115394110 TATTCCATGGAGTGGGAGGCTGG + Intergenic
995810558 5:116102814-116102836 CCTGTCAGGGTGTGGGGGGCTGG - Intronic
996061892 5:119041442-119041464 ACCTCCAGGAACTGGGTGGCTGG + Intronic
996830258 5:127732834-127732856 CCTGCAAGGGTGAGGGTGGCAGG + Intergenic
997695356 5:135857007-135857029 CCTTCCAGGGACAAGGTGCCAGG - Intronic
998133082 5:139660866-139660888 CCTCCCAGCCAGTGGGTGGGTGG - Intronic
998399612 5:141841709-141841731 CCTTCCAAGGGGTGGGGGCCGGG + Intergenic
999194197 5:149771066-149771088 CCTTGAAGGAATTGGGTGGCTGG + Intronic
999231551 5:150065044-150065066 TCTTCCTGGGAGTGGGGCGCTGG + Intronic
999410609 5:151346743-151346765 CTTTCCAGGGAGTGGGGAGTGGG - Intronic
1000214843 5:159145530-159145552 CCTGTCAGGGGGTGGGTGGCTGG + Intergenic
1001978586 5:176021467-176021489 CCCTCCAGGGAGGTGGTGCCTGG + Intronic
1002019918 5:176356935-176356957 GTTGCCAGGGAGTGGGTGGGGGG + Intronic
1002238831 5:177822295-177822317 CCCTCCAGGGAGGTGGTGCCTGG - Intergenic
1002350181 5:178577608-178577630 CCATCCAGGCAGCGGGGGGCAGG - Intronic
1003194877 6:3905918-3905940 ATTTCCAGGGAGGAGGTGGCTGG - Intergenic
1003264361 6:4552486-4552508 GCTTCTTGGGAGTAGGTGGCTGG - Intergenic
1006385021 6:33726120-33726142 CCTTCCTGCAAATGGGTGGCTGG - Intronic
1006410236 6:33869339-33869361 CAATCCAGGTAGTGGGTGGATGG + Intergenic
1006719109 6:36138722-36138744 CCTTCCTGGGGGTCTGTGGCAGG - Exonic
1007041689 6:38727849-38727871 TTTTCCAGTGACTGGGTGGCAGG + Intronic
1008812449 6:55520091-55520113 CCTGTCAGGGGGTGGGGGGCGGG + Intronic
1009987610 6:70800664-70800686 CCTGTCAGGGGGTGGGGGGCTGG - Intronic
1012111048 6:95234108-95234130 ACTTCAAGGCTGTGGGTGGCCGG - Intergenic
1013352577 6:109318799-109318821 CCTTCAATGCAGTGGGGGGCAGG + Intergenic
1013692942 6:112667422-112667444 TGTTCCATGGAGTGGGAGGCCGG - Intergenic
1013759311 6:113498361-113498383 TCTTCCAGGTAGTTGCTGGCAGG + Intergenic
1013983080 6:116156935-116156957 CTTGCCAGGGAGTGAGTGGCTGG - Intronic
1014951714 6:127563485-127563507 CCTGTCAGGGGGTGGGGGGCTGG - Intronic
1014968877 6:127790841-127790863 CCTTGCAGGGAGCTGGTGCCTGG - Intronic
1015408846 6:132868976-132868998 TCTTCCAGGGAGTCTGTGTCTGG - Intergenic
1016102603 6:140120730-140120752 CCTCTCAGGGAGTGGGGGTCTGG + Intergenic
1016528448 6:145030969-145030991 CCTTCCAGGGGTGGGGTGGAAGG - Intergenic
1016614224 6:146028366-146028388 CCTGCCAGGGAATGTCTGGCTGG + Intronic
1017497674 6:154995676-154995698 CCCTCCGGGGAGAGGGTGCCAGG - Intronic
1018073754 6:160191206-160191228 CTTCACAGGGAGTGGGTGGGAGG - Intronic
1018177023 6:161186131-161186153 CCTCCCAAGAAGTGGGGGGCTGG - Intronic
1018427199 6:163694219-163694241 CCTCACAGGGAGGAGGTGGCTGG + Intergenic
1019367900 7:644681-644703 CCCACCAGGGCCTGGGTGGCTGG + Intronic
1019406996 7:889128-889150 CCGTCCAGGGAGTGCATGGGAGG + Intronic
1020933244 7:14427088-14427110 CCTGTCAGGGAGTGGGGGGTGGG + Intronic
