ID: 1084741715

View in Genome Browser
Species Human (GRCh38)
Location 11:71144311-71144333
Sequence GTTGCACCTGACTGCAGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 149}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084741715_1084741719 -1 Left 1084741715 11:71144311-71144333 CCTACTCTGCAGTCAGGTGCAAC 0: 1
1: 0
2: 2
3: 25
4: 149
Right 1084741719 11:71144333-71144355 CCTCCTCATGAAACCAGGGAAGG 0: 1
1: 0
2: 1
3: 13
4: 188
1084741715_1084741717 -5 Left 1084741715 11:71144311-71144333 CCTACTCTGCAGTCAGGTGCAAC 0: 1
1: 0
2: 2
3: 25
4: 149
Right 1084741717 11:71144329-71144351 GCAACCTCCTCATGAAACCAGGG 0: 1
1: 1
2: 0
3: 3
4: 220
1084741715_1084741716 -6 Left 1084741715 11:71144311-71144333 CCTACTCTGCAGTCAGGTGCAAC 0: 1
1: 0
2: 2
3: 25
4: 149
Right 1084741716 11:71144328-71144350 TGCAACCTCCTCATGAAACCAGG 0: 1
1: 0
2: 0
3: 6
4: 124
1084741715_1084741721 5 Left 1084741715 11:71144311-71144333 CCTACTCTGCAGTCAGGTGCAAC 0: 1
1: 0
2: 2
3: 25
4: 149
Right 1084741721 11:71144339-71144361 CATGAAACCAGGGAAGGTGATGG 0: 1
1: 0
2: 2
3: 28
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084741715 Original CRISPR GTTGCACCTGACTGCAGAGT AGG (reversed) Intronic
900573697 1:3372648-3372670 GTTGCACGTTACCGCAGACTTGG - Intronic
901133709 1:6979298-6979320 GCGGCAGCTGCCTGCAGAGTGGG - Intronic
903541228 1:24097444-24097466 GCTGCACCTGCCTGCAGAAAAGG + Intronic
904575567 1:31503103-31503125 GTTGCACTTCACTGCATAGAAGG - Intergenic
904695306 1:32327316-32327338 GTTGACCCTGGCTGTAGAGTAGG + Intronic
906054164 1:42901668-42901690 ATTGCATCTCACTGAAGAGTAGG + Intergenic
906732899 1:48098496-48098518 GAGGCACATGACTGCAGAGGAGG - Intergenic
907207655 1:52788100-52788122 GTTGCATGTGACTGGAGTGTAGG + Intronic
907353529 1:53853303-53853325 ACTGTCCCTGACTGCAGAGTAGG - Intronic
909277291 1:73703943-73703965 GTTCAACCTGACTGCAGAATGGG + Intergenic
912758495 1:112345274-112345296 GTTGCAGCTCACTGCACATTTGG + Intergenic
915065032 1:153217910-153217932 GTGGCACCTGTCTCCAAAGTGGG - Intronic
915741121 1:158119035-158119057 GGGGCCCTTGACTGCAGAGTGGG + Intergenic
916194913 1:162213571-162213593 GTTGGATATGACTGCAGATTGGG - Intronic
916512847 1:165488358-165488380 GTTGCACCTGACTGTAAAAGAGG - Intergenic
920822749 1:209396705-209396727 CTTGCAACTGACTCCAGAGCTGG + Intergenic
922370583 1:224906844-224906866 GCTGCAGGTGACTTCAGAGTGGG + Intronic
1063587388 10:7364837-7364859 GTGGCACCTGCGTGCAGAGTTGG + Intronic
1064068265 10:12202567-12202589 CTTGCAGCTGACATCAGAGTGGG - Intronic
1064396716 10:14988348-14988370 ATTGCTCCTGACAGTAGAGTGGG + Intergenic
1064399511 10:15009747-15009769 ATTGCTCCTGACAGCAGAGTGGG + Intergenic
1065640289 10:27775162-27775184 GTTCCACCTGAAGGCAGAGCTGG + Intergenic
