ID: 1084741158

View in Genome Browser
Species Human (GRCh38)
Location 11:71140422-71140444
Sequence CAGGGTAATCTTCCCCTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 1, 2: 2, 3: 6, 4: 112}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084741158_1084741166 6 Left 1084741158 11:71140422-71140444 CCTGCAAGGGGAAGATTACCCTG 0: 1
1: 1
2: 2
3: 6
4: 112
Right 1084741166 11:71140451-71140473 AAAGCGTCAAACAGGCAGGGAGG 0: 1
1: 1
2: 1
3: 15
4: 141
1084741158_1084741164 2 Left 1084741158 11:71140422-71140444 CCTGCAAGGGGAAGATTACCCTG 0: 1
1: 1
2: 2
3: 6
4: 112
Right 1084741164 11:71140447-71140469 AAGGAAAGCGTCAAACAGGCAGG 0: 1
1: 0
2: 1
3: 6
4: 157
1084741158_1084741162 -2 Left 1084741158 11:71140422-71140444 CCTGCAAGGGGAAGATTACCCTG 0: 1
1: 1
2: 2
3: 6
4: 112
Right 1084741162 11:71140443-71140465 TGCCAAGGAAAGCGTCAAACAGG 0: 1
1: 0
2: 1
3: 36
4: 3417
1084741158_1084741169 16 Left 1084741158 11:71140422-71140444 CCTGCAAGGGGAAGATTACCCTG 0: 1
1: 1
2: 2
3: 6
4: 112
Right 1084741169 11:71140461-71140483 ACAGGCAGGGAGGCAGGGTCCGG 0: 1
1: 1
2: 8
3: 109
4: 970
1084741158_1084741165 3 Left 1084741158 11:71140422-71140444 CCTGCAAGGGGAAGATTACCCTG 0: 1
1: 1
2: 2
3: 6
4: 112
Right 1084741165 11:71140448-71140470 AGGAAAGCGTCAAACAGGCAGGG 0: 1
1: 0
2: 2
3: 10
4: 170
1084741158_1084741172 30 Left 1084741158 11:71140422-71140444 CCTGCAAGGGGAAGATTACCCTG 0: 1
1: 1
2: 2
3: 6
4: 112
Right 1084741172 11:71140475-71140497 AGGGTCCGGCCGGGTGTAGAAGG 0: 1
1: 0
2: 0
3: 5
4: 64
1084741158_1084741171 21 Left 1084741158 11:71140422-71140444 CCTGCAAGGGGAAGATTACCCTG 0: 1
1: 1
2: 2
3: 6
4: 112
Right 1084741171 11:71140466-71140488 CAGGGAGGCAGGGTCCGGCCGGG 0: 1
1: 1
2: 6
3: 57
4: 583
1084741158_1084741170 20 Left 1084741158 11:71140422-71140444 CCTGCAAGGGGAAGATTACCCTG 0: 1
1: 1
2: 2
3: 6
4: 112
Right 1084741170 11:71140465-71140487 GCAGGGAGGCAGGGTCCGGCCGG 0: 1
1: 0
2: 4
3: 64
4: 616
1084741158_1084741167 10 Left 1084741158 11:71140422-71140444 CCTGCAAGGGGAAGATTACCCTG 0: 1
1: 1
2: 2
3: 6
4: 112
Right 1084741167 11:71140455-71140477 CGTCAAACAGGCAGGGAGGCAGG 0: 1
1: 1
2: 2
3: 25
4: 275
1084741158_1084741168 11 Left 1084741158 11:71140422-71140444 CCTGCAAGGGGAAGATTACCCTG 0: 1
1: 1
2: 2
3: 6
4: 112
Right 1084741168 11:71140456-71140478 GTCAAACAGGCAGGGAGGCAGGG 0: 1
1: 1
2: 2
3: 51
4: 586

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084741158 Original CRISPR CAGGGTAATCTTCCCCTTGC AGG (reversed) Intronic
900790744 1:4678594-4678616 TAGGGTACTCTCTCCCTTGCTGG - Intronic
901492677 1:9604538-9604560 CAGGGAACTCTTCTCCTCGCGGG + Intronic
902414281 1:16229947-16229969 CAGGGCAGTCTTCTCCTGGCTGG - Intergenic
906512583 1:46419149-46419171 CAGGTTAATCATGGCCTTGCAGG - Intergenic
