ID: 1084741607

View in Genome Browser
Species Human (GRCh38)
Location 11:71143434-71143456
Sequence CCCGATGCGCGGGTTCCCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 28
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 26}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084741599_1084741607 16 Left 1084741599 11:71143395-71143417 CCATGCTTTTCGCACAAAACAGC 0: 1
1: 0
2: 2
3: 8
4: 84
Right 1084741607 11:71143434-71143456 CCCGATGCGCGGGTTCCCACGGG 0: 1
1: 0
2: 0
3: 1
4: 26
1084741597_1084741607 24 Left 1084741597 11:71143387-71143409 CCCAAAATCCATGCTTTTCGCAC 0: 1
1: 0
2: 1
3: 28
4: 238
Right 1084741607 11:71143434-71143456 CCCGATGCGCGGGTTCCCACGGG 0: 1
1: 0
2: 0
3: 1
4: 26
1084741601_1084741607 -6 Left 1084741601 11:71143417-71143439 CCAAAGGTTTCAGCCTGCCCGAT 0: 1
1: 0
2: 0
3: 4
4: 66
Right 1084741607 11:71143434-71143456 CCCGATGCGCGGGTTCCCACGGG 0: 1
1: 0
2: 0
3: 1
4: 26
1084741596_1084741607 25 Left 1084741596 11:71143386-71143408 CCCCAAAATCCATGCTTTTCGCA 0: 1
1: 0
2: 2
3: 31
4: 274
Right 1084741607 11:71143434-71143456 CCCGATGCGCGGGTTCCCACGGG 0: 1
1: 0
2: 0
3: 1
4: 26
1084741598_1084741607 23 Left 1084741598 11:71143388-71143410 CCAAAATCCATGCTTTTCGCACA 0: 1
1: 1
2: 1
3: 23
4: 250
Right 1084741607 11:71143434-71143456 CCCGATGCGCGGGTTCCCACGGG 0: 1
1: 0
2: 0
3: 1
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084741607 Original CRISPR CCCGATGCGCGGGTTCCCAC GGG Intronic
910232103 1:84997463-84997485 CCCGAGGCGCGGTTGCACACCGG + Intergenic
912473670 1:109922870-109922892 GCCCATGCAGGGGTTCCCACTGG - Intronic
1063423979 10:5937150-5937172 CCCGATGCGCTGCTCCGCACAGG - Exonic
1063450051 10:6145072-6145094 CCCAAGGCTCGGGTACCCACAGG - Intronic
1076885711 10:133261538-133261560 CCCGATGCGCACGTTCCCTCTGG - Intergenic
1084741607 11:71143434-71143456 CCCGATGCGCGGGTTCCCACGGG + Intronic
1097048619 12:56206510-56206532 CCCCATGTGCTGGTTCTCACAGG + Exonic
1113116794 13:106882729-106882751 CCAGCAGCGCGGCTTCCCACAGG - Intergenic
1148464550 17:47857172-47857194 CCTGATGCCTGGGTTCCCCCAGG - Intergenic
1162029171 19:7909978-7910000 CCCCATACCGGGGTTCCCACCGG - Intronic
1163827590 19:19532388-19532410 CCCGAGGCGCGGGCGCCCTCTGG - Intronic
1168590857 19:57633343-57633365 AGCGATGCTCGGGTTCCCCCCGG + Exonic
926189921 2:10721155-10721177 CCTGTTGCGCGGCTCCCCACAGG + Intergenic
1168806820 20:676499-676521 CCCCCTGCTCGGGCTCCCACTGG + Intergenic
1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG + Intronic
952360431 3:32625648-32625670 CGCGCTGCCCGGGTTCCCGCTGG - Intergenic
953031198 3:39180977-39180999 CCCGCAGGGCGTGTTCCCACCGG - Intergenic
954664975 3:52246739-52246761 CCGGATGCACAGCTTCCCACAGG - Exonic
961346384 3:126266356-126266378 CAGGATGCCCTGGTTCCCACGGG + Intergenic
985674719 5:1224987-1225009 CCCGAAGCCCGGATTCCCGCAGG - Exonic
1015592130 6:134832308-134832330 CCCGATGAGCGAGATTCCACTGG - Intergenic
1017689069 6:156945210-156945232 CCGGATGCGGGGGCTCACACCGG - Intronic
1027024440 7:74840743-74840765 CCTGATGCACTGGTCCCCACGGG + Intronic
1027063325 7:75103379-75103401 CCTGATGCACTGGTCCCCACGGG - Intronic
1028778288 7:94705505-94705527 CGCGCAGCCCGGGTTCCCACTGG - Intergenic
1036638770 8:10569216-10569238 CCCAATCAGCGGGATCCCACAGG + Intergenic
1037819978 8:22130796-22130818 CCCGGGGCGCGTGTTCCCCCCGG - Exonic
1199699333 X:150364436-150364458 CCCGAGGCGCGTGTTTGCACAGG - Intronic