1021064249 7:16154123-16154145 CATTACAAGGAGTGGGAGGCAGG - Intronic
1021463324 7:20913395-20913417 TCCTCCCAGGAGTGGGTGGCTGG - Intergenic
1022221972 7:28322594-28322616 CCTGTCGGGGAGTGGGGGGCTGG - Intronic
1022413187 7:30155182-30155204 CCTGACAGGGAGTGGCTGCCTGG - Intronic
1022484264 7:30765804-30765826 CCTCCCAGGGACTGGCTGTCAGG - Intronic
1022520089 7:31000556-31000578 CCTTCCAGGCTGGGGGTAGCAGG + Intergenic
1022539808 7:31125137-31125159 TTTTCCAGGGACTGGGTGGCAGG + Intergenic
1022901966 7:34819914-34819936 CCTGTCAGGGAGTGAGGGGCTGG + Intronic
1023340796 7:39217322-39217344 GCTGGCAGGGAGTGGGTGGGTGG + Intronic
1023752352 7:43384762-43384784 CGTGAGAGGGAGTGGGTGGCTGG + Intronic
1024093684 7:45967991-45968013 CCGCCCAGGGAGTGGGAGTCAGG - Intergenic
1024591765 7:50892381-50892403 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1024896229 7:54265440-54265462 GCTTCCAGGGACTGGGTTCCTGG - Intergenic
1025636637 7:63325708-63325730 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1025646059 7:63422394-63422416 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1026803051 7:73411872-73411894 TCTCCCAGGGACTGGGTGTCGGG + Intergenic
1026852672 7:73734976-73734998 CCTGCCAGGGAGTGCCTTGCTGG + Intergenic
1028128893 7:87147249-87147271 CCATCCCGGGAGTGGTGGGCTGG - Intergenic
1028316221 7:89406066-89406088 CCTGTCAGGGAGTGGGGGGCAGG - Intergenic
1028368469 7:90063090-90063112 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1028837289 7:95388932-95388954 CCTGTCAGGGTGTGGGGGGCTGG + Intronic
1029960342 7:104683612-104683634 GCTTCCAGGAAGTGGGTTCCAGG + Intronic
1030112444 7:106038370-106038392 CCTTCCAGGCAGTGAGTGCAAGG + Intergenic
1030464990 7:109889791-109889813 CCTGTCAGGGAGTGGGGGCCTGG + Intergenic
1031178035 7:118377410-118377432 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1031538810 7:122967612-122967634 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1034039563 7:147863078-147863100 CCTGTCAGGGAGTGGGGGCCTGG - Intronic
1034235984 7:149569897-149569919 CCCGCTAGGGAGTGGCTGGCGGG - Intergenic
1034535853 7:151725225-151725247 CCTTCGTGTGTGTGGGTGGCGGG - Intronic
1034940045 7:155224791-155224813 CCATCCAGGGAGGGGCTGGGAGG + Intergenic
1035582865 8:751021-751043 CCTTTCCGTGAGAGGGTGGCCGG - Intergenic
1035582875 8:751061-751083 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035582885 8:751101-751123 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035582895 8:751141-751163 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035582905 8:751181-751203 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035582915 8:751221-751243 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035582925 8:751261-751283 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035582934 8:751301-751323 CCTTTCCGTGAGAGGGTGGCCGG - Intergenic
1035852422 8:2933766-2933788 CCTGGCAGGGAGTGGGTTGACGG + Intergenic