1066324415 10:34342518-34342540 GTTTCACCTGACTGCATCATGGG - Intronic
1067571158 10:47372174-47372196 GTTGGAAATGACTGGAGAGTAGG + Intronic
1072419145 10:95274694-95274716 CATGCACCTTACTGCTGAGTAGG - Intronic
1076323053 10:129598022-129598044 GGTGGACCTGACTGCAGAGCAGG - Intronic
1076864152 10:133159237-133159259 GCTGCACCTGACTGCTGACTCGG + Intergenic
1077604727 11:3601517-3601539 ATTGCTCCTGACAGCAGAGTGGG + Intergenic
1078656287 11:13243566-13243588 GTGACAGCTGCCTGCAGAGTTGG - Intergenic
1084227192 11:67724330-67724352 ATTGCTCCTGACAGCAGAGTGGG + Intergenic
1084260625 11:67976102-67976124 ATTGCACCTGACAGCAGAGTCGG + Intergenic
1084679844 11:70660580-70660602 GTTGCACCTGGCAGCTGTGTGGG - Intronic
1084741715 11:71144311-71144333 GTTGCACCTGACTGCAGAGTAGG - Intronic
1084808006 11:71592518-71592540 ATTGCTCCTGACAGCAGAGTGGG - Intronic
1084812152 11:71619133-71619155 GTTGCTCCTGACAGCAGAGTGGG - Intergenic
1086100754 11:83097060-83097082 GCTGCACCTAACTGCAAAGGAGG - Intergenic
1089073900 11:115721703-115721725 GTTGCACATGCCTGCAGAGGGGG - Intergenic
1090416257 11:126542603-126542625 GGTGCACCTGACTGTAGCTTTGG - Intronic
1090939913 11:131378180-131378202 TTTCAACCTGACTGCAGATTAGG - Intronic
1091644813 12:2265447-2265469 CTTCCACCTTACTGCAGAGTGGG + Intronic
1091661358 12:2386133-2386155 GATGTCACTGACTGCAGAGTTGG - Intronic
1092211378 12:6648515-6648537 ATTGCACCTCACTGCAGCCTTGG - Intergenic
1092431881 12:8416653-8416675 ATTGCTCCTGACAGTAGAGTGGG + Intergenic
1092434834 12:8439269-8439291 ATTGCTCCTGACAGTAGAGTGGG + Intergenic
1100875572 12:98957899-98957921 GTTGCAACTGAGGGCAGATTAGG - Intronic
1101661421 12:106768946-106768968 CTTCCAACTGACTGCAAAGTAGG + Intronic
1102909950 12:116705687-116705709 GTTGCACGCCACTGCGGAGTTGG - Intergenic
1104035942 12:125097133-125097155 GTGCCACCTGCCTGCAGACTCGG + Intronic
1105818402 13:24057761-24057783 CTCCCACCTGACTGCAGTGTTGG - Intronic
1106140999 13:27011693-27011715 AGTGCACCTGACAGCAGAGTGGG - Intergenic
1107546880 13:41441709-41441731 ATTGCTCCTGACAGCAGAGTGGG + Intergenic
1108395924 13:49991458-49991480 GTTGCAGCTCACTGCAGCCTAGG - Intergenic
1111692969 13:91588283-91588305 GTAGCATATGACTGCAAAGTGGG - Intronic
1117039441 14:51756079-51756101 ATTGCTCCTGACAGCAGAGCGGG - Intergenic
1127766158 15:62187216-62187238 CTGGCACCTGACTGAAGAGCTGG + Intergenic
1128959473 15:71986448-71986470 GTGGCACATGACTGTAGAATGGG - Intronic
1130674021 15:85936760-85936782 GGTGCAGCTGAGTGGAGAGTGGG + Intergenic
1132258083 15:100395603-100395625 GCTGCACCTGTCTGCACAGCTGG + Intergenic
1133324191 16:4933458-4933480 ATTGAGCCTGACTGCAGAGCTGG + Intronic
1137566784 16:49538223-49538245 GCTGCACCTCGCTGGAGAGTTGG - Intronic