906716009 1:47969828-47969850 CAGGGGAAACATCACCTTGCTGG - Intronic
907322639 1:53615215-53615237 CTGGGTATCCTTCCCCTTGGTGG + Intronic
912489807 1:110056090-110056112 CAGGGTAATCTGTCCCTCGGTGG - Intronic
920535771 1:206735743-206735765 CAGGATAATCTCCTCATTGCAGG + Intergenic
920868992 1:209777484-209777506 CAAGGTACTCTTCTCCTTGGAGG + Exonic
920871186 1:209796504-209796526 CAGGGTCATCCACCCCTTCCTGG + Exonic
922338107 1:224634075-224634097 GTGGGTAGTCATCCCCTTGCAGG - Intronic
922996018 1:229962314-229962336 CAGGCTGATATTCTCCTTGCAGG - Intergenic
923667938 1:236015146-236015168 CAGGGTAACCTTCCCAGTGCAGG + Intronic
1063284515 10:4670927-4670949 CAGGGTGATGCTCCCCTTGAAGG + Intergenic
1065915592 10:30352068-30352090 TAGAGTATTCCTCCCCTTGCTGG - Intronic
1067578724 10:47425763-47425785 CAGGGAAATCTCCCCCATCCAGG + Intergenic
1074451267 10:113561618-113561640 CAGAGAAATCTTCTGCTTGCTGG - Intronic
1075448763 10:122532409-122532431 CAGGGTAATTTTCCCTTTATTGG + Intergenic
1078104186 11:8348186-8348208 CAGGGGAAGTTCCCCCTTGCAGG - Intergenic
1079137162 11:17782043-17782065 CAGGGTAATCATACAGTTGCAGG - Exonic
1084741158 11:71140422-71140444 CAGGGTAATCTTCCCCTTGCAGG - Intronic
1087116324 11:94528860-94528882 CAGGGTAATCTCCCAATTGTAGG - Intergenic
1091168441 11:133500647-133500669 CCGGGTAATTCTCCCCGTGCAGG - Intronic
1091625726 12:2119400-2119422 CCTGGGAAGCTTCCCCTTGCTGG + Intronic
1094493732 12:30976852-30976874 CAGGGTCAGATGCCCCTTGCGGG - Intronic
1095053035 12:37571215-37571237 CACTGTAATCTTCACCTTCCAGG + Intergenic
1104341267 12:127951588-127951610 CAGGGTAATGTTCTCATTCCAGG - Intergenic
1107237585 13:38191417-38191439 CAGGATAATCTCCCTATTGCAGG + Intergenic
1107630969 13:42342551-42342573 CCAGGTAATCTTCCACTGGCAGG + Intergenic
1111152584 13:84275842-84275864 CTGGATAATCTTCCAATTGCTGG + Intergenic
1112458535 13:99583287-99583309 GGGGATTATCTTCCCCTTGCTGG - Intergenic
1120564020 14:86032324-86032346 CAGGGTAATCTCTCCCATGTTGG + Intergenic
1122598687 14:102910042-102910064 CAGGCCAATCCTCCCCGTGCAGG - Exonic
1122684534 14:103494710-103494732 CATGGCAATCTTCGCCTTCCAGG + Intronic
1122859000 14:104573903-104573925 CAGGGGAATCCTCTCCTTGCAGG - Intronic
1122873870 14:104653986-104654008 CTGGATAATATTCCCCTTGATGG - Intergenic
1128705577 15:69835408-69835430 CAGGCTATTCTGGCCCTTGCCGG - Intergenic
1129908115 15:79204006-79204028 CAGGGAAATCATTTCCTTGCTGG - Intergenic
1133113726 16:3564475-3564497 CAGGGTGGTCTTGCCCATGCCGG + Exonic
1133178876 16:4037386-4037408 CAGGGTTTTGTTCCCCTTGATGG + Intronic
1138705679 16:58912741-58912763 CAGGGTTTTCTTCACCTTGGGGG + Intergenic
1139918024 16:70439815-70439837 CCGGGGCATCTCCCCCTTGCAGG + Intergenic
1145373555 17:22327242-22327264 CACTGTAATCTTCACCTTCCAGG + Intergenic