1037720215 8:21437333-21437355 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1037820471 8:22132539-22132561 CCAGCCTGGGAGTGGGAGGCCGG - Intronic
1038750901 8:30294891-30294913 CCTGTCGGGGGGTGGGTGGCTGG - Intergenic
1039712389 8:40068877-40068899 CCTGTCAGGGGGTGGGGGGCAGG + Intergenic
1039984576 8:42436724-42436746 GCTTCCAGGGAAGGGCTGGCCGG - Intronic
1040603787 8:48910141-48910163 ACTTCCAGGAGGTGGGTGGGAGG - Intergenic
1041214583 8:55587005-55587027 CCTTCCAGGGAGTGAAGAGCAGG - Intergenic
1041369177 8:57142155-57142177 CCTTCCAGGCGGTGGGAGGTGGG - Intergenic
1044632767 8:94295480-94295502 CCTGTCAGGGGGTGGGAGGCAGG + Intergenic
1046423183 8:114011551-114011573 CCTAGCAGGAAGTGAGTGGCGGG - Intergenic
1049358697 8:142201614-142201636 CCTTCCAGGGGGAGGCTGGGGGG - Intergenic
1049415204 8:142491881-142491903 CCTGACAGGGAGAGGGAGGCAGG + Intronic
1049501886 8:142971454-142971476 CCTAGCAGGGTGTGGGTGGGAGG + Intergenic
1049624154 8:143612641-143612663 GCTCCCAGGGAGTGGGATGCAGG + Exonic
1049803437 8:144528619-144528641 CGTTCCAGGGGGTGGGTGGGTGG - Intronic
1050071552 9:1820287-1820309 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1050181458 9:2927368-2927390 CCTGTCAGGGAGTGGGAGGTAGG + Intergenic
1050352298 9:4751916-4751938 TCTTCCCGGGAGTGGGGGTCAGG + Intergenic
1050552139 9:6758004-6758026 CCGTCGAGGGGGTGGGTGGGAGG - Intronic
1050699635 9:8324248-8324270 CCTGCCAGGGGGTGGGGGCCTGG - Intronic
1051302821 9:15671506-15671528 CCTGGCAGGGGGTGGGGGGCTGG - Intronic
1051985930 9:23086923-23086945 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1052020553 9:23520677-23520699 CCTGTCAGGGAGTAGGGGGCTGG + Intergenic
1052217852 9:25988568-25988590 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1053149230 9:35732299-35732321 CCTGCCAGGGAGGGGCTGCCGGG - Exonic
1053401241 9:37825565-37825587 CCTTCCAGAGAGTGGAGGGTGGG + Intronic
1053874992 9:42535064-42535086 CCTTCCAAGAAGTGACTGGCAGG - Intergenic
1053897638 9:42759545-42759567 CCTTCCAAGAAGTGACTGGCAGG + Intergenic
1054890541 9:70246309-70246331 CCTGCCAGGGGGTGGGGGGCTGG + Intergenic
1055296030 9:74834606-74834628 CCTGTCAGGGGGTGGGGGGCTGG - Intronic
1055624771 9:78165180-78165202 CCTGTCAGGGAGTGGGAAGCTGG - Intergenic
1056095363 9:83247958-83247980 CCCCTCAAGGAGTGGGTGGCTGG - Exonic
1056831769 9:89923129-89923151 CCTTCCAGGAGGTGGGTGAGGGG + Intergenic
1056945599 9:90993337-90993359 CCTGTCAGGGAATGGGGGGCTGG - Intergenic
1057942519 9:99297362-99297384 ACCTCCAGAGAGTGGGGGGCAGG + Intergenic
1057949250 9:99356731-99356753 CCTGCCAGGGAGAGGGCAGCAGG + Intergenic
1058677172 9:107410200-107410222 CAGTCCAGGGAGAGGCTGGCTGG + Intergenic
1059421463 9:114195100-114195122 GCTTCCAGGGTGTGTGTGCCTGG - Intronic
1059718374 9:116934607-116934629 CCTTTCAGGGAGTGGAAGGTGGG + Intronic
1060232154 9:121833371-121833393 CCTTCCCGGGAGTGGAGAGCAGG - Intronic