1137597911 16:49737128-49737150 ATTGCACCTACCTGCAGAATGGG - Intronic
1139967837 16:70755435-70755457 GTGTCACCTCACTGCAGAGCAGG - Intronic
1142309804 16:89305882-89305904 GTGGCACGTGTCTGCGGAGTGGG - Intronic
1142309920 16:89306415-89306437 GTGGCGCGTGTCTGCAGAGTGGG - Intronic
1142309969 16:89306656-89306678 GTGGCACGTGTCTGCACAGTGGG - Intronic
1142309973 16:89306681-89306703 GTGGCACGTGTCTGCGGAGTGGG - Intronic
1145764827 17:27451425-27451447 GTTACACCTGGCTGCAGGATAGG + Intergenic
1152044515 17:77927267-77927289 GTGGGACCTGACTCCAGAGGTGG - Intergenic
1160044633 18:75375478-75375500 GTTGCACCTGTCTGCATCTTGGG + Intergenic
1161040847 19:2110083-2110105 GGAGCCCCTGCCTGCAGAGTCGG + Intronic
1163826170 19:19526089-19526111 GTGTCCCCTGATTGCAGAGTGGG + Intronic
1165403796 19:35618115-35618137 GGAGCACCTGGCTGCAGAGCGGG + Exonic
1166976271 19:46606903-46606925 GTTGAACCTGACAGCAGAGCTGG - Intronic
1168324943 19:55533739-55533761 ACTGCATCTGGCTGCAGAGTGGG - Intronic
925655847 2:6148193-6148215 CTTGTTCCTGACTGCAGAGATGG + Intergenic
928101231 2:28438578-28438600 GAAACACCAGACTGCAGAGTTGG + Intergenic
929519499 2:42634737-42634759 GTTGAAAATGACTACAGAGTTGG - Intronic
931911221 2:66902331-66902353 GTTTCACCTGAATTTAGAGTTGG + Intergenic
931911371 2:66903623-66903645 GTTTCACCTGAATTTAGAGTTGG - Intergenic
932350585 2:71027987-71028009 ATTGCTCCTGACATCAGAGTGGG - Intergenic
932354085 2:71054247-71054269 ATTGCTCCTGACAGCAGAGTGGG - Intergenic
932485647 2:72082765-72082787 GCTGCACCTGCCTGCAGATGAGG - Intergenic
934590497 2:95545655-95545677 GTTGCTCCTGACATCAGAGTGGG - Intergenic
934592605 2:95569502-95569524 GTTTCACCAGTCTGCAGAATAGG - Intergenic
938143778 2:128817483-128817505 GAGGCACCTGGCTGCAGAGGAGG - Intergenic
942454015 2:176125335-176125357 GTTGCTCCAGAGTGTAGAGTTGG - Intergenic
943167295 2:184346031-184346053 GTTACATGTGACTGCAAAGTGGG - Intergenic
944568342 2:201015202-201015224 GTTGCACCTTTCTGAAGACTTGG - Intronic
945326591 2:208489247-208489269 GATGCACCTGTCTGGGGAGTTGG + Intronic
946510394 2:220349629-220349651 CCTGCTCCTGAATGCAGAGTGGG - Intergenic
948872508 2:240810655-240810677 GATGCAGATGAATGCAGAGTCGG + Intronic
1170958067 20:20999827-20999849 ATAGCTCCTTACTGCAGAGTAGG + Intergenic
1171141556 20:22748078-22748100 GTGGCACCTGACTTCAGAAGGGG - Intergenic
1171467584 20:25341463-25341485 GTTGAACCAGACTTCAGAGGTGG - Intronic
1176926619 21:14758050-14758072 GTTGAACCTTACTGCAGGGGTGG + Intergenic
1179492836 21:41752468-41752490 GGTGCTCCTGGCTGCAGAGAAGG - Intronic
1185416087 22:50711416-50711438 GTACCAACTGACTCCAGAGTTGG + Intergenic
949885192 3:8687257-8687279 ATTGCTCCTGACATCAGAGTGGG - Intronic
951283500 3:20780606-20780628 CTTGCATCTGATTTCAGAGTGGG - Intergenic