1153028038 18:688846-688868 CAGTGCTATCTTCCCCTTCCGGG - Intronic
1157089949 18:44625565-44625587 CAGGGTAATCTTACCCCTCCAGG + Intergenic
1162026963 19:7899938-7899960 CAGGCTACCCTTCTCCTTGCAGG + Exonic
1164542149 19:29129116-29129138 CATGGACATCTTCCCCCTGCAGG - Intergenic
1165143300 19:33715654-33715676 CAGGCTGACCTTCACCTTGCTGG + Intronic
1165569991 19:36767651-36767673 CACTGTAATCTTCACCTTTCAGG - Intronic
1166462824 19:43004331-43004353 CACTGCAATCTCCCCCTTGCAGG - Intronic
925977666 2:9152307-9152329 CAGGGTACTCTGCCTCTTCCAGG + Intergenic
926155953 2:10454167-10454189 CAGGGTACCCTACCCCTTGGAGG - Intergenic
926273124 2:11382680-11382702 CAGTCTAGTCTTCCCATTGCAGG + Intergenic
928239627 2:29575228-29575250 CAGGGTAATTTTTACATTGCTGG - Intronic
936647171 2:114385236-114385258 CAGTGTAATATTCCTATTGCTGG - Intergenic
937816267 2:126254025-126254047 CAGAGGACTCATCCCCTTGCAGG - Intergenic
940201303 2:151153828-151153850 CAGGGCTATTTTCCCCTTCCAGG - Intergenic
940649562 2:156428035-156428057 CAGGGTAATCTCTCCATTTCAGG + Intergenic
941363447 2:164581325-164581347 CAGGGTAATCTTCCCTGATCAGG - Intronic
946585666 2:221184776-221184798 CAGGATAATCTTTCCATTTCAGG - Intergenic
1171183282 20:23106724-23106746 CAGGGCCAGCTTCGCCTTGCTGG + Intergenic
1171529238 20:25841165-25841187 CACTGTAATCTTCACCTTCCAGG - Intronic
1171547588 20:26014720-26014742 CACTGTAATCTTCACCTTCCAGG + Intergenic
1175394619 20:58650186-58650208 CAGGGCCGGCTTCCCCTTGCGGG - Intergenic
1179820300 21:43933313-43933335 CAGGGTTTTCTCTCCCTTGCGGG + Intronic
1182121094 22:27787481-27787503 CAGGGAAATCTTCCTCTTGCTGG + Intronic
1182432673 22:30309523-30309545 CAGGGCAATCTGCCATTTGCTGG + Intronic
1183654043 22:39174954-39174976 GAGGGCATTCTTCCCCTTCCCGG - Intergenic
952565486 3:34652432-34652454 CAGGGTCATTTACACCTTGCTGG + Intergenic
956927857 3:74008754-74008776 CAAGGAAATCTTCCACTAGCAGG - Intergenic
958437967 3:94121398-94121420 CAGGATAATCTCCCCATTGCAGG + Intronic
958506693 3:94988185-94988207 CAGGGAAATCTTCCGCTTGCGGG + Intergenic
958640599 3:96800294-96800316 CAGGGAATTCTTTCCTTTGCTGG + Intergenic
965441432 3:168720096-168720118 CAGGCTAATCTTCCCATCTCTGG + Intergenic
966300914 3:178478999-178479021 CAGGGTAATTGTTCCCTTGTTGG - Intronic
972347594 4:38205868-38205890 CATGGTACTCTTGCCCTTTCTGG + Intergenic
972995330 4:44871802-44871824 CAGGAAAATCTTCACCTGGCTGG - Intergenic
975655499 4:76637467-76637489 CAGAGTAATCTTCCCTTTTGAGG - Intronic
976379031 4:84378713-84378735 CAAGTTAATCTTCCCTTTGGGGG + Intergenic
978371273 4:108031594-108031616 CAGGATTATCTTCACCTTCCAGG + Intronic
979240431 4:118442642-118442664 CAGGATAATTTACCCCCTGCAGG + Intergenic
993078743 5:83269753-83269775 CAGCGGAATCTTCCCCTTTTTGG + Intronic
993455825 5:88126032-88126054 CAGGGAAATCTTGCCCTTCTAGG - Intergenic