1060775655 9:126372045-126372067 GCTGCCAGGGACTGGGGGGCAGG - Intronic
1061401399 9:130370316-130370338 CGTGCCAGGCAGAGGGTGGCTGG + Intronic
1061406191 9:130394181-130394203 GCCTGCGGGGAGTGGGTGGCCGG + Intronic
1061623272 9:131825171-131825193 GGTTCCAGGGAGGGGCTGGCGGG + Intergenic
1061625546 9:131838880-131838902 GCCTCGAGGGAGTGAGTGGCTGG + Intergenic
1061797824 9:133098558-133098580 CCTCCCAGGGTCTGGCTGGCTGG - Exonic
1062103645 9:134740981-134741003 CCTTCCAGTGAGAGGGGTGCTGG + Intronic
1062208170 9:135348638-135348660 CCTGCCAGGGAGGGGGGGGCGGG - Intergenic
1062261723 9:135666247-135666269 CCTTCCCGGGAGCTGGTGGAGGG - Intronic
1062306283 9:135908404-135908426 GCTTCCAGGGAGCGGGCGCCCGG + Intergenic
1062353403 9:136150048-136150070 GCTTCCAGGGTGAGGGTGGCCGG - Intergenic
1062360132 9:136183707-136183729 CCTAACAGGAAGTGGGGGGCAGG + Intergenic
1062390737 9:136332734-136332756 CCTGGCAGGTAGTGGGTGGGAGG + Intronic
1062391682 9:136336377-136336399 CCCCCCAGGGAGTGAGTGACTGG - Intronic
1062458695 9:136653789-136653811 GCTGGCAGGGAGTGGGTGCCCGG + Intergenic
1062717317 9:138017765-138017787 CCCTCCAGGGAGTGACTGGCTGG + Intronic
1203468245 Un_GL000220v1:105772-105794 CCTTCCCCGGAGTGGGGGGTTGG + Intergenic
1203476066 Un_GL000220v1:149744-149766 CCTTCCCCGGAGTGGGGGGTTGG + Intergenic
1185516339 X:701760-701782 CCCTACAAGGAGTGGGTGGTGGG + Intergenic
1186867044 X:13730910-13730932 CCTGTCAGGGGGTGGGGGGCTGG + Intronic
1187941656 X:24388441-24388463 CCTGGCAGGGAGTGGGCTGCAGG - Intergenic
1188178287 X:27021933-27021955 CCTGTCAGGGAGTGGGGGGCTGG - Intergenic
1188510712 X:30933630-30933652 CCCTCCAGGGATCGGGTAGCAGG + Intronic
1189501828 X:41568082-41568104 CCTGTCAGGGGGTGGGGGGCTGG + Intronic
1190879244 X:54481154-54481176 CCTTCCAGGGAGTGGGAGATAGG - Intronic
1191043590 X:56112325-56112347 CCTGCCATGGAGTGGGGGGCTGG + Intergenic
1191175020 X:57490314-57490336 CCTGTCAGGGAGTGGGGGGAGGG - Intergenic
1191646249 X:63484308-63484330 CCTGTCAGGGGGTGTGTGGCTGG + Intergenic
1192031204 X:67514307-67514329 CCTGTCAGGGAGAGGGGGGCTGG + Intergenic
1193589959 X:83376810-83376832 CCTGTCAGGGGGTGGGTGCCTGG + Intergenic
1194052627 X:89090680-89090702 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1194056927 X:89146426-89146448 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1196115312 X:111993049-111993071 CCTGTCAGGGGGTGGGGGGCTGG - Intronic
1197576356 X:128216937-128216959 CCTGTCAGGGAGTGGGGGGCTGG + Intergenic
1199840193 X:151638287-151638309 CCTTTTGGGGAGTGGGGGGCTGG + Intronic
1199979980 X:152915525-152915547 CCCTGCAGGGAATGGGTGGGAGG - Intronic
1200236358 X:154469608-154469630 CCCTCCTGGGTGTGGGTGGGTGG + Intronic
1200370845 X:155722930-155722952 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1201145392 Y:11062320-11062342 CCTGCTGGGGAGTGGGTGGCAGG - Intergenic
1202113224 Y:21446243-21446265 CCTGCCAGGCAGTGTGGGGCTGG - Intergenic