952750341 3:36820041-36820063 GTTGCAGCTTTCTGCAGGGTAGG + Intergenic
954322726 3:49843041-49843063 CTGGCACCTGGCTGCAGAGCAGG - Intronic
954997494 3:54894936-54894958 CTTGCACATGACTCCAAAGTTGG + Intronic
956000932 3:64729205-64729227 GTGGCTCCTGACTTCTGAGTTGG - Intergenic
957043773 3:75358370-75358392 ATTGCTCCTGACATCAGAGTGGG + Intergenic
957075572 3:75600525-75600547 ACTGCTCCTGACAGCAGAGTGGG + Intergenic
959562902 3:107802785-107802807 ATTCCACCTAACTGCAGGGTAGG - Intronic
959981819 3:112526067-112526089 ATTGCTCCTGACATCAGAGTGGG + Intergenic
960554545 3:119013005-119013027 GTTCTACATGACTGGAGAGTAGG - Intronic
961272866 3:125702436-125702458 ATTGCTCCTGACATCAGAGTGGG - Intergenic
961275610 3:125723606-125723628 ATTCCTCCTGACAGCAGAGTGGG - Intergenic
963079439 3:141377184-141377206 GTTGCTCCTGACTGCAGTGGTGG - Intronic
963779464 3:149472639-149472661 TTTGCACCTGCCTGGAGTGTTGG + Intergenic
963837695 3:150073753-150073775 GTTGCAGCTGACAGCAAGGTGGG + Intergenic
964139615 3:153381890-153381912 CATGCACCTGAGTGCGGAGTGGG - Intergenic
964425186 3:156545467-156545489 GTGTCATCTGACTCCAGAGTAGG - Intronic
965518203 3:169645070-169645092 GTTGCACCTGAGTGTACATTTGG - Intronic
966682036 3:182651956-182651978 GCTGCACTTGACTGCAGGGGAGG + Intergenic
966856980 3:184201144-184201166 GTTCTTCCTGACTCCAGAGTGGG - Intronic
968988234 4:3891174-3891196 ATTGCTCCTGACAGCAGAGTGGG + Intergenic
969019230 4:4128475-4128497 ATTGCTCCTGACAGCAGAGTGGG + Intergenic
969023865 4:4158351-4158373 ATTGCTCCTGACAGCAGAGTGGG + Intergenic
969489584 4:7491420-7491442 GCTGCACCTGCCTGCAGAGAGGG - Intronic
969734827 4:8980510-8980532 ATTGCTCCTGACAGCAGAGTGGG - Intergenic
969789559 4:9482829-9482851 ATTGCTCCAGACAGCAGAGTGGG - Intergenic
973549795 4:52022364-52022386 GTTACACTTGAATGCAGGGTTGG + Exonic
975374693 4:73630149-73630171 TTTGCAGCTGACTGGGGAGTGGG + Intergenic
980870318 4:138603742-138603764 GTTGCTCCTGACTGCTGTGCTGG - Intergenic
983179350 4:164630204-164630226 GTTGGACCTGCCTTCTGAGTTGG - Intergenic
988829242 5:34971388-34971410 GTTGGTCCTGTCTGCAGAGCTGG - Intergenic
993382929 5:87228614-87228636 GGTCCACCTCACTGCAGAGGTGG + Intergenic
993457642 5:88143891-88143913 AGGGCACCTGGCTGCAGAGTAGG - Intergenic
995026128 5:107424823-107424845 GCTGCTCCTGACTGCAGTGGTGG + Intronic
996445581 5:123545778-123545800 GTTGGACCTAACTTTAGAGTTGG + Exonic
998351684 5:141506010-141506032 GCTGCCCCTAACTCCAGAGTAGG + Intronic
1000703827 5:164486884-164486906 GTGGGACCAGACTGCAGATTTGG - Intergenic
1008930639 6:56935370-56935392 CGTGCAGCTCACTGCAGAGTGGG + Intronic
1010002183 6:70958353-70958375 GTTGCACCAGAACGCACAGTCGG - Intergenic
1012233343 6:96785466-96785488 GTTGCACCTTCCTGCAGTGGAGG - Intergenic