993871470 5:93259730-93259752 CAGGGTCATTTACGCCTTGCAGG - Intergenic
995458911 5:112381902-112381924 CTGGGTAACCTCCCCCTTTCAGG + Intronic
997771136 5:136555686-136555708 CAGTTAAATCTTCCCATTGCAGG - Intergenic
999531727 5:152470500-152470522 CAGGGTCATCTTCCCATCTCAGG - Intergenic
1002923098 6:1587095-1587117 CAGGGTCATTTTTCCCTTGGGGG - Intergenic
1005148182 6:22716711-22716733 CAGGTTATTCTTCCAGTTGCAGG - Intergenic
1005925059 6:30437210-30437232 CAGGGTAATACTGCCCTTGTAGG - Intergenic
1009320603 6:62284001-62284023 CAGGGCATGCTTCCCCCTGCTGG + Intronic
1013555918 6:111257489-111257511 CAGGAAATTCATCCCCTTGCAGG - Intergenic
1013834980 6:114323981-114324003 CAGGGTCTTCTTCCCCCTGCTGG + Intronic
1016000060 6:139032923-139032945 CAGGGTAAGCTCCCCTCTGCAGG - Intronic
1016882063 6:148921207-148921229 CATGGAACTCTTCCCCTTCCAGG - Intronic
1018086103 6:160302482-160302504 CAGGACATTCTTCCCCTTCCAGG - Intergenic
1018918056 6:168150073-168150095 CAGGGTGATATTCCTCTTGGTGG + Intergenic
1019380256 7:717965-717987 CAGGGGACTCTCTCCCTTGCTGG + Intronic
1022596651 7:31719312-31719334 CAGGAAAATCTGCCCCTAGCTGG + Intergenic
1022606090 7:31815635-31815657 CATGGTAATTTTCCCCCAGCTGG + Intronic
1024728806 7:52231705-52231727 CAGGGTCATCCTCCCTCTGCAGG - Intergenic
1026148217 7:67766602-67766624 CAGGGCAATCTTCCTCATGAGGG - Intergenic
1027235586 7:76295732-76295754 CTGGGAAGTCTCCCCCTTGCTGG + Intergenic
1028723895 7:94065294-94065316 CAGGATAATCTTCCTATTTCAGG + Intergenic
1029927649 7:104334469-104334491 CAGTGTAACCTCCGCCTTGCGGG - Intronic
1030407938 7:109138476-109138498 CAGGGTAATATTACCCTTATAGG + Intergenic
1035422856 7:158743532-158743554 CAGGGCAATCTTCATCTTGATGG + Exonic
1038094092 8:24287893-24287915 CTGGGTAGTCTTCCCATGGCAGG + Intergenic
1044589646 8:93901494-93901516 CAGGGTGATCTTTTCCTTGCTGG + Intronic
1049953292 9:666950-666972 CAGGGTAATGCCCGCCTTGCCGG + Intronic
1053186344 9:36019822-36019844 CTGTCTACTCTTCCCCTTGCTGG - Intergenic
1054147976 9:61577456-61577478 CACTGTAATCTTCACCTTCCAGG + Intergenic
1054652879 9:67639007-67639029 CACTGTAATCTTCACCTTCCAGG + Intergenic
1054754258 9:68941295-68941317 CAGGATAATCATCCCATTTCAGG - Intronic
1055001071 9:71448960-71448982 CAGGGTCATTTTCCCCTTCATGG - Intergenic
1058684420 9:107467733-107467755 AAAGGTAATCTCCCCCTTCCTGG - Intergenic
1060245438 9:121942002-121942024 CAGGTTATTCTTGCCCTTCCTGG - Intronic
1187665500 X:21604738-21604760 CAGGGTGATCTTTCCTTGGCAGG + Intronic
1190401618 X:50041841-50041863 CTGGGTAATCTTCACCTTTTGGG - Intronic
1194010919 X:88559865-88559887 CAAGGCATTCTTCCCTTTGCTGG + Intergenic
1195770504 X:108346106-108346128 CAAGGTAGTGTTCCCCATGCAGG - Intronic
1201145803 Y:11064921-11064943 CAGGGAAATCTTCCCCTTGCAGG - Intergenic