1016409501 6:143767236-143767258 TTTGCACCAGACTGCCCAGTTGG + Intronic
1018818521 6:167354706-167354728 GTGCCACCTGACAGCAGAGATGG + Intronic
1020306394 7:6838836-6838858 ACTGCTCCTGACAGCAGAGTGGG + Intergenic
1020310969 7:6868523-6868545 ATTGCTCCTGACAGCAGAGTGGG + Intergenic
1021940796 7:25677265-25677287 GCTGCCCGTGACTGCAGAGCGGG - Intergenic
1027262295 7:76473513-76473535 ACTGCACCTGACTGCAAAATGGG - Intronic
1027313676 7:76971610-76971632 ACTGCACCTGACTGCAAAATGGG - Intergenic
1032454822 7:132065384-132065406 GTTCCACCTGCCTGCAGCTTGGG + Intergenic
1033189356 7:139262802-139262824 GATTCACCTGACTCCAGAGTAGG + Intronic
1033339709 7:140482340-140482362 GTTGCATCTGAGTGGACAGTAGG - Intergenic
1035018165 7:155784348-155784370 GTCGCACCAGGCTGCAGAGCTGG + Intergenic
1035782063 8:2235452-2235474 ATTGCAACTAACTGCATAGTAGG - Intergenic
1035810057 8:2483967-2483989 ATTGCAACTAACTGCATAGTAGG + Intergenic
1036003443 8:4633907-4633929 GTTGGACCTTACTGGAGACTGGG + Intronic
1036767755 8:11559692-11559714 GTGGCATCTGGCTGCAAAGTGGG - Intronic
1036819660 8:11930442-11930464 ATTGCTCCTGACAGTAGAGTGGG + Intergenic
1036832849 8:12035492-12035514 ATTGCTCCTGACAGTAGAGTGGG + Intergenic
1037753879 8:21699291-21699313 GTGGCCGCTGGCTGCAGAGTCGG + Intronic
1038277265 8:26132177-26132199 TTTGCACCTGTCTGCAATGTTGG - Intergenic
1042704134 8:71648955-71648977 GTTGTACCTGACTCCACAGACGG + Intergenic
1043148616 8:76684361-76684383 CTTGCACCTGGCTTCAGTGTGGG + Intronic
1048099700 8:131337113-131337135 GTGGGAAATGACTGCAGAGTTGG - Intergenic
1050693199 9:8251696-8251718 TTTACACCTGTGTGCAGAGTGGG + Intergenic
1053576726 9:39362163-39362185 GTTGAACCTTATTTCAGAGTGGG - Intergenic
1053841235 9:42190088-42190110 GTTGAACCTTATTTCAGAGTGGG - Intergenic
1054098294 9:60920854-60920876 GTTGAACCTTATTTCAGAGTGGG - Intergenic
1054119695 9:61196484-61196506 GTTGAACCTTATTTCAGAGTGGG - Intergenic
1054588059 9:66986078-66986100 GTTGAACCTTATTTCAGAGTGGG + Intergenic
1055986079 9:82057271-82057293 GTTGAACCTTATTTCAGAGTGGG + Intergenic
1056043858 9:82695931-82695953 GTGGCACCTGACTGCAGGTAGGG + Intergenic
1056585256 9:87923861-87923883 GTTGAACCTTATTTCAGAGTGGG - Intergenic
1056611624 9:88129079-88129101 GTTGAACCTTATTTCAGAGTGGG + Intergenic
1056866460 9:90231217-90231239 ATTGCTCCTGACATCAGAGTGGG - Intergenic
1056916703 9:90753103-90753125 ATTGCTCCTGACATCAGAGTGGG + Intergenic
1059008220 9:110427521-110427543 GATGCTCCTGACTGCAGAGATGG - Intronic
1061673462 9:132202270-132202292 GAGGCACCTGGCTGCAGAGGAGG + Intronic
1061840270 9:133354699-133354721 GCTGAACCTGATTGCAGAGTTGG - Exonic
1190781919 X:53604984-53605006 GTTGTACCTGACTTCATATTTGG - Intronic
1199425212 X:147693114-147693136 CTTGCGCATGACTGGAGAGTGGG + Intergenic